ID: 1019340741

View in Genome Browser
Species Human (GRCh38)
Location 7:507710-507732
Sequence CATCCTCCCTGGTTATATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019340741_1019340751 17 Left 1019340741 7:507710-507732 CCAAAATATAACCAGGGAGGATG 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1019340751 7:507750-507772 GCAGAAACTGCGCCCCAGGGAGG 0: 1
1: 0
2: 2
3: 57
4: 587
1019340741_1019340752 25 Left 1019340741 7:507710-507732 CCAAAATATAACCAGGGAGGATG 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1019340752 7:507758-507780 TGCGCCCCAGGGAGGCACACAGG No data
1019340741_1019340749 13 Left 1019340741 7:507710-507732 CCAAAATATAACCAGGGAGGATG 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1019340749 7:507746-507768 AAAGGCAGAAACTGCGCCCCAGG No data
1019340741_1019340750 14 Left 1019340741 7:507710-507732 CCAAAATATAACCAGGGAGGATG 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1019340750 7:507747-507769 AAGGCAGAAACTGCGCCCCAGGG 0: 1
1: 1
2: 0
3: 9
4: 205
1019340741_1019340744 -5 Left 1019340741 7:507710-507732 CCAAAATATAACCAGGGAGGATG 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1019340744 7:507728-507750 GGATGCCAAGGCCCACCGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019340741 Original CRISPR CATCCTCCCTGGTTATATTT TGG (reversed) Intronic