ID: 1019340743

View in Genome Browser
Species Human (GRCh38)
Location 7:507721-507743
Sequence GTGGGCCTTGGCATCCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019340743_1019340749 2 Left 1019340743 7:507721-507743 CCAGGGAGGATGCCAAGGCCCAC No data
Right 1019340749 7:507746-507768 AAAGGCAGAAACTGCGCCCCAGG No data
1019340743_1019340756 21 Left 1019340743 7:507721-507743 CCAGGGAGGATGCCAAGGCCCAC No data
Right 1019340756 7:507765-507787 CAGGGAGGCACACAGGACAGAGG No data
1019340743_1019340757 22 Left 1019340743 7:507721-507743 CCAGGGAGGATGCCAAGGCCCAC No data
Right 1019340757 7:507766-507788 AGGGAGGCACACAGGACAGAGGG 0: 1
1: 3
2: 8
3: 68
4: 659
1019340743_1019340758 23 Left 1019340743 7:507721-507743 CCAGGGAGGATGCCAAGGCCCAC No data
Right 1019340758 7:507767-507789 GGGAGGCACACAGGACAGAGGGG No data
1019340743_1019340752 14 Left 1019340743 7:507721-507743 CCAGGGAGGATGCCAAGGCCCAC No data
Right 1019340752 7:507758-507780 TGCGCCCCAGGGAGGCACACAGG No data
1019340743_1019340750 3 Left 1019340743 7:507721-507743 CCAGGGAGGATGCCAAGGCCCAC No data
Right 1019340750 7:507747-507769 AAGGCAGAAACTGCGCCCCAGGG 0: 1
1: 1
2: 0
3: 9
4: 205
1019340743_1019340759 27 Left 1019340743 7:507721-507743 CCAGGGAGGATGCCAAGGCCCAC No data
Right 1019340759 7:507771-507793 GGCACACAGGACAGAGGGGATGG No data
1019340743_1019340751 6 Left 1019340743 7:507721-507743 CCAGGGAGGATGCCAAGGCCCAC No data
Right 1019340751 7:507750-507772 GCAGAAACTGCGCCCCAGGGAGG 0: 1
1: 0
2: 2
3: 57
4: 587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019340743 Original CRISPR GTGGGCCTTGGCATCCTCCC TGG (reversed) Intronic