ID: 1019340745

View in Genome Browser
Species Human (GRCh38)
Location 7:507733-507755
Sequence TTCTGCCTTTCGGTGGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 151}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019340745_1019340760 21 Left 1019340745 7:507733-507755 CCAAGGCCCACCGAAAGGCAGAA 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1019340760 7:507777-507799 CAGGACAGAGGGGATGGTGCTGG No data
1019340745_1019340750 -9 Left 1019340745 7:507733-507755 CCAAGGCCCACCGAAAGGCAGAA 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1019340750 7:507747-507769 AAGGCAGAAACTGCGCCCCAGGG 0: 1
1: 1
2: 0
3: 9
4: 205
1019340745_1019340751 -6 Left 1019340745 7:507733-507755 CCAAGGCCCACCGAAAGGCAGAA 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1019340751 7:507750-507772 GCAGAAACTGCGCCCCAGGGAGG 0: 1
1: 0
2: 2
3: 57
4: 587
1019340745_1019340756 9 Left 1019340745 7:507733-507755 CCAAGGCCCACCGAAAGGCAGAA 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1019340756 7:507765-507787 CAGGGAGGCACACAGGACAGAGG No data
1019340745_1019340749 -10 Left 1019340745 7:507733-507755 CCAAGGCCCACCGAAAGGCAGAA 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1019340749 7:507746-507768 AAAGGCAGAAACTGCGCCCCAGG No data
1019340745_1019340761 22 Left 1019340745 7:507733-507755 CCAAGGCCCACCGAAAGGCAGAA 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1019340761 7:507778-507800 AGGACAGAGGGGATGGTGCTGGG No data
1019340745_1019340758 11 Left 1019340745 7:507733-507755 CCAAGGCCCACCGAAAGGCAGAA 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1019340758 7:507767-507789 GGGAGGCACACAGGACAGAGGGG No data
1019340745_1019340757 10 Left 1019340745 7:507733-507755 CCAAGGCCCACCGAAAGGCAGAA 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1019340757 7:507766-507788 AGGGAGGCACACAGGACAGAGGG 0: 1
1: 3
2: 8
3: 68
4: 659
1019340745_1019340759 15 Left 1019340745 7:507733-507755 CCAAGGCCCACCGAAAGGCAGAA 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1019340759 7:507771-507793 GGCACACAGGACAGAGGGGATGG No data
1019340745_1019340752 2 Left 1019340745 7:507733-507755 CCAAGGCCCACCGAAAGGCAGAA 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1019340752 7:507758-507780 TGCGCCCCAGGGAGGCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019340745 Original CRISPR TTCTGCCTTTCGGTGGGCCT TGG (reversed) Intronic