ID: 1019340747

View in Genome Browser
Species Human (GRCh38)
Location 7:507740-507762
Sequence GCGCAGTTTCTGCCTTTCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019340747_1019340757 3 Left 1019340747 7:507740-507762 CCACCGAAAGGCAGAAACTGCGC No data
Right 1019340757 7:507766-507788 AGGGAGGCACACAGGACAGAGGG 0: 1
1: 3
2: 8
3: 68
4: 659
1019340747_1019340758 4 Left 1019340747 7:507740-507762 CCACCGAAAGGCAGAAACTGCGC No data
Right 1019340758 7:507767-507789 GGGAGGCACACAGGACAGAGGGG No data
1019340747_1019340752 -5 Left 1019340747 7:507740-507762 CCACCGAAAGGCAGAAACTGCGC No data
Right 1019340752 7:507758-507780 TGCGCCCCAGGGAGGCACACAGG No data
1019340747_1019340760 14 Left 1019340747 7:507740-507762 CCACCGAAAGGCAGAAACTGCGC No data
Right 1019340760 7:507777-507799 CAGGACAGAGGGGATGGTGCTGG No data
1019340747_1019340756 2 Left 1019340747 7:507740-507762 CCACCGAAAGGCAGAAACTGCGC No data
Right 1019340756 7:507765-507787 CAGGGAGGCACACAGGACAGAGG No data
1019340747_1019340761 15 Left 1019340747 7:507740-507762 CCACCGAAAGGCAGAAACTGCGC No data
Right 1019340761 7:507778-507800 AGGACAGAGGGGATGGTGCTGGG No data
1019340747_1019340765 29 Left 1019340747 7:507740-507762 CCACCGAAAGGCAGAAACTGCGC No data
Right 1019340765 7:507792-507814 GGTGCTGGGCTCATGCCAGGGGG No data
1019340747_1019340766 30 Left 1019340747 7:507740-507762 CCACCGAAAGGCAGAAACTGCGC No data
Right 1019340766 7:507793-507815 GTGCTGGGCTCATGCCAGGGGGG 0: 1
1: 0
2: 1
3: 29
4: 247
1019340747_1019340763 27 Left 1019340747 7:507740-507762 CCACCGAAAGGCAGAAACTGCGC No data
Right 1019340763 7:507790-507812 ATGGTGCTGGGCTCATGCCAGGG 0: 1
1: 0
2: 1
3: 28
4: 188
1019340747_1019340759 8 Left 1019340747 7:507740-507762 CCACCGAAAGGCAGAAACTGCGC No data
Right 1019340759 7:507771-507793 GGCACACAGGACAGAGGGGATGG No data
1019340747_1019340764 28 Left 1019340747 7:507740-507762 CCACCGAAAGGCAGAAACTGCGC No data
Right 1019340764 7:507791-507813 TGGTGCTGGGCTCATGCCAGGGG No data
1019340747_1019340762 26 Left 1019340747 7:507740-507762 CCACCGAAAGGCAGAAACTGCGC No data
Right 1019340762 7:507789-507811 GATGGTGCTGGGCTCATGCCAGG 0: 1
1: 0
2: 1
3: 29
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019340747 Original CRISPR GCGCAGTTTCTGCCTTTCGG TGG (reversed) Intronic