ID: 1019340749

View in Genome Browser
Species Human (GRCh38)
Location 7:507746-507768
Sequence AAAGGCAGAAACTGCGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019340745_1019340749 -10 Left 1019340745 7:507733-507755 CCAAGGCCCACCGAAAGGCAGAA 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1019340749 7:507746-507768 AAAGGCAGAAACTGCGCCCCAGG No data
1019340743_1019340749 2 Left 1019340743 7:507721-507743 CCAGGGAGGATGCCAAGGCCCAC No data
Right 1019340749 7:507746-507768 AAAGGCAGAAACTGCGCCCCAGG No data
1019340739_1019340749 16 Left 1019340739 7:507707-507729 CCTCCAAAATATAACCAGGGAGG 0: 1
1: 0
2: 2
3: 11
4: 123
Right 1019340749 7:507746-507768 AAAGGCAGAAACTGCGCCCCAGG No data
1019340741_1019340749 13 Left 1019340741 7:507710-507732 CCAAAATATAACCAGGGAGGATG 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1019340749 7:507746-507768 AAAGGCAGAAACTGCGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019340749 Original CRISPR AAAGGCAGAAACTGCGCCCC AGG Intronic