ID: 1019340754

View in Genome Browser
Species Human (GRCh38)
Location 7:507763-507785
Sequence TCTGTCCTGTGTGCCTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 304}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019340754_1019340765 6 Left 1019340754 7:507763-507785 CCCAGGGAGGCACACAGGACAGA 0: 1
1: 0
2: 5
3: 29
4: 304
Right 1019340765 7:507792-507814 GGTGCTGGGCTCATGCCAGGGGG No data
1019340754_1019340761 -8 Left 1019340754 7:507763-507785 CCCAGGGAGGCACACAGGACAGA 0: 1
1: 0
2: 5
3: 29
4: 304
Right 1019340761 7:507778-507800 AGGACAGAGGGGATGGTGCTGGG No data
1019340754_1019340768 19 Left 1019340754 7:507763-507785 CCCAGGGAGGCACACAGGACAGA 0: 1
1: 0
2: 5
3: 29
4: 304
Right 1019340768 7:507805-507827 TGCCAGGGGGGCTCATGCCAGGG No data
1019340754_1019340766 7 Left 1019340754 7:507763-507785 CCCAGGGAGGCACACAGGACAGA 0: 1
1: 0
2: 5
3: 29
4: 304
Right 1019340766 7:507793-507815 GTGCTGGGCTCATGCCAGGGGGG 0: 1
1: 0
2: 1
3: 29
4: 247
1019340754_1019340764 5 Left 1019340754 7:507763-507785 CCCAGGGAGGCACACAGGACAGA 0: 1
1: 0
2: 5
3: 29
4: 304
Right 1019340764 7:507791-507813 TGGTGCTGGGCTCATGCCAGGGG No data
1019340754_1019340760 -9 Left 1019340754 7:507763-507785 CCCAGGGAGGCACACAGGACAGA 0: 1
1: 0
2: 5
3: 29
4: 304
Right 1019340760 7:507777-507799 CAGGACAGAGGGGATGGTGCTGG No data
1019340754_1019340767 18 Left 1019340754 7:507763-507785 CCCAGGGAGGCACACAGGACAGA 0: 1
1: 0
2: 5
3: 29
4: 304
Right 1019340767 7:507804-507826 ATGCCAGGGGGGCTCATGCCAGG 0: 1
1: 0
2: 1
3: 11
4: 178
1019340754_1019340769 20 Left 1019340754 7:507763-507785 CCCAGGGAGGCACACAGGACAGA 0: 1
1: 0
2: 5
3: 29
4: 304
Right 1019340769 7:507806-507828 GCCAGGGGGGCTCATGCCAGGGG 0: 1
1: 0
2: 0
3: 17
4: 382
1019340754_1019340762 3 Left 1019340754 7:507763-507785 CCCAGGGAGGCACACAGGACAGA 0: 1
1: 0
2: 5
3: 29
4: 304
Right 1019340762 7:507789-507811 GATGGTGCTGGGCTCATGCCAGG 0: 1
1: 0
2: 1
3: 29
4: 235
1019340754_1019340763 4 Left 1019340754 7:507763-507785 CCCAGGGAGGCACACAGGACAGA 0: 1
1: 0
2: 5
3: 29
4: 304
Right 1019340763 7:507790-507812 ATGGTGCTGGGCTCATGCCAGGG 0: 1
1: 0
2: 1
3: 28
4: 188
1019340754_1019340771 21 Left 1019340754 7:507763-507785 CCCAGGGAGGCACACAGGACAGA 0: 1
1: 0
2: 5
3: 29
4: 304
Right 1019340771 7:507807-507829 CCAGGGGGGCTCATGCCAGGGGG 0: 1
1: 0
2: 1
3: 23
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019340754 Original CRISPR TCTGTCCTGTGTGCCTCCCT GGG (reversed) Intronic