ID: 1019340759

View in Genome Browser
Species Human (GRCh38)
Location 7:507771-507793
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019340748_1019340759 5 Left 1019340748 7:507743-507765 CCGAAAGGCAGAAACTGCGCCCC No data
Right 1019340759 7:507771-507793 GGCACACAGGACAGAGGGGATGG No data
1019340747_1019340759 8 Left 1019340747 7:507740-507762 CCACCGAAAGGCAGAAACTGCGC No data
Right 1019340759 7:507771-507793 GGCACACAGGACAGAGGGGATGG No data
1019340745_1019340759 15 Left 1019340745 7:507733-507755 CCAAGGCCCACCGAAAGGCAGAA 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1019340759 7:507771-507793 GGCACACAGGACAGAGGGGATGG No data
1019340743_1019340759 27 Left 1019340743 7:507721-507743 CCAGGGAGGATGCCAAGGCCCAC No data
Right 1019340759 7:507771-507793 GGCACACAGGACAGAGGGGATGG No data
1019340746_1019340759 9 Left 1019340746 7:507739-507761 CCCACCGAAAGGCAGAAACTGCG No data
Right 1019340759 7:507771-507793 GGCACACAGGACAGAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type