ID: 1019340760

View in Genome Browser
Species Human (GRCh38)
Location 7:507777-507799
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019340755_1019340760 -10 Left 1019340755 7:507764-507786 CCAGGGAGGCACACAGGACAGAG 0: 1
1: 1
2: 2
3: 80
4: 486
Right 1019340760 7:507777-507799 CAGGACAGAGGGGATGGTGCTGG No data
1019340753_1019340760 -8 Left 1019340753 7:507762-507784 CCCCAGGGAGGCACACAGGACAG 0: 1
1: 0
2: 2
3: 41
4: 381
Right 1019340760 7:507777-507799 CAGGACAGAGGGGATGGTGCTGG No data
1019340745_1019340760 21 Left 1019340745 7:507733-507755 CCAAGGCCCACCGAAAGGCAGAA 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1019340760 7:507777-507799 CAGGACAGAGGGGATGGTGCTGG No data
1019340746_1019340760 15 Left 1019340746 7:507739-507761 CCCACCGAAAGGCAGAAACTGCG No data
Right 1019340760 7:507777-507799 CAGGACAGAGGGGATGGTGCTGG No data
1019340747_1019340760 14 Left 1019340747 7:507740-507762 CCACCGAAAGGCAGAAACTGCGC No data
Right 1019340760 7:507777-507799 CAGGACAGAGGGGATGGTGCTGG No data
1019340748_1019340760 11 Left 1019340748 7:507743-507765 CCGAAAGGCAGAAACTGCGCCCC No data
Right 1019340760 7:507777-507799 CAGGACAGAGGGGATGGTGCTGG No data
1019340754_1019340760 -9 Left 1019340754 7:507763-507785 CCCAGGGAGGCACACAGGACAGA 0: 1
1: 0
2: 5
3: 29
4: 304
Right 1019340760 7:507777-507799 CAGGACAGAGGGGATGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type