ID: 1019340789

View in Genome Browser
Species Human (GRCh38)
Location 7:507875-507897
Sequence CCCCTCCTTCCCTGACCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 946
Summary {0: 1, 1: 0, 2: 9, 3: 89, 4: 847}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019340781_1019340789 5 Left 1019340781 7:507847-507869 CCTGGAGGCCTGAGTTAGGCCCT 0: 1
1: 0
2: 3
3: 28
4: 337
Right 1019340789 7:507875-507897 CCCCTCCTTCCCTGACCCCCCGG 0: 1
1: 0
2: 9
3: 89
4: 847
1019340782_1019340789 -3 Left 1019340782 7:507855-507877 CCTGAGTTAGGCCCTCCCCTCCC 0: 1
1: 0
2: 3
3: 24
4: 260
Right 1019340789 7:507875-507897 CCCCTCCTTCCCTGACCCCCCGG 0: 1
1: 0
2: 9
3: 89
4: 847
1019340778_1019340789 16 Left 1019340778 7:507836-507858 CCACACCTGGACCTGGAGGCCTG 0: 1
1: 0
2: 1
3: 47
4: 313
Right 1019340789 7:507875-507897 CCCCTCCTTCCCTGACCCCCCGG 0: 1
1: 0
2: 9
3: 89
4: 847
1019340779_1019340789 11 Left 1019340779 7:507841-507863 CCTGGACCTGGAGGCCTGAGTTA 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1019340789 7:507875-507897 CCCCTCCTTCCCTGACCCCCCGG 0: 1
1: 0
2: 9
3: 89
4: 847
1019340775_1019340789 21 Left 1019340775 7:507831-507853 CCCAGCCACACCTGGACCTGGAG 0: 1
1: 0
2: 2
3: 32
4: 271
Right 1019340789 7:507875-507897 CCCCTCCTTCCCTGACCCCCCGG 0: 1
1: 0
2: 9
3: 89
4: 847
1019340776_1019340789 20 Left 1019340776 7:507832-507854 CCAGCCACACCTGGACCTGGAGG 0: 1
1: 0
2: 1
3: 41
4: 335
Right 1019340789 7:507875-507897 CCCCTCCTTCCCTGACCCCCCGG 0: 1
1: 0
2: 9
3: 89
4: 847
1019340772_1019340789 30 Left 1019340772 7:507822-507844 CCAGGGGGACCCAGCCACACCTG 0: 1
1: 0
2: 2
3: 40
4: 413
Right 1019340789 7:507875-507897 CCCCTCCTTCCCTGACCCCCCGG 0: 1
1: 0
2: 9
3: 89
4: 847

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019340789 Original CRISPR CCCCTCCTTCCCTGACCCCC CGG Intronic
900286116 1:1901468-1901490 CCCCGCATTCCCTGGACCCCTGG - Intergenic
900437847 1:2639977-2639999 CCCCTCCCTGCCTGACCCCCTGG + Intronic
900464852 1:2820662-2820684 CCCCTGGTCCCCTGAACCCCTGG - Intergenic
901059905 1:6467205-6467227 CCCCACCTTCCCAGTCCCACAGG - Exonic
901066668 1:6497532-6497554 CCCCTCCCTCCCCGGCTCCCCGG + Intronic
901131483 1:6964227-6964249 CCACTCCTACCCAGACCTCCAGG - Intronic
901177768 1:7317133-7317155 GCCTTCCTTCCCTGTACCCCCGG - Intronic
901201840 1:7471619-7471641 CTGCTCCTCCCCTGACCCACTGG - Intronic
901529464 1:9844123-9844145 CCCCTTATTGCCTGAACCCCAGG + Intergenic
901630162 1:10644115-10644137 CCCCTGCTGCCCTGACCACCAGG + Intronic
901770666 1:11528965-11528987 CCTGTCCTCCCCTGAGCCCCAGG + Intronic
901798048 1:11691823-11691845 CCCCTCCTCCCCCTACCCGCCGG + Exonic
901838710 1:11940351-11940373 CCCCTTTATTCCTGACCCCCAGG + Intronic
902330571 1:15729256-15729278 CACCTCCACCCCTGACCCCCAGG - Intronic
902374249 1:16022851-16022873 CCCTTCCCTCCCTGCCACCCAGG - Intronic
902379200 1:16044728-16044750 CCCTTCCCTCCCTGCCACCCAGG - Intronic
902548403 1:17204993-17205015 CACCTCCTCCCCTGACCTCCTGG + Intergenic
902569790 1:17339836-17339858 CCCCTCCTGCCCTGGCCAACGGG + Intronic
902932533 1:19741625-19741647 CCCCTCCTTCCTTGCCCACCTGG + Intronic
903139778 1:21332586-21332608 CCCCTCCTCCCCCCTCCCCCTGG - Intronic
903339353 1:22644148-22644170 CCCATCCTTCCCTGGTGCCCCGG - Exonic
903676626 1:25068477-25068499 CCGACCCTTCCCTGATCCCCAGG - Intergenic
903864734 1:26389799-26389821 CCCCTCCTTCCCTCAGCCTGTGG - Intergenic
903968202 1:27102638-27102660 CCCCTCCCTGCCTGCCCACCAGG + Intronic
904605779 1:31696845-31696867 CCCCTCCTGCCCTGGGCCCATGG + Intronic
904713263 1:32447767-32447789 CCCCTCCTTCCCCTTCCCCTAGG + Intergenic
905145181 1:35882860-35882882 CACTTCATTCCCAGACCCCCTGG - Intronic
905186945 1:36203720-36203742 TTCCTCCTTACCTCACCCCCTGG - Intergenic
905390765 1:37634303-37634325 CCCCTCCATCCCGCAGCCCCGGG - Intronic
905548705 1:38818946-38818968 CCCGTCCTTCACTGAGACCCGGG + Intergenic
905774641 1:40660753-40660775 CCCCTCCCTCCCTACCTCCCGGG - Intronic
905815748 1:40949436-40949458 TCCCTCCTTACCTCACTCCCTGG - Intergenic
906031124 1:42720947-42720969 CCCCTTCTCCCCTAACCCCATGG + Intergenic
906126806 1:43431940-43431962 CCCGTCCTTCCCTGGGCCCCAGG + Intronic
906511197 1:46411298-46411320 TCACTCCTTCCCTTACCACCAGG + Intronic
906580489 1:46931262-46931284 CCTCTCCCTCCCAGGCCCCCAGG + Intronic
906727730 1:48055991-48056013 CTCCTCCTCCCCACACCCCCTGG + Intergenic
906961101 1:50419901-50419923 CCCCTACAGCCCTGACCCCAGGG + Intronic
907473563 1:54690296-54690318 TCCCTCCCACCCTGACCCCAAGG - Intronic
908173035 1:61526854-61526876 CCTCTCCTTCCCCTACCCTCTGG + Intergenic
908916870 1:69138251-69138273 CCCCTCCATCCCTGAACCACTGG - Intergenic
908971792 1:69844353-69844375 TCCCTCCTCCCCTCAGCCCCTGG + Intronic
909547907 1:76868103-76868125 CCCCTCCTTTCCTGGGGCCCTGG - Intronic
910490664 1:87765913-87765935 CCCCTACTTCCCAGCTCCCCAGG + Intergenic
910573897 1:88737068-88737090 CCACCCCTTCCCTCAACCCCAGG - Intronic
911517985 1:98891592-98891614 CCCCTTCCACCCTCACCCCCAGG - Exonic
911685563 1:100773044-100773066 TCCCTTCTTCCCTTAGCCCCTGG + Intergenic
912551998 1:110490524-110490546 CCCCACCCTCCCTGACACCTTGG - Intergenic
912616167 1:111102170-111102192 CCCCCACTTCCCTGACAACCTGG - Intergenic
913195399 1:116452354-116452376 ACCCTGCTCCCCTGACCCACAGG - Intergenic
913327361 1:117638555-117638577 CTCATCCTTCCCTGACCTCCAGG - Intergenic
915279784 1:154814506-154814528 GTCCCCCTTCCCTGACCCCAGGG - Intronic
915311040 1:155005899-155005921 CCCCTTCCTCCCAGTCCCCCGGG - Intronic
915393253 1:155562838-155562860 CCCCCCCTTCCCCGCCCCCACGG + Intergenic
915519161 1:156431190-156431212 CCCCTTCCTCCCTTATCCCCTGG - Intergenic
915565528 1:156710720-156710742 CCCCTCCTACCCTGCCTCCTAGG - Intergenic
915588211 1:156856542-156856564 ACCTTTCTTCCCTGACCCTCTGG + Intronic
915600676 1:156921196-156921218 CCCCTGATGCCCTCACCCCCTGG - Intronic
915684345 1:157616584-157616606 TCCTTCCTCTCCTGACCCCCTGG - Intergenic
915769484 1:158404906-158404928 CCCCTCCTTCTCTGAATCCTTGG - Intergenic
916059644 1:161089670-161089692 TCCCTCCTTCCCTCCCTCCCTGG - Intergenic
916452311 1:164932772-164932794 CCCCTCCTCCCCTGACTACTTGG + Intergenic
916483251 1:165234503-165234525 CCTCTCTTTTCCAGACCCCCAGG - Intronic
917674409 1:177305341-177305363 CCTCCCCTTACCAGACCCCCTGG + Intergenic
917795136 1:178527898-178527920 CCCCTTCTTCTCTGAGCTCCAGG + Intronic
917981879 1:180274591-180274613 CCCCACCCTACCTGCCCCCCTGG + Exonic
918001699 1:180502824-180502846 GGCCTCCTTCCCCCACCCCCGGG - Exonic
918076599 1:181175598-181175620 CCGCCCCTCCCCTGACCCTCAGG + Intergenic
918104187 1:181402345-181402367 CACCTCTTTCCCTGGCCCCTGGG - Intergenic
918415203 1:184299006-184299028 CCCCTCTATTCCTGACCACCTGG - Intergenic
919749619 1:201028972-201028994 ACCCTCCTCCCCTGCCCCACAGG - Intergenic
919924253 1:202184261-202184283 CCCCTCCTTCATTCAGCCCCAGG - Intergenic
919928659 1:202207252-202207274 CCCCTCCTGCCCTAGCCCCTAGG - Intronic
920094968 1:203480688-203480710 CCTCCCCTTCCCTCAGCCCCAGG - Intronic
920176135 1:204103019-204103041 CCTCTCCCTCCCTGCCCCCAGGG - Intronic
920698718 1:208201586-208201608 CCACTTCTTCCCTGGCTCCCTGG - Intronic
921191098 1:212709293-212709315 CCTCTCCTTCCCTGTCTCCAAGG + Intergenic
921217652 1:212951110-212951132 CCCCTCCATCCCCAACCCCCCGG + Intronic
921866717 1:220094289-220094311 CCCCGCCTTCCCTGCAGCCCGGG + Exonic
922178413 1:223215078-223215100 CCTCTCCATCCCCAACCCCCAGG + Intergenic
922315135 1:224434913-224434935 GCCTCCCTCCCCTGACCCCCGGG - Intronic
922696935 1:227735596-227735618 GCCCTCCTTCCCGCATCCCCGGG + Intronic
923226369 1:231942069-231942091 TCCCTCTTTCCCTCATCCCCTGG - Intronic
923299943 1:232630943-232630965 CCCCTTCCTCCCTGCCCTCCAGG + Intergenic
923361863 1:233219442-233219464 CCCCTTGTTCCCTGACCCTGTGG - Intronic
923519670 1:234725899-234725921 CCAGTCCTTCCCTGCCTCCCCGG + Intergenic
924286100 1:242488573-242488595 CCCTTCCTCCCCTGAGCCCTTGG - Intronic
924494700 1:244575740-244575762 CCTCTCCTTCCCTTTCCCCTAGG + Intronic
1062833850 10:623607-623629 CCCCTCCTCCCCTCAGCCCTCGG - Intronic
1062833884 10:623702-623724 CCCCTCCTCCCCTCAGCCCTCGG - Intronic
1063692126 10:8296860-8296882 CCCCTCCTTCTCTGTCATCCAGG + Intergenic
1063953177 10:11242910-11242932 CGCCTCCGTCCCTGTCGCCCTGG - Intronic
1064437617 10:15325086-15325108 TTCCTCCTTCCCTGACAGCCAGG + Intronic
1065960722 10:30732144-30732166 CTCCTCTTTCCTTGGCCCCCAGG - Intergenic
1066433909 10:35379277-35379299 GGCTTCCTTCCCTGCCCCCCTGG + Intronic
1066484647 10:35831619-35831641 TCCCTCCTCCCCTGAACCGCTGG + Intergenic
1067028676 10:42866028-42866050 CCCCACCCTCCCTGCCCTCCTGG + Intergenic
1067040342 10:42949736-42949758 CCCATCCTGCCCTTAACCCCTGG - Intergenic
1067330298 10:45309425-45309447 CCAAACCTTCCCTGACTCCCTGG + Intronic
1067488135 10:46672010-46672032 TCCCTCCCTCCCTCAGCCCCTGG - Intergenic
1067660687 10:48234546-48234568 CCCCTCCTTTCCTGTCCCCAGGG - Intronic
1068114486 10:52722329-52722351 TCCCTCCTTCCCCTACCCTCTGG - Intergenic
1068544102 10:58327163-58327185 TCGCTCCTTCCCTGGCCTCCCGG + Intergenic
1068545128 10:58335651-58335673 CCCCACCTTCCTTGCCCTCCCGG - Intronic
1069149169 10:64933981-64934003 CCCCTCCTGCCCCATCCCCCTGG + Intergenic
1069291750 10:66788618-66788640 CTCCTCCTTCCATCAACCCCAGG + Intronic
1069325268 10:67225104-67225126 CCCCCACTTCCCTGACAACCTGG + Intronic
1069884700 10:71616286-71616308 GGCCTCCTTCCCAGAGCCCCTGG - Intronic
1069933749 10:71901016-71901038 GCCCTCCGTCCCCGATCCCCAGG + Intergenic
1069988047 10:72297667-72297689 TCCCTCCTTCCCGCTCCCCCGGG + Intergenic
1070353019 10:75611527-75611549 CCCCTCCTCCCCTCAGCCCCAGG + Intronic
1070539465 10:77405951-77405973 CCCCAGCTTCCCTGAGCCACAGG - Intronic
1070553789 10:77512935-77512957 CCACTCCTGCCCTTACTCCCTGG + Intronic
1070691673 10:78531702-78531724 TCCCTCCAACCCTGACCCCATGG - Intergenic
1070813725 10:79311039-79311061 CTCCTCCTTCCCAGCCTCCCCGG + Exonic
1070914602 10:80144798-80144820 CCCTTCCCTCCCCGGCCCCCAGG - Intronic
1071622233 10:87131370-87131392 TCCCTCCCTCCCTCAGCCCCTGG + Intronic
1071931132 10:90471725-90471747 CCACCACTTCCCTGACCTCCTGG + Intergenic
1072591550 10:96832525-96832547 TCCCCCCTTCCCCCACCCCCCGG + Intronic
1072802776 10:98404981-98405003 CCCCTCCCTCACTGACCTTCTGG - Intronic
1073243901 10:102075909-102075931 CCCCTGCCTCCTTGACCCCTTGG - Intergenic
1073505975 10:103990171-103990193 CCCCTCCTTCCTCCAACCCCTGG - Intronic
1074857057 10:117481368-117481390 CCCCTCCATCACTGAGTCCCAGG - Intergenic
1074970298 10:118531098-118531120 CCCCACCTTCCATGTTCCCCTGG + Intergenic
1075112667 10:119599981-119600003 TCTCTCCTTCCCTGATGCCCAGG - Intergenic
1075341008 10:121646805-121646827 TCCCTCCTCCCCTCGCCCCCAGG - Intergenic
1075429523 10:122368907-122368929 GCGTGCCTTCCCTGACCCCCTGG - Intergenic
1075501091 10:122974730-122974752 TCCCTCCTTCTCTTAGCCCCAGG - Intronic
1076202948 10:128572805-128572827 CCCATCCTTCCTGGCCCCCCAGG + Intergenic
1076305334 10:129462076-129462098 CCCCCCCTCCCCTGCCCCACTGG - Intergenic
1076370253 10:129948387-129948409 CTCCCCCTTTCCTGAACCCCTGG - Intronic
1076635030 10:131876149-131876171 CCCCTCCGATCCTGGCCCCCAGG - Intergenic
1076875171 10:133212388-133212410 ACCCTCCTCCCCTGAGCACCCGG - Intronic
1076888334 10:133272604-133272626 CGCCACCCTGCCTGACCCCCAGG - Intronic
1076990609 11:271427-271449 AGCCTCCCTCCCTGGCCCCCAGG - Intergenic
1076994276 11:290589-290611 CCCCTCCTTACCGGGCTCCCTGG - Exonic
1077173460 11:1178560-1178582 CCCCTCCTGCCCAGATGCCCTGG + Intronic
1077184128 11:1228852-1228874 GCCCTCCACCCCTGTCCCCCAGG - Intronic
1077186342 11:1237041-1237063 CCCCTCCTGCCCGGACGCCCTGG + Exonic
1077264685 11:1642819-1642841 TCCCTCCTTCCCTCCCTCCCAGG + Intergenic
1077340996 11:2026257-2026279 CCCCTCCTGGACTGTCCCCCGGG - Intergenic
1077487902 11:2847455-2847477 CTCCTCCTTCTCTGCTCCCCAGG - Intronic
1077490937 11:2860680-2860702 CCCCTCCTTCCCCTACCACAAGG - Intergenic
1077635987 11:3841353-3841375 CCGCCCCTGCCCTGAGCCCCGGG + Intergenic
1077722634 11:4643732-4643754 CCTCTCCTCCCCATACCCCCAGG + Exonic
1078339521 11:10488873-10488895 CTCCAGCCTCCCTGACCCCCTGG + Intronic
1078431102 11:11289506-11289528 TCCCTCCTTCCCTTATCCCAGGG - Intronic
1080369398 11:31617409-31617431 TCCCTCTTTCCCTCAACCCCTGG - Intronic
1080459023 11:32437755-32437777 CCCCTACATCCCTCACCCCGGGG - Intergenic
1080701303 11:34646622-34646644 CCCCGCCGTCCCTGCCGCCCGGG - Exonic
1081871214 11:46383369-46383391 CTTCTCCTTCCCTGATGCCCGGG + Intronic
1081990327 11:47333891-47333913 GGCCCCCTTCCCTGTCCCCCAGG - Intronic
1082100684 11:48170407-48170429 CCCCTCGATCCCCAACCCCCGGG - Intronic
1082810648 11:57477060-57477082 CCTCTCCTTGCCTGCCCCCTGGG + Exonic
1082828323 11:57597650-57597672 CCCCACCCTCCCTGACCCTGGGG + Exonic
1083159863 11:60848292-60848314 CCCCTCCGTCCCTGTCCCTGAGG - Intronic
1083259579 11:61515949-61515971 GTCCTCCTGCCTTGACCCCCAGG + Intronic
1083339846 11:61951979-61952001 CACATCCTTCCCAGGCCCCCCGG - Intronic
1083399073 11:62411523-62411545 CCCCTCCCTCCCTGAAACCCTGG + Intronic
1083631390 11:64097238-64097260 CCCCTCCCTACCTGCCCCACTGG - Intronic
1083827618 11:65212178-65212200 CCCCTCCTTCCCAACCTCCCAGG - Intergenic
1084003917 11:66313476-66313498 CCCCTCCTTTCCTGGTTCCCTGG + Intergenic
1084026302 11:66452250-66452272 CCTCTGCTTCCCTGTCCCCCAGG - Intronic
1084165595 11:67373440-67373462 CCCGTCCTGCCCTGACCCCCGGG - Intronic
1084165679 11:67373768-67373790 CCCCTCCTACCCCCACCCCGGGG - Intronic
1084179539 11:67439521-67439543 CCACTCCCTCCCTGACTGCCTGG + Intronic
1084314700 11:68338484-68338506 CCCCTCCTGCCTTGAGTCCCAGG - Intronic
1084317694 11:68354905-68354927 CCCCTCTTACCCTGTCCCCACGG + Intronic
1084418241 11:69046705-69046727 CTCCTCATTCCCTCAGCCCCTGG - Intergenic
1084461731 11:69300016-69300038 CGCCACCCTCCCTGACCCTCTGG + Intronic
1084489162 11:69468963-69468985 TCCCTCCTTCCCTTCCCCACCGG - Intergenic
1084735972 11:71105632-71105654 CCTCTTCATCCCTGAGCCCCTGG - Intronic
1084756226 11:71240508-71240530 CCCCTTCTTGCTTGGCCCCCTGG - Intronic
1084990740 11:72922949-72922971 CCCTTCCTTCCCCCAGCCCCTGG + Intronic
1085047308 11:73360986-73361008 CCCTTCCTCCCCTGCCCCTCAGG - Intronic
1085174564 11:74474653-74474675 CCCCTCCTTCCAGGAGCTCCTGG - Intergenic
1085603004 11:77872273-77872295 CACCTCCCACCCTGACCCCTTGG - Exonic
1086740194 11:90358174-90358196 CTCTTCCCTCCCTGAACCCCTGG - Intergenic
1087691163 11:101321611-101321633 CACCACCCTCCCTGGCCCCCAGG - Intergenic
1087970219 11:104471765-104471787 TCCCTCCTTCCCTCAAGCCCTGG - Intergenic
1088978001 11:114832980-114833002 CCCCTCTTCCCCTGCCCCCCAGG - Intergenic
1089079582 11:115764548-115764570 CCCTTCCTCCCCTGCCCCCATGG - Intergenic
1089399179 11:118154443-118154465 CCCCACCTGCCCTGCCCCCTTGG - Intergenic
1089462786 11:118662544-118662566 TCTCTCCTTCCCTGAGCTCCTGG - Intronic
1089466793 11:118690799-118690821 GCTCTCCTTCCCTGAGCTCCTGG + Intergenic
1089517773 11:119044679-119044701 TCCCTCACCCCCTGACCCCCTGG - Exonic
1089620941 11:119721808-119721830 ACACTGCTTCCCTGGCCCCCAGG + Intronic
1089690375 11:120183317-120183339 ACACTCCTTCCCTGAACCCAAGG - Intronic
1089810724 11:121129277-121129299 CCCCTCCTTCCCTGCCTTTCTGG - Intronic
1090365695 11:126203538-126203560 TTCCTCCTTCCCGGACCCCAGGG + Exonic
1090668621 11:128930875-128930897 CCCCAGCCTCCCTAACCCCCTGG - Intergenic
1090718669 11:129452977-129452999 CCTCTCCTCCCCTGAATCCCCGG + Intergenic
1090799413 11:130161006-130161028 CCCCTCCTTCCGGGTGCCCCTGG + Intronic
1090853673 11:130593118-130593140 CCCCTCCTCCACAGACCCTCTGG - Intergenic
1091084983 11:132712795-132712817 CCTCTCCTTCCCTGACCACCAGG - Intronic
1202823981 11_KI270721v1_random:81446-81468 CCCCTCCTGGACTGTCCCCCGGG - Intergenic
1091393437 12:139394-139416 CTCCTCCTTCCCTCCCTCCCAGG - Intronic
1091688235 12:2578790-2578812 CCCCTGCCTCCCTCAACCCCTGG - Intronic
1091771166 12:3152226-3152248 GCCCTCCTTGCCTGGCCACCAGG + Intronic
1091803891 12:3342515-3342537 TTCCACCTTCCCAGACCCCCAGG + Intergenic
1092180460 12:6443275-6443297 CTGCTCCTGCTCTGACCCCCTGG + Intergenic
1092195709 12:6548560-6548582 CCCCGCCCGCCCTGACACCCGGG - Intronic
1092630681 12:10372782-10372804 CTCTTCCTTCACTGATCCCCTGG + Exonic
1094493368 12:30975173-30975195 CCCAGCCTTTCCTGACTCCCTGG - Intronic
1095497690 12:42802471-42802493 CCCTTCCTAACCTGACCCTCAGG - Intergenic
1095628360 12:44344516-44344538 CACCTCCTTGCGTGACCACCTGG - Intronic
1096103265 12:48981920-48981942 CCCATCCTTCTCTCACCTCCTGG - Intergenic
1096210714 12:49763516-49763538 CCACCCCTTGCCTGACCCTCAGG + Exonic
1096513235 12:52143427-52143449 CCCCTCCATCACTGAGCCCGAGG + Intergenic
1096518603 12:52171713-52171735 CCCCCCCGTCCCCCACCCCCAGG - Exonic
1096607689 12:52778248-52778270 CCCCTCCCTGCTTTACCCCCTGG + Intergenic
1096717276 12:53499238-53499260 CCCTTCCTTCCCAGCCCCACAGG + Intronic
1096749222 12:53748114-53748136 CCCCTCCCTGCCTGCTCCCCTGG - Intergenic
1096789982 12:54038577-54038599 CCCCTCCCTCCCTCACTACCAGG + Intronic
1096866824 12:54569410-54569432 CCCCTCTTTCCCAGCCACCCTGG + Intronic
1097161202 12:57047863-57047885 CCCTTCCTTCCCTGGCCTTCTGG - Intronic
1097763654 12:63498280-63498302 TCTCTCATCCCCTGACCCCCTGG + Intergenic
1098682102 12:73369408-73369430 TCCCTCCTTCCCCCAGCCCCAGG + Intergenic
1099439832 12:82686800-82686822 CTCCTCCTACCCTGCCCCTCGGG - Intergenic
1099812745 12:87605512-87605534 TGTCTCCTTCCCTGTCCCCCAGG - Intergenic
1101827482 12:108231868-108231890 CTCCTCTTTTCCTGACTCCCTGG - Intronic
1102025905 12:109714258-109714280 CTCCTCCTGCTCTGAGCCCCGGG - Exonic
1102083652 12:110118488-110118510 ACCAGCCTTCCCTGACCACCTGG + Intergenic
1102180912 12:110911586-110911608 TTCTTCCTTCCCTGACCCCAAGG + Intronic
1102581571 12:113891539-113891561 CCCCTTCCTCCCTGTCCACCTGG - Intronic
1102731685 12:115116849-115116871 TCCCTCCATCCCTCAGCCCCTGG + Intergenic
1103075701 12:117980765-117980787 ACCCTCCTTCCCCTGCCCCCTGG - Intergenic
1103446317 12:120997374-120997396 CCTCTCCTTCCCAGAGCCCGTGG - Intronic
1103511831 12:121480146-121480168 CCCCTCCTTGCCCGCCTCCCTGG - Intronic
1103557821 12:121776499-121776521 CCCCTCCTTCCCAGAGCTTCTGG + Exonic
1103743523 12:123107196-123107218 CCCCTCCCTGCCTGAGCCACGGG + Intronic
1104003216 12:124873689-124873711 GCCCTCCTCCCCTCAGCCCCAGG + Intronic
1104166997 12:126241819-126241841 CCCCTCACTCACTGACACCCAGG + Intergenic
1104178114 12:126352054-126352076 CTCCCTCTTCCCTGACCCACTGG - Intergenic
1104424225 12:128661415-128661437 GCCGTCCTTCCCTGAGACCCTGG - Intronic
1104842868 12:131832933-131832955 CAGCTCCTTCCGTGTCCCCCAGG + Intronic
1104948717 12:132429179-132429201 CTCCTCCCTCCCTGACCACACGG + Intergenic
1105613085 13:21986199-21986221 CTCCTCCCTCCCTGCTCCCCAGG - Intergenic
1106794165 13:33187215-33187237 CCCCTCTTTCCCTGCCTTCCCGG - Intronic
1107495911 13:40925530-40925552 CCCCACCCTCCCTGACAACCAGG - Intergenic
1107612560 13:42130804-42130826 CCCCGTCTCCCCTGATCCCCAGG + Intronic
1107659263 13:42622494-42622516 CCCCTCCCACCCTTCCCCCCAGG - Intergenic
1108350276 13:49585367-49585389 CCCCTGCTTCCCTTCCCCGCAGG - Intronic
1108361695 13:49673808-49673830 CACCTCCATCCCTTAACCCCTGG - Intronic
1108482308 13:50886420-50886442 TCCCTCCATCCCTGAACCACTGG - Intergenic
1108667741 13:52649759-52649781 CCCCACCCTCCCTGACAACCAGG + Intergenic
1108739698 13:53323001-53323023 CCCTGCCTTCCTTGACCCTCAGG + Intergenic
1110630090 13:77697816-77697838 CGGCTCCTTCCCTGTCGCCCCGG - Intergenic
1110630288 13:77698553-77698575 CCGCTCCTTCCCCGAGACCCTGG + Intronic
1111985371 13:95060903-95060925 CCCCACCTTCCCTCAGCCCCTGG + Intronic
1112709825 13:102114814-102114836 CTCCCCCTTCCCTCAGCCCCTGG - Intronic
1113285801 13:108847820-108847842 CCCATCCCTCCCCGACCTCCTGG + Intronic
1113438710 13:110311937-110311959 CACCGCCTTCCCTGCCCTCCAGG + Intronic
1113569228 13:111342087-111342109 CACCTGCTTCCTTGGCCCCCCGG - Intronic
1113674139 13:112196416-112196438 CCCCTGGTTCCCTGGTCCCCTGG + Intergenic
1113711081 13:112466005-112466027 CACCCACTTCCCTGAGCCCCAGG - Intergenic
1113861773 13:113491316-113491338 CCCTTCCTTCCCTCCCTCCCTGG + Intronic
1113891856 13:113740105-113740127 CCCATCCTTTGCTGACCCCAAGG - Intergenic
1114475000 14:22988015-22988037 CCCTTCCTTCCCTCCCCGCCAGG - Exonic
1114554082 14:23551490-23551512 CGTCTCCGTCCCTGACGCCCCGG - Exonic
1114613792 14:24057925-24057947 CCCCTCCCTCGCTGACCCCAGGG + Intronic
1114690144 14:24573854-24573876 CTCCTGCTTCCCTGAGCTCCGGG + Intronic
1117920955 14:60724470-60724492 TCCCTCCCCTCCTGACCCCCAGG + Intergenic
1118598472 14:67454091-67454113 ACCCCCCTACCCTGCCCCCCAGG - Intronic
1118747560 14:68785233-68785255 CCCCTTCTTCCTTCACGCCCTGG + Intergenic
1118765373 14:68906069-68906091 CCCGTTCTTTCCTGCCCCCCCGG - Intronic
1119054878 14:71409049-71409071 CCCCTCCTTCTCTTTCCCTCTGG + Intronic
1119182689 14:72615122-72615144 CCCCTTCTTCTCTCACTCCCCGG - Intergenic
1119421069 14:74508389-74508411 TCCCTCCCTCCCTGAGCCCCGGG + Intronic
1119493764 14:75061150-75061172 CTCCTCATCCCCTGAGCCCCTGG - Intronic
1119764616 14:77180744-77180766 TCCCTCTTCCCCTGACCCCCTGG - Intronic
1119778424 14:77262368-77262390 TCCCTCCTCCCCTTAGCCCCTGG + Intergenic
1120876662 14:89381832-89381854 CCCCTCCTTCTCTGTTGCCCAGG - Intronic
1121074895 14:91060160-91060182 CCCCACCTCCCGGGACCCCCGGG + Intronic
1121732592 14:96196959-96196981 CCCCTCCTACCCCCAGCCCCTGG - Intergenic
1122621248 14:103058477-103058499 CCCCTCCTCTCCTGACGCCAAGG - Intergenic
1122633034 14:103116368-103116390 CCCCTCCTTGCCGGACAGCCAGG - Intergenic
1122863120 14:104591436-104591458 CCCTTCCAGCCCTGACCCACTGG - Intronic
1122923993 14:104891514-104891536 CCCATCCTTCCAAGCCCCCCAGG - Intronic
1123033780 14:105463586-105463608 GCCCACCCTCCCTGGCCCCCGGG - Intronic
1123121580 14:105919303-105919325 CAGCCCCTTCCATGACCCCCTGG + Intronic
1123123097 14:105927104-105927126 CCCCTGCCTTCCTGACACCCTGG - Intronic
1123123627 14:105929459-105929481 CCCCTGCCTTCCTGACACCCTGG - Intronic
1123404295 15:20010964-20010986 CAGCCCCTTCCATGACCCCCTGG + Intergenic
1123406268 15:20020959-20020981 CCCCTGCCTTCCTGACACCCTGG - Intergenic
1123513630 15:21017611-21017633 CAGCCCCTTCCATGACCCCCTGG + Intergenic
1123515598 15:21027607-21027629 CCCCTGCCTTCCTGACACCCTGG - Intergenic
1124351185 15:28956729-28956751 TTCCTCCTCCCCTCACCCCCTGG + Intronic
1124632715 15:31346604-31346626 CCCCTCCTTGCAGGCCCCCCAGG + Intronic
1125220575 15:37328441-37328463 CTCCTCCTTCCCCAAGCCCCTGG - Intergenic
1125758702 15:42083108-42083130 CCCTGCCTTCCCTGCCCACCAGG - Intronic
1126097254 15:45098290-45098312 CCCCTGCTTCCTTGAGTCCCTGG + Intronic
1126665703 15:51074837-51074859 CCCCTCCCACCATGAGCCCCTGG + Intronic
1127259038 15:57314522-57314544 CCCCTCCTTCCCTGGGGTCCTGG + Intergenic
1127361260 15:58246924-58246946 CCCTGCCATCCCTGACCCCATGG + Intronic
1127477691 15:59350217-59350239 GGCCTCCTTCCCTGATCACCAGG + Intronic
1128086325 15:64888999-64889021 CCCCCCACCCCCTGACCCCCAGG - Intronic
1128108239 15:65059766-65059788 CCCCTCTATCCCAGAACCCCAGG + Intronic
1128155362 15:65388586-65388608 TCCCTGCCTCCCTCACCCCCAGG - Exonic
1128453905 15:67822334-67822356 CACCTCCCTCCCTGCCCCCCTGG - Intronic
1129262016 15:74373936-74373958 CCACTCCTTTCCTGGCCCCCCGG - Intergenic
1129413342 15:75361569-75361591 CCACTCTGACCCTGACCCCCCGG + Intronic
1129454623 15:75670115-75670137 CCCCTGCTCCTCTCACCCCCAGG - Intergenic
1129455599 15:75674837-75674859 CTCCTCCATCCCACACCCCCAGG + Exonic
1129523097 15:76198060-76198082 CCCTTGCCTCCCTGAACCCCTGG - Intronic
1130458953 15:84143934-84143956 TCCCTCCTACCCCTACCCCCAGG - Intergenic
1130569016 15:85023822-85023844 TCCCTCCTTCCCTGAACACTTGG - Intronic
1131182323 15:90249301-90249323 CCCATCTTTCCCTAAACCCCGGG - Intergenic
1131235663 15:90694713-90694735 CCCTTCCTGCCCTCAGCCCCTGG + Intergenic
1131873692 15:96783625-96783647 CCCTTCCTTCCCCGAGGCCCAGG - Exonic
1132553835 16:564244-564266 CCCCTCCTGCCCTGGGTCCCTGG - Exonic
1132629403 16:909725-909747 CTCCTCCCACCCTGTCCCCCCGG - Intronic
1132713643 16:1280017-1280039 CCCGTCCTTCCCTGACCTGGGGG - Intergenic
1132989310 16:2784930-2784952 ACCCTCCCTCCCTGAACTCCAGG - Intronic
1133026249 16:2990139-2990161 CCCCTCCTTCCCTCCCTCCCAGG + Intergenic
1133232924 16:4374809-4374831 CACTTCCTTCTCAGACCCCCAGG + Intronic
1133248769 16:4466402-4466424 TCTCTCCTTCCCTGCCCTCCAGG - Exonic
1133269310 16:4602715-4602737 CCCCACCTTCCCAAGCCCCCAGG - Intergenic
1133320007 16:4907544-4907566 CCCCACCTCCCCTTTCCCCCTGG - Intronic
1133406823 16:5531160-5531182 TCCCACCTTCCCAGACCACCTGG - Intergenic
1133553780 16:6885151-6885173 CTCCTCCTTCCCTAATTCCCAGG + Intronic
1133620642 16:7522992-7523014 CTCCTCCTTGCCTCATCCCCAGG + Intronic
1134444880 16:14323171-14323193 GTACCCCTTCCCTGACCCCCGGG + Intergenic
1135354777 16:21760044-21760066 CCCCTCCTTCATTCACCCCAAGG + Intronic
1135453262 16:22576183-22576205 CCCCTCCTTCATTCACCCCAAGG + Intergenic
1135976128 16:27109885-27109907 CCCCTCCTTCCCCGGGCTCCGGG + Intergenic
1136048363 16:27633092-27633114 CCCCTCCCTCCTTAACCGCCAGG - Intronic
1136317301 16:29461778-29461800 CCTCCACTTCCCTTACCCCCAGG - Intronic
1136431876 16:30201121-30201143 CCTCCACTTCCCTTACCCCCAGG - Intronic
1137255155 16:46769046-46769068 CCCCACCTTCCCCCATCCCCAGG + Intronic
1137420134 16:48326327-48326349 CTCCTCCATCCCTAACCCACAGG + Intronic
1137716635 16:50602139-50602161 CCTCTCATTCCCAGGCCCCCAGG - Intronic
1137934166 16:52617853-52617875 GCACTCCTTTCCTGAACCCCTGG - Intergenic
1137980391 16:53064413-53064435 CCCTCCCTACCCTGAGCCCCTGG - Intronic
1138105570 16:54285753-54285775 CCCCTCCTTCCCTGGCTCCGCGG + Intronic
1138271717 16:55700324-55700346 CCCCTCCCACCCTGTTCCCCTGG - Intronic
1138343704 16:56307244-56307266 TCCCTCCTTCCCAGAATCCCGGG + Intronic
1138420705 16:56897379-56897401 CCCCTCCTACTCTGACCCTGGGG - Intronic
1138516224 16:57536621-57536643 CCCCTGCTTCCCCTCCCCCCGGG - Intergenic
1138534213 16:57651369-57651391 CCGATCCTTCCCTGACCCCAGGG + Exonic
1138630856 16:58293268-58293290 CCCCTCCTCCCTTGACCTCTAGG - Intronic
1138639347 16:58371007-58371029 TCCCTCCTCCCTTGACCCTCAGG + Intronic
1138655768 16:58490438-58490460 CCCCTCCCTCCCTGACTCAGTGG + Intronic
1139211437 16:65081918-65081940 CCCCTGCTTCCCTTCCCCCAAGG - Intronic
1139547896 16:67658205-67658227 CCCCTGCCACCCTGACCCCCAGG - Exonic
1139670819 16:68491664-68491686 CCTCTTCTTCGCTGCCCCCCTGG - Intergenic
1139751179 16:69109725-69109747 CATCTCCTTCCCTGACCTCAAGG + Exonic
1140138771 16:72233739-72233761 TCCCTCCTTCCCTCAGCCCCTGG + Intergenic
1140478259 16:75249664-75249686 CAACTCCTTCCCTTGCCCCCAGG - Intronic
1140897762 16:79340135-79340157 CTCCTCCGTCCCTGACCTCCCGG - Intergenic
1141041254 16:80674617-80674639 TCCCTCCTCCCCTTAGCCCCTGG + Intronic
1141054500 16:80803664-80803686 CCCCTCCTCCCCCGCGCCCCCGG + Intronic
1141135763 16:81464119-81464141 CCCCTGCTTCCCTTACACACTGG - Intronic
1141278778 16:82611774-82611796 CCTCTCCCTCCATCACCCCCTGG - Intergenic
1141288411 16:82694548-82694570 CCCCTCCTTCCCTTCCTCCCAGG + Intronic
1141373572 16:83509100-83509122 CCCCTTCTTCCCCAGCCCCCAGG + Intronic
1141804318 16:86332678-86332700 CCCCCCATCCCCTGTCCCCCAGG - Intergenic
1142000678 16:87662589-87662611 GCCCTCCTTTCCTGGCCCCCTGG + Intronic
1142375546 16:89705148-89705170 TCCGTCCTTCCCTGCCCTCCCGG + Intergenic
1142403594 16:89873810-89873832 GCCCTCCTTCCCTGCGCCCCCGG - Exonic
1142563765 17:826520-826542 CCCTTCCTTCCTTAACCACCTGG - Intronic
1142733584 17:1879934-1879956 CCCCTCCCTCCCTCAACTCCAGG - Intronic
1142733621 17:1880067-1880089 CCCCTCCCTCCCCCAACCCCAGG - Intronic
1142762146 17:2049044-2049066 CCCCTCCTTCACTCCCCACCCGG - Intergenic
1142950185 17:3472085-3472107 CCCCACTTCCCCTCACCCCCTGG + Exonic
1143014522 17:3884522-3884544 CTCCTCATTCCCGGACCCCCAGG + Intronic
1143153070 17:4818890-4818912 AGCCTCCTTCCCCCACCCCCAGG - Intronic
1143196472 17:5079726-5079748 CATTTTCTTCCCTGACCCCCAGG - Intronic
1143416257 17:6753130-6753152 ACCCCCCTCCCCTGACCCACAGG + Intergenic
1143749887 17:9020915-9020937 CCCCTCCTCGCCGGACCCCGGGG + Intergenic
1143779678 17:9222678-9222700 CCGTCCCTTCCCTGACCCCGTGG + Intronic
1145255558 17:21320291-21320313 CTCCTCCCTGCCTGACACCCTGG - Intergenic
1145321054 17:21767658-21767680 CTCCTCCCTGCCTGACACCCTGG + Intergenic
1145755362 17:27386231-27386253 CCCATCCTTACCTAAGCCCCTGG + Intergenic
1146064375 17:29623067-29623089 TCCCTCCCTCCATGACTCCCGGG + Intergenic
1146762414 17:35490082-35490104 CCCCTCCTCCCCAGTGCCCCAGG + Intronic
1147163135 17:38579176-38579198 CCCCTCCTTCCCTCACCTGCTGG - Intronic
1147276719 17:39324010-39324032 CCCCTCCCCCCCCCACCCCCTGG + Intronic
1147428238 17:40356352-40356374 CTCCTCCCTCCCCGTCCCCCAGG - Exonic
1147538109 17:41334074-41334096 GACCTCCTTTCCTGACCCTCAGG - Intergenic
1147757851 17:42780425-42780447 CCCCTTCTTTCCCGAGCCCCCGG - Intergenic
1147951403 17:44109942-44109964 CCGCTCCTTCCCTCACTCCCAGG - Intronic
1147978642 17:44261735-44261757 CCCCTCCTTCCCAGTGCCCTGGG + Intronic
1148104755 17:45113257-45113279 CCACTCCCTCCCTCACCCACAGG - Exonic
1148178144 17:45585060-45585082 CCCCTCCTGCCCTGCCCCTCTGG - Intergenic
1148231901 17:45941455-45941477 CCCCTCCTTCCCCCTGCCCCTGG + Intronic
1148357605 17:46986124-46986146 CCCCCCCTTGCCCCACCCCCAGG - Intronic
1148384521 17:47224534-47224556 TCCCTCCTTCCCCCAGCCCCTGG + Intergenic
1148735496 17:49862675-49862697 CCCCTCACTCCCTGTCCCGCTGG + Intergenic
1148783790 17:50135470-50135492 CCCCTCCCTCCAGGACCCACAGG + Intronic
1148813944 17:50313246-50313268 CGCCTCCTGCCCTTACCCTCAGG - Intergenic
1149424455 17:56541841-56541863 CCCTCCCTTCCTTGAACCCCAGG - Intergenic
1149512723 17:57256499-57256521 CCCCCCCGTCCCCGCCCCCCCGG - Intronic
1149597805 17:57874532-57874554 ACACACCCTCCCTGACCCCCAGG + Intronic
1149705584 17:58691880-58691902 CCCCTCCTTCTCAGGACCCCAGG + Intronic
1149798726 17:59546370-59546392 CCCCTTCTACCCTCAGCCCCTGG + Intergenic
1149799732 17:59556447-59556469 CCGCTCCTTCCTTTACCTCCAGG - Intergenic
1149863008 17:60134617-60134639 CCCCTCCTCCCCCACCCCCCAGG + Intergenic
1150408041 17:64919350-64919372 CCCCTCCTGCCCTGCCCCTCTGG - Intronic
1150484908 17:65536981-65537003 CCCCTCCTTCCCTGGCGGGCAGG + Exonic
1150562234 17:66303363-66303385 CTCCTCCTCCCCTGTCCCCTGGG - Intronic
1150727252 17:67661449-67661471 CCCTTTCTCCCCTCACCCCCAGG + Intronic
1151344936 17:73495707-73495729 CCCCACCTTCCCCGATCCTCAGG + Intronic
1151455294 17:74222236-74222258 CCCCTCCCTCACTGACCACGAGG + Intronic
1151531002 17:74704635-74704657 CACCTCCTGCTCTGACCCACTGG + Exonic
1151660793 17:75516925-75516947 CCCCCGCTTCCCTTACCCCTGGG - Intronic
1151825015 17:76519272-76519294 CCCCTGCTTCCCTCTCTCCCTGG + Intergenic
1152031483 17:77846055-77846077 CCAGTCCTTCCCTGACCCTCGGG - Intergenic
1152068865 17:78125541-78125563 CCCCCACTTCCCTGTCCCCGTGG + Intronic
1152228265 17:79102564-79102586 CCCCTCCTTCCCTGCTCCCCAGG - Intronic
1152304095 17:79511177-79511199 CCGTTTCTTCCCTGACCCTCAGG - Intronic
1152531752 17:80922975-80922997 CCTCTCCCTCCCGGACACCCCGG + Intronic
1152645814 17:81468112-81468134 CCCCTCTAACCCTGACCCCCAGG - Intergenic
1152714824 17:81893926-81893948 CCCCTGCAGCCCTGACCCTCTGG + Intronic
1152721795 17:81927214-81927236 CCCCTCCCTCCAGGACGCCCGGG + Intronic
1153334972 18:3914203-3914225 CCCATCCTTCCCTTTCCCCCAGG + Intronic
1153520881 18:5952999-5953021 CTCCTCTTTTCCTGATCCCCTGG - Intergenic
1153778725 18:8476227-8476249 CCACTCCTTCTCAGACCCTCTGG - Intergenic
1154119960 18:11644266-11644288 CCCCTCCCTCCCTGCCCACAGGG - Intergenic
1155150005 18:23115726-23115748 TCCCTCCTTCCCCAAGCCCCTGG + Intergenic
1156370674 18:36468939-36468961 CCTCTCCTTCCCTGAGCCCCAGG - Intronic
1158566520 18:58558909-58558931 CCCCTTCTTCCCCCAGCCCCTGG - Intronic
1158722581 18:59938703-59938725 CTCCTTCTTCCAGGACCCCCAGG - Intergenic
1159928358 18:74289276-74289298 TCCCTCCTTTCCTGACTCACAGG + Intronic
1160031960 18:75269802-75269824 CCCCTCGTTCCCAGCCCCCCTGG + Intronic
1160831743 19:1107594-1107616 CCCTTCCCTCCCTGTCCCACAGG + Intergenic
1160843578 19:1157048-1157070 CCCCTGCTGCCCCGATCCCCAGG + Intronic
1160877407 19:1303171-1303193 CCCCTCCTTCCCTGTCTCTGTGG + Intergenic
1160914290 19:1489525-1489547 TCCCTCCTTACCAGAGCCCCTGG + Intronic
1160980996 19:1816569-1816591 CCCCTCCTGCCCGTTCCCCCAGG - Exonic
1161021668 19:2014176-2014198 CCCCTCCGTCCCTGTACCCAGGG - Intronic
1161202732 19:3024988-3025010 CCCCTCCTCCCCCCACCCCCAGG + Intronic
1161264379 19:3357747-3357769 CCCCTCCCCTCCTCACCCCCAGG + Intergenic
1161300315 19:3539294-3539316 CCCCTCCCTCCCTCCCTCCCTGG + Intronic
1161443510 19:4305255-4305277 CCCCCGCATCCCTGGCCCCCAGG + Intronic
1161446737 19:4322964-4322986 CCCCTCCTGCCCTGCGCCACAGG + Exonic
1161461270 19:4399378-4399400 CCCTTCCTTTCCTGTCCCCCAGG - Intronic
1161488467 19:4548445-4548467 CCTCCCCTGCCCTGTCCCCCAGG - Exonic
1161782571 19:6303019-6303041 TGCCTCCTCCCCTGACCCCGTGG - Intergenic
1161853897 19:6753061-6753083 CCCCACCTTCCCCGACAACCTGG - Intronic
1161983493 19:7642387-7642409 CCTCAGCTCCCCTGACCCCCAGG + Intronic
1162320520 19:9968614-9968636 CCCCTCTTTCCCTCCCTCCCTGG - Intronic
1162502626 19:11062642-11062664 CCCTTCCCTCACTGACCACCTGG - Intronic
1163007583 19:14406309-14406331 CCCCTCCGTCCCCGCCCCGCAGG + Exonic
1163118320 19:15200932-15200954 TCCCTCCTTCCCTGGGCTCCGGG + Exonic
1163210845 19:15839018-15839040 CCCCTCCTGCTCTGACGCCACGG - Intergenic
1163499841 19:17669676-17669698 CACCTCCTCCCCCAACCCCCAGG - Exonic
1163556892 19:17998303-17998325 CCCCGCCTCCCCTGCCTCCCAGG + Exonic
1163976620 19:20858845-20858867 CCTCTCCTTCCCTTTCCCCTAGG - Intronic
1164645802 19:29858216-29858238 ACCCTCCTTCCTCCACCCCCGGG + Intergenic
1164834936 19:31350338-31350360 CCCCTCCCACACCGACCCCCGGG - Intergenic
1165166879 19:33863261-33863283 CCCCTGCAGCCCTGACCCCCTGG - Intergenic
1165174763 19:33920331-33920353 CTCCTCCTTCCTAGAACCCCTGG - Intergenic
1165326921 19:35119269-35119291 ACCCTCCTCCCCTGCTCCCCAGG - Intronic
1165386722 19:35514271-35514293 CACCTCCTTCCCCGACACCGAGG - Intergenic
1165388265 19:35524423-35524445 CTCCTCCCTCCCTGGCTCCCAGG + Intronic
1165425370 19:35742611-35742633 CCCATCCTTCCCAGGCTCCCGGG - Exonic
1165437630 19:35805058-35805080 TCCCTCCTCCCCTCAGCCCCTGG - Intronic
1165478044 19:36043392-36043414 TCCCTCTTTCCCTCTCCCCCAGG - Intronic
1165749933 19:38253414-38253436 CCCCTCCCTTCCTGTCCCCTGGG - Intronic
1165851130 19:38851006-38851028 CCCTGCCATCCCAGACCCCCAGG + Intronic
1166082366 19:40452063-40452085 CCCCTCCTTCCCTCCTCCCAAGG + Intronic
1166111822 19:40627306-40627328 CCGCTCCTTCCCAGAGCCCGAGG + Exonic
1166123932 19:40702556-40702578 TCCCTCCTTCCCTCCCTCCCAGG - Intronic
1166131898 19:40750682-40750704 CACCTCCTTCCGTGGCGCCCGGG - Intronic
1166317582 19:41997712-41997734 CCCCGCCCTCCCTGCCCCGCCGG - Intergenic
1166525321 19:43507022-43507044 CCACTCCTTCCCTCAGACCCAGG + Intronic
1166572409 19:43805994-43806016 TCCCTCCTCCCCACACCCCCTGG + Intronic
1166777109 19:45319731-45319753 CCCCTCCTGCCCTGCCCATCAGG - Exonic
1166803444 19:45471500-45471522 CCCCCCATTTCCTGACCCCACGG + Intronic
1167265797 19:48482730-48482752 CCCCTTCTTCCCTCAGACCCAGG + Intergenic
1167306939 19:48714873-48714895 CCCCTCACTCCCTGCCCACCAGG - Exonic
1167460430 19:49621626-49621648 CACCCCCTGCCCAGACCCCCAGG - Intronic
1167476630 19:49705126-49705148 CACCTCCATCCCTAACCCACTGG - Intronic
1167486115 19:49763796-49763818 CACCTTCTACCCTGACCCCGAGG - Intergenic
1167503889 19:49861539-49861561 CCCCTCCTCCCCTGACCCCTGGG - Intronic
1167574603 19:50312107-50312129 CCCCTCCCTCCCTGCCCTGCGGG + Intronic
1167721836 19:51184941-51184963 CTCCTCCTTCTCCCACCCCCAGG + Intergenic
1167764028 19:51468488-51468510 CCCCCACTTCTCTGAGCCCCAGG - Intergenic
1168277081 19:55284338-55284360 CCGCTCCGTCCCGGCCCCCCCGG - Exonic
1168278432 19:55289889-55289911 CCCCTCCTGCCCCCAGCCCCCGG + Intronic
1168282284 19:55312071-55312093 CCCCTCCCTCCCCGGCCCCGTGG - Exonic
925039156 2:716799-716821 CTCCTCCTCCCCTCATCCCCAGG - Intergenic
925123517 2:1437816-1437838 CCCCTCCTGCCCTGAAGCCTGGG + Intronic
925274517 2:2639313-2639335 CTGCTCCTCCCATGACCCCCTGG - Intergenic
925731381 2:6921676-6921698 CCCATGCTGCCCTGACCCCACGG - Intronic
925741407 2:7008593-7008615 CCCATGCTTCCCTGTCCCCCCGG + Intronic
926120363 2:10238313-10238335 CACCGCCTTACCTGACTCCCAGG - Intergenic
926152784 2:10434249-10434271 CCCCTGGTTCCCTGACCACATGG - Intergenic
926358052 2:12059362-12059384 CCCCTCCCTGCCTGACCTCCTGG - Intergenic
926748063 2:16176124-16176146 TCCCCTCTTCCCTCACCCCCTGG + Intergenic
927152415 2:20203666-20203688 GCCCGCCTTCCCCTACCCCCAGG - Intronic
927490731 2:23519318-23519340 CCCGTCCTCCCCTCCCCCCCAGG + Intronic
927863431 2:26574468-26574490 CCCCACCTTCCCTGACAGTCTGG - Intronic
927887151 2:26725525-26725547 CCCGTCCTTCCCTGTCCTCCAGG - Intronic
927928104 2:27026922-27026944 CCTCCCTTTCCCTGACCCCCTGG - Exonic
928040942 2:27876647-27876669 CCCCTCCTCCCCTCAGCCCCTGG - Intronic
928124918 2:28608652-28608674 CCACTCCTTTCCTAACCCCAGGG + Intronic
928421054 2:31138136-31138158 CCCCGCCAACCCTGACCGCCGGG - Exonic
929212053 2:39367971-39367993 GCCCTCCTTCCCTGACTACCTGG - Intronic
929536022 2:42784510-42784532 CCCCACCTCCCCCCACCCCCAGG - Intronic
929605683 2:43232684-43232706 CTCCTACTCCCCTGACACCCCGG + Intronic
929713520 2:44288398-44288420 CCCTTTCTTCCCCCACCCCCTGG + Intronic
930219669 2:48733628-48733650 CTCCCCATTCCCTGGCCCCCAGG - Intronic
931643108 2:64398676-64398698 TCCCTCCTTCCCTCAGCTCCTGG - Intergenic
932360397 2:71100658-71100680 ACCCTACTTCCCTCATCCCCAGG + Intergenic
932507115 2:72245634-72245656 CCTCACTTTCCCTGAACCCCTGG - Intronic
932712904 2:74080896-74080918 CCCCTCCGGCCCTGAGCCACGGG - Intronic
933784849 2:85830425-85830447 CCTCTCCTTAGCTGCCCCCCTGG + Intergenic
933853154 2:86386999-86387021 TCCCTCCTTCCCTCAACCCCTGG + Intergenic
933864546 2:86504088-86504110 CCCTTTCTTCCCTAATCCCCTGG - Exonic
934067066 2:88350466-88350488 CTCCTCCTCCCCAGACCCACTGG - Intergenic
934521408 2:95022431-95022453 CCCCTCCTGCGCTGACGCCATGG + Intergenic
934568219 2:95352379-95352401 CCCTTCCTCCCCTGGCCTCCAGG - Intronic
934716823 2:96549467-96549489 CCCCTCCCTGCCTGCACCCCAGG - Intronic
934718117 2:96554835-96554857 CCCCTCCTCCCCTCAACCTCAGG - Intergenic
934902035 2:98167131-98167153 CCGCCCCTTCCCTGTCCCGCTGG - Intronic
935222502 2:101027499-101027521 CCCCTCTTGCCCTGACCCCTGGG - Intronic
935267849 2:101409834-101409856 CCCCACCTGCCCTGAGCCCATGG + Intronic
935308795 2:101762370-101762392 CCCCTGCATCCTTGTCCCCCTGG + Intronic
935398863 2:102639707-102639729 CACCTCCTCCCTTGAGCCCCTGG + Intronic
935449117 2:103189464-103189486 CCTCTCCATCCCTGTCCACCTGG - Intergenic
935556060 2:104510624-104510646 TCCCCGCTTCCCTGACCCCCGGG - Intergenic
936030493 2:109066802-109066824 CCCCTCCTTCCTTTACCGCTCGG - Intergenic
936501856 2:113072804-113072826 CTCTTCCCACCCTGACCCCCTGG - Intronic
936701039 2:115012016-115012038 CCCCTACTTCCCTGGCAACCTGG + Intronic
936954929 2:118013921-118013943 CTCCTCCTTCCCTGACACGTCGG - Intronic
936985930 2:118311238-118311260 CTCCTCCTTCCCAGGCCTCCTGG - Intergenic
937029351 2:118725215-118725237 CCCCTGCTTCCTGGAGCCCCCGG - Intergenic
937258607 2:120571555-120571577 CCACTCTGTCCCTGACCCCAGGG - Intergenic
937909436 2:127068414-127068436 CACCCCCTTTCCTTACCCCCCGG - Intronic
938945081 2:136204995-136205017 CTCAACCCTCCCTGACCCCCAGG - Intergenic
939780901 2:146446394-146446416 CCCCTCCCTACCTCAACCCCTGG + Intergenic
940038065 2:149330588-149330610 TCGCTCCTTCCCTGAGCTCCCGG + Exonic
940097434 2:149993424-149993446 CCTCTCCTTCCCAAATCCCCTGG - Intergenic
940216036 2:151304500-151304522 TCACTCCTTCCCTCATCCCCTGG - Intergenic
940290679 2:152074837-152074859 CCACCCCTGCCCTGACACCCAGG + Intronic
941089802 2:161161023-161161045 CCACTCCCTCCGTGACCCTCTGG - Intronic
942003140 2:171670536-171670558 CCCCCACATCCCTCACCCCCTGG + Intergenic
942551650 2:177126137-177126159 CCCCTCCTTAGCTGGCCCTCTGG - Intergenic
943489631 2:188534483-188534505 CCCCTCCTTCCTTCTCCCTCTGG - Intronic
943754151 2:191540806-191540828 TTCCTCCTTCCCTGATCTCCAGG + Intergenic
944643581 2:201754532-201754554 CCCTTCCTTCCCTTTCCCCCAGG + Exonic
946171750 2:217899767-217899789 CCCCTCCTTCCCTTAGACCTGGG - Intronic
946929710 2:224659694-224659716 CACCTCCTTCCCCCAGCCCCAGG + Intergenic
947156314 2:227165056-227165078 CCCCGCCATCCCTGACTCCTAGG - Intronic
947765590 2:232635067-232635089 CCTCTGCCTCCCTGACACCCTGG + Intronic
947808310 2:232983340-232983362 CTCCTCCTTCCCTCACCGCTCGG - Intronic
947849549 2:233274688-233274710 CTCTTCCTTCCCAGTCCCCCAGG + Exonic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948107807 2:235429077-235429099 CCCCTCCTACTCTGTCCCACTGG - Intergenic
948247211 2:236496600-236496622 CCCTTCCTTCCCTCTCTCCCTGG - Intronic
948340326 2:237245526-237245548 CCCCTCCATCCCTGCCACCATGG + Intergenic
948572502 2:238926688-238926710 CCCCTGCCTCCCAGACCCTCAGG + Intergenic
948858854 2:240743276-240743298 CTTCTCTTTCCCTGACACCCTGG + Intronic
1168748967 20:268669-268691 CCACCCCATCCCTGGCCCCCAGG + Intergenic
1168835144 20:872848-872870 CACCGCCTTCCCTGACACCCTGG - Exonic
1168895180 20:1319350-1319372 CCCCTCCCTCCTTGACTGCCTGG - Intronic
1168918421 20:1510636-1510658 CCCCTTGTTCCCTGTCACCCTGG - Intergenic
1168951485 20:1804966-1804988 CCCCTCCTCATCTGACCTCCTGG + Intergenic
1169110268 20:3028195-3028217 CCTCTCCTTCCCAGTGCCCCAGG + Intronic
1169211069 20:3766654-3766676 CCTCACCTTGGCTGACCCCCTGG - Intronic
1170237648 20:14125132-14125154 CCCCTCCTTCTGTCATCCCCTGG - Intronic
1171208891 20:23301959-23301981 CCCCTGTTTCTCTGTCCCCCTGG - Intergenic
1171210410 20:23312086-23312108 CGCCTCCTCCCCTGAGTCCCTGG - Intergenic
1171345363 20:24461921-24461943 CACCGCCTTCCCCCACCCCCAGG + Intergenic
1171427780 20:25059004-25059026 CCCCGCCGTCCCCGCCCCCCAGG - Intergenic
1171850133 20:30302025-30302047 CCACTCCCTGCCTGACCACCGGG - Intergenic
1172024444 20:31938314-31938336 TCCCTCCCTCCCTCACCCCATGG - Intronic
1172168999 20:32917562-32917584 CCCCACCCTCCCTGCCCCACAGG - Intronic
1172237927 20:33390451-33390473 TTCCTCCTTCCCTCAGCCCCTGG - Intronic
1172445368 20:34990519-34990541 CCCGTCCCTCCCAGAGCCCCAGG - Intronic
1172999224 20:39093492-39093514 GCCCTCTTTTCCTGACCCTCTGG + Intergenic
1173311177 20:41897305-41897327 CTCCACCTTCCCTGACCACTGGG - Intergenic
1173355133 20:42280113-42280135 CCCATCCCTTCCTGACCACCCGG - Intronic
1173616122 20:44403942-44403964 CCTCTCCTCCCCCGACCCCCGGG - Intronic
1174136603 20:48384558-48384580 CGCCTCCTTTCCTGACGCCCCGG + Intergenic
1175176298 20:57114499-57114521 CCCCTCTTTCCCAGAGCCCCTGG - Intergenic
1175264799 20:57696094-57696116 TCCCTCCTGCTCTGAGCCCCAGG + Intronic
1175316971 20:58055220-58055242 CCCCTCCTTCCTCAGCCCCCAGG - Intergenic
1175543193 20:59761196-59761218 CCCCTCCCTCCCTGGCTCCCAGG - Intronic
1175570156 20:60012175-60012197 CCTCCCCTTCCATGACCCCCCGG - Intronic
1175826598 20:61939526-61939548 CCCATCTTTCTCTGGCCCCCAGG - Exonic
1175830884 20:61965181-61965203 CCCCGCCTTCCCGGACCTCAGGG - Intronic
1175895805 20:62335126-62335148 CACCTCCTCCCTTGGCCCCCAGG - Exonic
1175941521 20:62539548-62539570 CCCCACCTTCCCCTACCCCCCGG - Intergenic
1175955127 20:62605192-62605214 CTCCACCAACCCTGACCCCCCGG + Intergenic
1175961020 20:62636409-62636431 CCCCTCCTCCGCTGCCCTCCTGG - Intergenic
1175975200 20:62707547-62707569 TCCCTCCTCCCCAGAACCCCTGG - Intergenic
1176033271 20:63024052-63024074 CCCCACCCTCCCTGGCCCCGGGG + Intergenic
1176070182 20:63222166-63222188 ACCCTCCTCCCCCCACCCCCAGG - Intergenic
1176077381 20:63254563-63254585 CCCCTCCTCCCCGCAACCCCCGG + Intronic
1176110293 20:63407831-63407853 TTCCTCCTTCCCAGACCCCTAGG + Intronic
1176110916 20:63410338-63410360 CCCCTCCTGCCCTGGGCCCCTGG + Intronic
1176124788 20:63470648-63470670 ACCCTCCTGCCCTGACAGCCTGG - Intronic
1176379070 21:6102640-6102662 CCCCACCCTCCCTCACCCCTCGG + Intergenic
1176430225 21:6570919-6570941 CCCCTCCTTCCCGGTGCCCCTGG - Intergenic
1177754203 21:25324908-25324930 TTCCTCCTTCCCCGAGCCCCTGG - Intergenic
1178812301 21:35895387-35895409 CCCCTCCCACCCTTTCCCCCAGG - Intronic
1179089895 21:38255474-38255496 ATCCTCCTGCCCTGAACCCCTGG + Intronic
1179705619 21:43178381-43178403 CCCCTCCTTCCCGGTGCCCCTGG - Intergenic
1179744404 21:43435597-43435619 CCCCACCCTCCCTCACCCCTCGG - Intergenic
1179780959 21:43700708-43700730 CCCCTCCTTTCCGGAGTCCCTGG - Intergenic
1179821645 21:43940460-43940482 CCCCTGCTTCCCTACCTCCCAGG - Intronic
1179825261 21:43961208-43961230 CCCCTCCTTTCCCCACTCCCTGG - Intronic
1179913930 21:44464414-44464436 CCCCTCCTGCCCTGGCCCTGGGG + Intergenic
1180070080 21:45431576-45431598 GGCCTCCACCCCTGACCCCCAGG - Intronic
1180181807 21:46121461-46121483 CCCGTCCAGCCCTGACCACCAGG - Intronic
1180188487 21:46151791-46151813 CCCCTCCTTCCCGGGACCCCGGG - Intronic
1180822137 22:18837640-18837662 CCCCACCTTCCCTAACCACAGGG + Intergenic
1181059001 22:20273029-20273051 CCCTGCCTTCCCTGCCCCACTGG - Intronic
1181185601 22:21101361-21101383 CCCATCCTTATCTGGCCCCCTGG - Intergenic
1181190837 22:21138406-21138428 CCCCGCCTTCCCTAACCACAGGG - Intergenic
1181208368 22:21272101-21272123 CCCCACCTTCCCTAACCACAGGG + Intergenic
1181440691 22:22933901-22933923 TCCCTTGTTCCCTGCCCCCCTGG - Intergenic
1181546114 22:23603568-23603590 CCTCTCCCTCCGTGTCCCCCAGG + Intergenic
1181583331 22:23839599-23839621 CCTCTCCTTCCTTGGGCCCCCGG - Intergenic
1181934720 22:26429977-26429999 CCCCTCCTCCCCTGACCTCCTGG + Intronic
1181971449 22:26693427-26693449 CCCATCCTTAGCTGACCTCCTGG - Intergenic
1182550605 22:31098962-31098984 CCCCGCCTTCCATGACCTTCGGG - Intronic
1182558400 22:31141189-31141211 CACCTCCATCCCTGGCCACCTGG + Intergenic
1182586408 22:31346377-31346399 CCCCTCCTTCTCCTCCCCCCAGG - Intergenic
1182649223 22:31837072-31837094 CGACTACTTCCCTGACCGCCAGG + Exonic
1182833231 22:33320835-33320857 CCTCTCCTCCCCAGAGCCCCCGG + Intronic
1182966146 22:34522810-34522832 CACCTCCCTACCTGTCCCCCTGG + Intergenic
1183380340 22:37487491-37487513 CGCCTCCTTCCCAGCCCCCCAGG + Intergenic
1183398884 22:37589404-37589426 CCCCTAATTCCCAGAGCCCCTGG + Intergenic
1183446649 22:37860946-37860968 CCCCTCCCTCCCTGGGCTCCTGG + Intronic
1183469085 22:37996291-37996313 CCCCTCTTTCCCTGCCTCCCTGG - Intronic
1183649546 22:39145925-39145947 CCCCGCTTCCCCCGACCCCCCGG - Intronic
1183658935 22:39207111-39207133 CACCTCCCTCCCAGCCCCCCAGG - Intergenic
1183821075 22:40346480-40346502 CCCGTCCTGCCCTGGCCTCCAGG + Intergenic
1183945976 22:41325947-41325969 CCTCTGCTGCCCTGATCCCCTGG + Intronic
1183978827 22:41528077-41528099 CCCCTCCTGCACTGGCCCCAGGG + Exonic
1184339619 22:43879112-43879134 CCCTTCCCTCCAGGACCCCCTGG - Intergenic
1184421884 22:44386930-44386952 CCCCTCCCTTGCTGACCCCGAGG + Intergenic
1184590292 22:45477523-45477545 CCCTCCCTTCCCTGCCCACCTGG + Intergenic
1185038069 22:48489930-48489952 GCCTCCCTTCCCTGACTCCCCGG + Intronic
1185085819 22:48740488-48740510 CAGCTCCATCCCTGCCCCCCTGG - Intronic
1185309593 22:50146582-50146604 CCCCACCCTCCCTGACGGCCTGG + Intronic
1185340468 22:50288644-50288666 CCCATCCTCCTCTGGCCCCCAGG + Intronic
1185414828 22:50704266-50704288 CCCCTGCCTGCCTGACCCCCGGG - Intergenic
1203218563 22_KI270731v1_random:23311-23333 CCCCACCTTCCCTAACCACAGGG - Intergenic
1203272269 22_KI270734v1_random:63525-63547 CCCCGCCTTCCCTAACCACAGGG + Intergenic
949475222 3:4438470-4438492 CTCATCCTTCCCAGTCCCCCAGG + Intronic
950066499 3:10115961-10115983 TCCCTCCCGCCCTGACCCTCAGG + Intronic
950153719 3:10707639-10707661 CGCCCCCTTCCCTCACCCGCAGG + Intronic
950412909 3:12850637-12850659 CCCCACCATCCCTGTCCCCCAGG + Intronic
950572046 3:13807329-13807351 CCCCATCTTCCCGGACTCCCAGG + Intergenic
950621934 3:14212825-14212847 CCCCACCTGCCCTGGCCTCCTGG - Intergenic
951139759 3:19147105-19147127 CCCCTCCCTCCCGGAGCCCAAGG + Intergenic
954362291 3:50128464-50128486 CCCCTACCTCCCTCACCCTCTGG + Intergenic
954363634 3:50135032-50135054 CCCCAGCACCCCTGACCCCCAGG - Intergenic
954414936 3:50388690-50388712 CCACTCCCTCTCTGAGCCCCAGG + Intronic
954581355 3:51704450-51704472 CCCCTCCTCCCCCAACCCCAGGG - Intergenic
954923614 3:54213394-54213416 CCCCTCCTGCCTTAACCCCCGGG + Intronic
955931708 3:64064250-64064272 CCCCTGTTTCCCTGTCCCTCAGG + Intergenic
955960771 3:64339477-64339499 CCTCTCCGTCCCTGAGCCCTAGG - Intronic
958880287 3:99661946-99661968 TTCCTCCTTCCCTCATCCCCTGG - Intronic
958932154 3:100218806-100218828 CTCCTCCTTCCTTGATCCTCTGG - Intergenic
959449865 3:106485935-106485957 CCCCATCTTCCCTGCCCCCAGGG + Intergenic
959552605 3:107680006-107680028 CCCAGCCTTCCCTGATCCCAGGG - Intronic
960049077 3:113223611-113223633 CCCCTCCCTCCCCCAGCCCCTGG + Intronic
960943975 3:122953370-122953392 CTTCTCCTACCCTGAACCCCAGG + Intronic
961004210 3:123393779-123393801 CCCCTCCCTCCCTCCCGCCCCGG + Intronic
961412231 3:126730700-126730722 CCTCTCCTTGCCTGAAGCCCTGG + Intronic
961539540 3:127590399-127590421 CCCCTCCTTACCTGACAGCCCGG + Exonic
961716627 3:128861922-128861944 CCCCACTGTCCCTGTCCCCCAGG - Intergenic
962322383 3:134402630-134402652 CTCCTCCATCCCTGACCACAAGG + Intergenic
962438178 3:135385441-135385463 TTCCTCCTTCCCTGGTCCCCCGG - Intergenic
962740122 3:138357252-138357274 CCCCTCCCTGCCTGAACACCAGG - Intronic
962759265 3:138493548-138493570 GCCACCCCTCCCTGACCCCCTGG - Intergenic
963049878 3:141132128-141132150 CCCCTCCCACCCTTTCCCCCAGG + Intronic
965036219 3:163441620-163441642 CCCCTCCTTCCCTCAGCGCCTGG + Intergenic
966878342 3:184336111-184336133 CGCCTCTTACCCTGACCCGCCGG - Intronic
967329038 3:188272034-188272056 CCCCTCCTTCTCTTCCTCCCAGG - Intronic
968007129 3:195250717-195250739 CCCCTACTTCACTGTCTCCCAGG + Intronic
969495495 4:7523886-7523908 CCCCTCCCTCCTTGGGCCCCTGG + Intronic
969635928 4:8369580-8369602 CACCTCCTGCCCTGCCCACCCGG + Intronic
969987188 4:11224553-11224575 CCCCTCCTTCCCTCACACCTTGG + Intergenic
970159613 4:13175708-13175730 TCACACCTTCCCTGACTCCCAGG + Intergenic
970194395 4:13541249-13541271 CTCCTCCTTCCGGGACTCCCAGG + Exonic
971303164 4:25458310-25458332 CGCCTCCTACCCTCACCCCATGG - Intergenic
971894979 4:32580556-32580578 TACCTCCATCCCTGACACCCTGG + Intergenic
975602487 4:76117086-76117108 CCCCTCCTCCCCTCACACCCTGG + Intronic
976278616 4:83304292-83304314 CCCCTCCTTCCCTTTCTACCAGG - Intronic
978311699 4:107391413-107391435 CCCCTCCCTCCTCCACCCCCAGG + Intergenic
981340125 4:143612238-143612260 CATCTCCTTCCCTGTCTCCCAGG + Intronic
981463165 4:145034731-145034753 GCCTTCCTTCCCTGTCCCCTGGG - Intronic
983926313 4:173406635-173406657 TCCCTCCTACCCTGAACTCCTGG + Intergenic
984032694 4:174624474-174624496 CCCATCCTTCCCTTACCCATTGG - Intergenic
985124590 4:186680474-186680496 CCACTCCTCCCCTGCCCCTCTGG + Intronic
985521595 5:376278-376300 CCCCTCCTGCCCAACCCCCCAGG - Intronic
985758603 5:1733465-1733487 CCCTCTCCTCCCTGACCCCCAGG + Intergenic
985772943 5:1824502-1824524 CCCCTGCCTCAGTGACCCCCGGG - Intergenic
985783461 5:1882436-1882458 CCCCTGCTCCCCAAACCCCCGGG - Intronic
985796408 5:1965403-1965425 CCCCTCCCTCTCTGTCCCACTGG + Intergenic
985858173 5:2447383-2447405 ACACTCTTCCCCTGACCCCCAGG - Intergenic
985894240 5:2739537-2739559 CCTCTCCTCCCCGGTCCCCCCGG - Intergenic
985947431 5:3197301-3197323 TCCCTTCTTCCCTGACACCCAGG + Intergenic
986285388 5:6354872-6354894 TCCCTCATTCCCTGAGCCTCCGG - Intergenic
986340425 5:6784473-6784495 TCCCTCCTCCCCTGAGGCCCAGG - Intergenic
986367721 5:7050660-7050682 CCACTCCTTCCCTTAGCCTCTGG - Intergenic
986681594 5:10238078-10238100 CCTCTCCTCCCCTCACCCTCTGG - Intronic
986684033 5:10260088-10260110 CTCTTCCTTCCCTGACCCTCTGG - Intronic
989602456 5:43212533-43212555 GCCCTCCTCTCCTGAGCCCCAGG - Intronic
990444631 5:55882684-55882706 CCTCTCCTTCCTTGACCCCTAGG - Intronic
990990412 5:61678300-61678322 CCCCACCTTCCCACACCCCATGG + Intronic
991081805 5:62608917-62608939 CCCTCCCTCCCCTGAGCCCCTGG + Intronic
991149874 5:63355331-63355353 CCCTCCCTTCCCTCAACCCCAGG + Intergenic
992681673 5:79159668-79159690 CCCCTTGTCCCCCGACCCCCAGG + Intronic
993457862 5:88145394-88145416 GCCCACTATCCCTGACCCCCGGG - Intergenic
993626189 5:90227642-90227664 CCCTTCCTTTCCTGCCCCCTAGG + Intergenic
995379152 5:111512600-111512622 CCCCCCCTCCCCGGAGCCCCCGG - Intergenic
996760673 5:126983283-126983305 CCACCCCTTCCCTGCCCTCCTGG - Intronic
998891273 5:146748497-146748519 CCCATCCTTTCCTTATCCCCTGG + Intronic
999315600 5:150582182-150582204 TCGCTCCTTCCAGGACCCCCAGG + Intergenic
1000049451 5:157549200-157549222 CACCTACTTCCCTGACCACATGG + Intronic
1001037776 5:168310027-168310049 CTCCCCCTTCCCTGTCCCCTTGG + Intronic
1001630115 5:173168665-173168687 CCACCCCTCCCCTCACCCCCAGG - Intergenic
1002023939 5:176384150-176384172 CACCTCCTTGCCTTACACCCTGG + Exonic
1003173220 6:3736368-3736390 CCCTTCCCTCCCTGTCCACCAGG + Intronic
1003276314 6:4656253-4656275 CCCCCTCCTCCCTGAGCCCCTGG + Intergenic
1003460042 6:6320713-6320735 ACCCTCCTCCCCTGTCCCACAGG + Exonic
1003490951 6:6620985-6621007 CCCCTGCTCCCCTCTCCCCCGGG - Intronic
1003552152 6:7108897-7108919 CCCCTCCTCCCCAGGCCCCCCGG - Intronic
1003707659 6:8552310-8552332 CCCTTCCTTCCTTGAACTCCTGG - Intergenic
1003754735 6:9104262-9104284 CCCCTCTTTGCCTGCCCACCAGG - Intergenic
1003869170 6:10388325-10388347 CCACTCCCACCCTCACCCCCAGG + Intergenic
1004026866 6:11827455-11827477 CCTCTCCTTCCCTGCCCCCAGGG + Intergenic
1004204146 6:13575238-13575260 CCCCTCCAGCCCTGCCCCTCTGG - Intronic
1004924080 6:20402479-20402501 CCCCTCCTCCCCAGTGCCCCCGG + Exonic
1005369776 6:25120178-25120200 CCCCCCCATACCTCACCCCCTGG + Intergenic
1005866518 6:29942085-29942107 CCACTCCTTACCTGTCCACCTGG - Exonic
1006065920 6:31462738-31462760 CCATTCCTTGCCTGTCCCCCTGG - Intergenic
1006151517 6:31992593-31992615 CCCCTGCTTCCCTGAGCCTTGGG + Intronic
1006152280 6:31995933-31995955 ACCCTCCTTTCCTGCCCTCCAGG + Exonic
1006157818 6:32025331-32025353 CCCCTGCTTCCCTGAGCCTTGGG + Intronic
1006158583 6:32028671-32028693 ACCCTCCTTTCCTGCCCTCCAGG + Exonic
1006321785 6:33323455-33323477 GCCCTGCTTTCCTGTCCCCCAGG + Intronic
1006396455 6:33790403-33790425 CCCTCCCCTCCCTGACACCCTGG + Intergenic
1006504140 6:34477010-34477032 CCCCTCGTTCCCTGGCCCTCAGG + Intronic
1007102682 6:39260944-39260966 CCCTCCATTCCCTGACCCACTGG + Intergenic
1007335202 6:41150652-41150674 CCCCTCCATCCCTCAGCCCTGGG + Intronic
1007764444 6:44152523-44152545 TCCCTCCTTCCCTGCCCCTCTGG + Intronic
1007817055 6:44531879-44531901 CTCCTCCTTCCCTGCCCACCTGG + Intergenic
1009326792 6:62360596-62360618 TCCTTCCTTCCCTCAGCCCCAGG - Intergenic
1009336723 6:62499595-62499617 CCCCTCCTACCCTGAACACATGG - Intergenic
1011735287 6:90303914-90303936 CACCTCCTTCCCTGTTTCCCAGG - Intergenic
1013368306 6:109450647-109450669 CCCTTCCTTCTCTGGGCCCCAGG - Intronic
1014136528 6:117896187-117896209 CACTTCCTTTCCTGACCTCCAGG - Intergenic
1014516915 6:122390586-122390608 TTCCTCCTTCCCTCAGCCCCTGG - Intergenic
1015200761 6:130577620-130577642 CCTCTCTGTCCCTGACACCCAGG + Intergenic
1015973799 6:138769165-138769187 CCCTTCCTGACCTGACCCTCTGG + Intronic
1016190277 6:141256243-141256265 CACCTCCTTCCCTTTCCCCAAGG - Intergenic
1016329931 6:142945336-142945358 CCCCTCCGACCCTCACCCTCGGG + Intergenic
1017224864 6:152009101-152009123 CCCTCCCTTCCCCCACCCCCTGG + Intronic
1017770051 6:157638070-157638092 CTCCTCCCTCCCTCTCCCCCTGG - Intronic
1017907756 6:158768543-158768565 CCTCTCCTTCACAGACCCGCTGG - Intronic
1018857596 6:167685723-167685745 GCCCTCCCTCCCTGAGCCCTGGG - Intergenic
1018952660 6:168389249-168389271 GCCCTCCTCACCTGACCCCAGGG + Intergenic
1019045096 6:169139660-169139682 GCCCTTCATCCCTGACCGCCAGG + Intergenic
1019089920 6:169520000-169520022 CCTCTCCCTCCCTAAACCCCTGG + Intronic
1019320500 7:413278-413300 CCCCTCCCTCCCAGACCCCTTGG - Intergenic
1019340789 7:507875-507897 CCCCTCCTTCCCTGACCCCCCGG + Intronic
1019608568 7:1923405-1923427 CCTCTTCTACCCTGACACCCAGG + Intronic
1019725994 7:2603022-2603044 CCCCTCCGTGCCTGGCCTCCTGG + Intronic
1020086874 7:5315222-5315244 CGCCCCCATCCCTGATCCCCGGG - Intronic
1020089740 7:5332561-5332583 CCCCTCCCTCACGGAACCCCAGG + Intronic
1020169634 7:5835159-5835181 CTCCTCCTGCTCTGAACCCCGGG + Intergenic
1021110154 7:16684719-16684741 TCCCTCATTCCCTCACTCCCTGG + Intronic
1021719484 7:23491731-23491753 CCCCTACTTCCCTCCCTCCCCGG + Intergenic
1022103009 7:27180313-27180335 CCGCCCCCTCCCTGCCCCCCAGG + Intergenic
1022952343 7:35350975-35350997 CCCCACCTTCCCCGCCCCCTAGG - Intergenic
1023336318 7:39174609-39174631 CTCCTCCTTCCTTCACCCCATGG + Intronic
1023761914 7:43472312-43472334 CACGACCTTCCCTGACCCCTAGG + Intronic
1023823134 7:43991136-43991158 CCAGTCCTGCCCTGACCTCCTGG - Intergenic
1024237127 7:47407263-47407285 CCACTCCTTCTCTGACACGCTGG + Intronic
1024771061 7:52723919-52723941 CCCCCCCTACCCCTACCCCCCGG + Intergenic
1025129397 7:56367740-56367762 CCCCTCCCACGCTGACCCCTTGG - Intergenic
1025129682 7:56368871-56368893 CCCCTCCCACGCTGACCCCTTGG - Intergenic
1025130095 7:56370545-56370567 CCCCTCCCACACTGACCCCTTGG - Intergenic
1025130415 7:56371843-56371865 CCCCTCCCACACTGACCCCTTGG - Intergenic
1025130736 7:56373141-56373163 CCCCTCCCACACTGACCCCTTGG - Intergenic
1025131050 7:56374434-56374456 CCCCTCCCACACTGACCCCTTGG - Intergenic
1025144756 7:56493545-56493567 ACCCTCCATCCCTGCTCCCCAGG - Intergenic
1025207437 7:57001931-57001953 CGCCCCCATCCCTGATCCCCGGG + Intergenic
1025664498 7:63574955-63574977 CGCCCCCATCCCTGATCCCCGGG - Intergenic
1026515323 7:71064815-71064837 CCCCTCCTACTCTCAACCCCTGG - Intergenic
1026632961 7:72053786-72053808 CCCCTCCCACCCTTCCCCCCAGG + Intronic
1026647627 7:72186044-72186066 CCTCTCCTTCTCTCACCCTCCGG - Intronic
1026767118 7:73167095-73167117 CCCCTTCTGTCCTCACCCCCAGG + Intergenic
1026995368 7:74612540-74612562 TCACTTCTTCCCTGTCCCCCAGG + Intergenic
1027043587 7:74976806-74976828 CCCCTTCTGTCCTCACCCCCAGG + Intronic
1027080060 7:75225553-75225575 CCCCTTCTGTCCTCACCCCCAGG - Intergenic
1027345797 7:77258226-77258248 CCCCTCCTCCCTCCACCCCCTGG + Intronic
1027349331 7:77294395-77294417 ACCCTCCTACCCTAAACCCCAGG + Intronic
1027497359 7:78904788-78904810 CCACCCCTCCCCTGGCCCCCGGG + Intronic
1028369867 7:90078995-90079017 CCTCCCCTTCCCTGCCTCCCAGG - Intergenic
1029114943 7:98231999-98232021 GCCCTCCTCCCCTGGCACCCCGG - Intronic
1029389279 7:100264158-100264180 CCCCTTCTGTCCTCACCCCCAGG - Intronic
1029439070 7:100577422-100577444 CGCCTCCTTCCCTGACCCCGGGG - Intronic
1029495221 7:100892818-100892840 CCCCCCTCTCCCTCACCCCCAGG - Exonic
1029546460 7:101212831-101212853 CCCCACCTCACCTGCCCCCCCGG + Exonic
1029651748 7:101898035-101898057 CCCCTAGATCCCTGACCCCTCGG - Intronic
1029751398 7:102544574-102544596 CCAGTCCTGCCCTGACCTCCTGG - Intronic
1029769350 7:102643668-102643690 CCAGTCCTGCCCTGACCTCCTGG - Intronic
1030077586 7:105749852-105749874 CCCCTGCTTCCTTCTCCCCCAGG + Intronic
1030299640 7:107962307-107962329 CCTCTCCTTCCCTCACAACCTGG - Intronic
1031192405 7:118570737-118570759 TCCCTTCTTCCCTCAGCCCCTGG - Intergenic
1031888375 7:127264619-127264641 TCCCTCATACCCTGTCCCCCAGG + Intergenic
1032165653 7:129542743-129542765 CCCAACCTACCCTGACCCTCTGG + Intergenic
1032475604 7:132209531-132209553 CCCCTCCTCCCCTGGCTGCCAGG - Intronic
1032482894 7:132261159-132261181 CCCCTTCTTCCATGTCCCCTGGG - Intronic
1032614729 7:133455382-133455404 CCCCACCTCCCCTAACCCCTGGG - Intronic
1033360428 7:140635469-140635491 CCCCTCCTCCCGGGATCCCCAGG - Intronic
1033432528 7:141301981-141302003 CTCCTCCTTCCCCCAACCCCTGG - Intronic
1034129010 7:148698851-148698873 CTCCTCCTCCCCTGCCCGCCCGG - Intronic
1034175587 7:149097201-149097223 CCCCTCATAGCCTGAACCCCTGG - Intergenic
1034401415 7:150864042-150864064 CCCCTCCTCCCCTGAGGCCCCGG + Intergenic
1034414776 7:150958583-150958605 CCCCTCCTTCCCTTACCCAGCGG - Intronic
1034440534 7:151083513-151083535 CCCCTCCTTCCCCGCCGCCGCGG + Intronic
1034931583 7:155167759-155167781 CCACTCCTTGCCTGAGCTCCAGG + Intergenic
1034975871 7:155449069-155449091 TCTCTCCTTCCCTGCCCCCACGG + Intergenic
1035021638 7:155804146-155804168 ACCCTCCTTCCCTCCCGCCCCGG + Intronic
1035295917 7:157866997-157867019 CCACCCCGTCCCTGACGCCCTGG + Intronic
1035295956 7:157867115-157867137 CCACCCCGTCCCTGACGCCCTGG + Intronic
1035295991 7:157867217-157867239 CCACCCCGTCCCTGACGCCCTGG + Intronic
1035296002 7:157867251-157867273 CCACCCCGTCCCTGACGCCCTGG + Intronic
1035296013 7:157867285-157867307 CCACCCCGTCCCTGACGCCCTGG + Intronic
1035305517 7:157928984-157929006 CCCCTCCTGCCCTGACGTTCTGG - Intronic
1036621100 8:10424903-10424925 CTGCTCCTTCGCTGTCCCCCGGG - Intronic
1036667214 8:10754967-10754989 CACCCGCTTCCCTGACACCCTGG - Intronic
1037800396 8:22031393-22031415 CTCCTCCTTGCCTGAGCCCAAGG + Intronic
1037825310 8:22156847-22156869 CCTCCCCTTCCGTGACTCCCAGG - Intronic
1037882295 8:22579166-22579188 CCCCGCCTTCCCTCCCTCCCGGG + Exonic
1038258464 8:25972233-25972255 CCCCTCCTTCGTAGACCCCGAGG + Intronic
1038296026 8:26291663-26291685 CCCCTCCTTCCTTTTCCCCCCGG + Intronic
1038483061 8:27914884-27914906 CCCCTCATTGGCTGATCCCCAGG - Intronic
1038534774 8:28346260-28346282 TCCCTCCTTCCCAGCCCACCCGG - Exonic
1039367623 8:36947690-36947712 CCCCTCCTTTTCTCACCCTCTGG - Intergenic
1039592581 8:38762280-38762302 CTCCTCCTTCCCCCAGCCCCCGG + Intronic
1039858545 8:41437032-41437054 CCTCTCCATCCCTGGCCCCAGGG + Intergenic
1040085804 8:43339480-43339502 CCCCTTGCTCCCTCACCCCCAGG - Intergenic
1041289211 8:56292980-56293002 CTCTTCCTTCCCTGAAGCCCTGG + Intergenic
1042222908 8:66490841-66490863 CCCCTACCTCCATGACCTCCTGG - Intronic
1042683840 8:71416030-71416052 CCCCTGCTTCCCTGTGCCGCAGG + Intronic
1042727592 8:71894192-71894214 CCCCACCTTCCCTGCACCACAGG - Intronic
1042857100 8:73278435-73278457 CTTCTCCTACCCTGACGCCCGGG + Intergenic
1043944198 8:86231369-86231391 ACCCTCCTTCCCTCTGCCCCTGG - Intronic
1044186247 8:89255186-89255208 ACCATCCTTTCCTGACTCCCTGG - Intergenic
1044213506 8:89580050-89580072 CACTTCCTTCCCTCACCCCTAGG - Intergenic
1044856356 8:96480015-96480037 TCCCTCCTTCCCCCAACCCCTGG - Intergenic
1044866676 8:96577742-96577764 CCCCTCTTCCCCTGAACCCCTGG + Intronic
1045185805 8:99837034-99837056 CCCCTCTTTCCCAGTCCTCCTGG + Intronic
1045286461 8:100795972-100795994 CCCCACCTTTCCTGCCCTCCTGG - Intergenic
1047448004 8:124937264-124937286 CCCCACCTTCCCTGAGTTCCTGG - Intergenic
1047520346 8:125591140-125591162 CTCCTCCTTCCCATACCCCTAGG - Intergenic
1047608696 8:126499652-126499674 CACATCTTTCCCTGACTCCCTGG + Intergenic
1047997381 8:130349707-130349729 CCCCTTCTTCCCTGCCTCACAGG + Intronic
1048295496 8:133210725-133210747 CCCATCCTGCCCTCACCCCATGG + Intronic
1048972592 8:139653608-139653630 CCACCCCTTCCCTCACCCCAAGG + Intronic
1048989869 8:139754981-139755003 CCCGTCCTTCCCAGGGCCCCTGG - Intronic
1049240490 8:141535318-141535340 CCCCTCCTCCCCAGTCCCTCTGG - Intergenic
1049310998 8:141933799-141933821 TTGCTCCTTCCCTGACACCCTGG - Intergenic
1049366905 8:142243593-142243615 CACCTCCTCCCCTGCTCCCCCGG - Intronic
1049368990 8:142254581-142254603 CCCCTCCCTCCAGCACCCCCTGG + Intronic
1049424066 8:142530281-142530303 CCCTTCCTTCCCTGTTCCCTTGG - Intronic
1049511051 8:143026814-143026836 CCCCTCCTCCCCTGCCCCAAGGG - Intergenic
1049545066 8:143226752-143226774 TCCATCCTTCTCTGACCCCCAGG + Intergenic
1049554338 8:143274682-143274704 CCCCAGCCTCCCTGACCCCCAGG + Exonic
1049575667 8:143388650-143388672 CCCCTCCTCTGCTGACACCCAGG - Intergenic
1049673368 8:143879263-143879285 CCCCTCCTCCTCTGTCCCCAAGG + Intergenic
1049692719 8:143969685-143969707 GCACTCATGCCCTGACCCCCAGG - Intronic
1050044158 9:1526112-1526134 CCCCTCCTTCCTTCAGCCCTGGG + Intergenic
1050090854 9:2015894-2015916 ATCCTCCTCCCCTGTCCCCCAGG - Intronic
1050601080 9:7252123-7252145 CTCCTCCTACCCTCAACCCCTGG + Intergenic
1051669350 9:19494511-19494533 CCACTTCTGCCCTGACCCCCTGG - Intergenic
1051807740 9:21014542-21014564 TCCCTCTTTCCCTCAGCCCCTGG - Intronic
1052951359 9:34215526-34215548 CCCCTCCAACCCTTCCCCCCAGG - Intronic
1053141264 9:35684315-35684337 CCCATCCTGCCTTTACCCCCAGG - Exonic
1053240591 9:36491612-36491634 TCCCTCCTCCCCTCAGCCCCTGG + Intergenic
1053423519 9:37996259-37996281 CCTCCCCTTCCCTCACACCCAGG + Intronic
1053737933 9:41113433-41113455 CACCCCCTTCCCCCACCCCCCGG + Intergenic
1054810476 9:69430271-69430293 TCCCTCCTTCCCAGACTCCTGGG + Exonic
1056602797 9:88059621-88059643 CCCCGCCTCCCCTTGCCCCCAGG + Intergenic
1056789362 9:89615753-89615775 CCCCACCTGGCCTGTCCCCCAGG - Intergenic
1057040589 9:91844861-91844883 CCCCGCCTTCCCTGTCCCATGGG - Intronic
1057199431 9:93132500-93132522 ACCCACCTTCCCTGCCCTCCAGG + Intronic
1057267605 9:93629641-93629663 CTCTTCCTTCCCTGCCCCCTGGG + Intronic
1057291456 9:93809895-93809917 CCCCTCCCTCCCTCTCTCCCAGG - Intergenic
1057842593 9:98498216-98498238 CCCCTCCTTCCCTCAGCTGCTGG - Intronic
1058495564 9:105555066-105555088 CCTGCCCTTCCCTGATCCCCTGG - Intergenic
1058935074 9:109762840-109762862 CCCCTCCTTCCCATTCCCCAGGG + Intronic
1059282801 9:113149271-113149293 GCACTCCTTCCCTGTCCCCCAGG - Intergenic
1059354482 9:113688114-113688136 CCCGTCCTCCCCTCACCCGCGGG + Intergenic
1059395876 9:114033707-114033729 CCCCTCCTGCCCTGCCTCTCAGG - Intronic
1059461854 9:114436210-114436232 CTCATCCTTCCCTGAGCCTCAGG - Intronic
1060200643 9:121650275-121650297 CCCCTCCTGCCCCTCCCCCCTGG + Intronic
1060643542 9:125259373-125259395 CCTCTCCTTCCCTTCCTCCCTGG + Intergenic
1060973510 9:127752392-127752414 CCTCTCCTTCCCCCACCTCCAGG + Intronic
1061041523 9:128143803-128143825 CCCTTCCTTCCCATACCTCCGGG - Intergenic
1061059150 9:128242097-128242119 CCCCACCCTCCCTGACTGCCAGG + Intronic
1061078336 9:128355219-128355241 CCCCTCCTCCCCCAACCCTCAGG - Intronic
1061232167 9:129321318-129321340 CCCCTCCCTCCTTGCCTCCCAGG - Intergenic
1061475726 9:130864720-130864742 TCCCTCCTTCGTTCACCCCCTGG - Intronic
1061621092 9:131811837-131811859 CCCAGCCCTCCCTGACCCCGGGG + Intergenic
1061707937 9:132467354-132467376 CCCCTCCTCCCCTCAGCTCCTGG + Intronic
1061790126 9:133054819-133054841 CCCCTCCATTCCTGGCCTCCAGG - Intronic
1061802526 9:133120357-133120379 ACCCTCCTCCCCTCACCACCAGG + Intronic
1061805850 9:133137510-133137532 CCCGCCCTTCCCTGGCCCTCCGG - Intronic
1061808291 9:133148516-133148538 CCCGTCCTACTCTGAGCCCCAGG + Intronic
1061917137 9:133761079-133761101 CTCCCCCCTCCCTGATCCCCTGG - Intergenic
1062003004 9:134226205-134226227 CCCCTGCCTCCCAGCCCCCCTGG - Intergenic
1062022171 9:134324976-134324998 CCCCCTCTTCACTGACCCCTGGG - Intronic
1062172731 9:135144507-135144529 CGGCTCATTCCCTGTCCCCCAGG + Intergenic
1062315554 9:135965422-135965444 CCCCTCCCTCCCTCACCCCTGGG + Intergenic
1062347889 9:136123733-136123755 CGTCTCCTTCCCTGGCCTCCTGG - Intergenic
1062444661 9:136588550-136588572 CCCTTCCTGCCCTGCCCCTCTGG - Intergenic
1062474565 9:136720650-136720672 CCTGTCCTTCCCTGTCCCACAGG - Intronic
1062475758 9:136726266-136726288 GCCCTCCTTCCCTGCCTGCCGGG - Intergenic
1062520489 9:136955727-136955749 CCCCTCCATCCCTGCCCCTTGGG + Intronic
1062534811 9:137016738-137016760 CCCTCCCCTCCCCGACCCCCAGG - Exonic
1062536738 9:137024339-137024361 GCCCACCTTCCCTGGCCCCAGGG - Intronic
1062637937 9:137501268-137501290 CCCCTCCCACACTGAGCCCCCGG + Intronic
1186196229 X:7112734-7112756 CCACTGCAGCCCTGACCCCCCGG + Intronic
1186428859 X:9487307-9487329 CCCCTTCTCCCCAGCCCCCCTGG + Intronic
1187017108 X:15340835-15340857 CACCTTCTTCCCTCATCCCCTGG + Intergenic
1187626533 X:21120901-21120923 CCCCTACTACCCTCAACCCCTGG + Intergenic
1188246415 X:27840780-27840802 CCCCCCCATCCCTGCACCCCTGG + Intergenic
1189196253 X:39156035-39156057 CCCCTCCTTAGCTTAGCCCCAGG + Intergenic
1189340477 X:40201127-40201149 CTCCTCCTTCCCTTCTCCCCTGG + Intergenic
1189424143 X:40882846-40882868 CCCACCTTTCCCTGCCCCCCAGG + Intergenic
1189833026 X:44994249-44994271 CCCCACCCTCCCTGAGCCTCTGG + Intronic
1190066269 X:47243618-47243640 CCCCTCCGCCCCCCACCCCCGGG - Intronic
1190242559 X:48668728-48668750 GGACTCCTTCCCTGACACCCTGG - Intergenic
1190737972 X:53268179-53268201 ACCCTCATTCCCAGACCCCTTGG + Intronic
1192146764 X:68687829-68687851 CCCCTCCCTCCCTGTCCTCTGGG + Intronic
1192168537 X:68840790-68840812 CCCCTTTTTCCCTGCCCCCTGGG + Exonic
1192236511 X:69299617-69299639 CCCCTCCTCCCATGACCCTGGGG + Intergenic
1196918290 X:120561291-120561313 GCCTTCCTTCCCTGGCCCACCGG + Intronic
1197721674 X:129749227-129749249 TCCCCCCTCCCCTGAGCCCCAGG - Intronic
1198513134 X:137374300-137374322 CCCCGCCCTCCCCCACCCCCGGG - Intergenic
1199440441 X:147862037-147862059 TTCCTCCTTCCCTCAGCCCCTGG - Intergenic
1200231728 X:154447122-154447144 CCCCTCCTTCCTTGACCCCTGGG - Intronic
1200361602 X:155612758-155612780 ACACCCCTTCCCTGACCCACGGG + Intronic