ID: 1019343004 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:517352-517374 |
| Sequence | TCCGCGCGCGGGGAGGGCGC GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 334 | |||
| Summary | {0: 1, 1: 1, 2: 4, 3: 46, 4: 282} |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1019343004_1019343020 | 28 | Left | 1019343004 | 7:517352-517374 | CCCGCGCCCTCCCCGCGCGCGGA | 0: 1 1: 1 2: 4 3: 46 4: 282 |
||
| Right | 1019343020 | 7:517403-517425 | CTATCTCCAGGAGTCGCTGGAGG | 0: 1 1: 0 2: 0 3: 15 4: 126 |
||||
| 1019343004_1019343016 | 2 | Left | 1019343004 | 7:517352-517374 | CCCGCGCCCTCCCCGCGCGCGGA | 0: 1 1: 1 2: 4 3: 46 4: 282 |
||
| Right | 1019343016 | 7:517377-517399 | GAAGGGGCGCGATTTACCTACGG | 0: 1 1: 0 2: 0 3: 5 4: 29 |
||||
| 1019343004_1019343019 | 25 | Left | 1019343004 | 7:517352-517374 | CCCGCGCCCTCCCCGCGCGCGGA | 0: 1 1: 1 2: 4 3: 46 4: 282 |
||
| Right | 1019343019 | 7:517400-517422 | AGTCTATCTCCAGGAGTCGCTGG | 0: 1 1: 0 2: 0 3: 3 4: 70 |
||||
| 1019343004_1019343017 | 16 | Left | 1019343004 | 7:517352-517374 | CCCGCGCCCTCCCCGCGCGCGGA | 0: 1 1: 1 2: 4 3: 46 4: 282 |
||
| Right | 1019343017 | 7:517391-517413 | TACCTACGGAGTCTATCTCCAGG | 0: 1 1: 0 2: 0 3: 3 4: 42 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1019343004 | Original CRISPR | TCCGCGCGCGGGGAGGGCGC GGG (reversed) | Intronic | ||