ID: 1019343004

View in Genome Browser
Species Human (GRCh38)
Location 7:517352-517374
Sequence TCCGCGCGCGGGGAGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 1, 2: 4, 3: 46, 4: 282}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019343004_1019343020 28 Left 1019343004 7:517352-517374 CCCGCGCCCTCCCCGCGCGCGGA 0: 1
1: 1
2: 4
3: 46
4: 282
Right 1019343020 7:517403-517425 CTATCTCCAGGAGTCGCTGGAGG 0: 1
1: 0
2: 0
3: 15
4: 126
1019343004_1019343016 2 Left 1019343004 7:517352-517374 CCCGCGCCCTCCCCGCGCGCGGA 0: 1
1: 1
2: 4
3: 46
4: 282
Right 1019343016 7:517377-517399 GAAGGGGCGCGATTTACCTACGG 0: 1
1: 0
2: 0
3: 5
4: 29
1019343004_1019343019 25 Left 1019343004 7:517352-517374 CCCGCGCCCTCCCCGCGCGCGGA 0: 1
1: 1
2: 4
3: 46
4: 282
Right 1019343019 7:517400-517422 AGTCTATCTCCAGGAGTCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 70
1019343004_1019343017 16 Left 1019343004 7:517352-517374 CCCGCGCCCTCCCCGCGCGCGGA 0: 1
1: 1
2: 4
3: 46
4: 282
Right 1019343017 7:517391-517413 TACCTACGGAGTCTATCTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019343004 Original CRISPR TCCGCGCGCGGGGAGGGCGC GGG (reversed) Intronic