ID: 1019343461

View in Genome Browser
Species Human (GRCh38)
Location 7:519057-519079
Sequence CGCCGCCACAGGAGACCGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 78}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019343461_1019343472 18 Left 1019343461 7:519057-519079 CCAGCCGGTCTCCTGTGGCGGCG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1019343472 7:519098-519120 TAGGGAGCGCGGCCCGGAGGAGG 0: 1
1: 0
2: 2
3: 20
4: 194
1019343461_1019343468 12 Left 1019343461 7:519057-519079 CCAGCCGGTCTCCTGTGGCGGCG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1019343468 7:519092-519114 ATCCCTTAGGGAGCGCGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 53
1019343461_1019343474 22 Left 1019343461 7:519057-519079 CCAGCCGGTCTCCTGTGGCGGCG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1019343474 7:519102-519124 GAGCGCGGCCCGGAGGAGGGTGG 0: 1
1: 0
2: 3
3: 37
4: 394
1019343461_1019343473 19 Left 1019343461 7:519057-519079 CCAGCCGGTCTCCTGTGGCGGCG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1019343473 7:519099-519121 AGGGAGCGCGGCCCGGAGGAGGG 0: 1
1: 0
2: 3
3: 27
4: 342
1019343461_1019343475 27 Left 1019343461 7:519057-519079 CCAGCCGGTCTCCTGTGGCGGCG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1019343475 7:519107-519129 CGGCCCGGAGGAGGGTGGCGCGG 0: 1
1: 0
2: 3
3: 31
4: 433
1019343461_1019343477 29 Left 1019343461 7:519057-519079 CCAGCCGGTCTCCTGTGGCGGCG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1019343477 7:519109-519131 GCCCGGAGGAGGGTGGCGCGGGG 0: 1
1: 0
2: 1
3: 31
4: 378
1019343461_1019343476 28 Left 1019343461 7:519057-519079 CCAGCCGGTCTCCTGTGGCGGCG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1019343476 7:519108-519130 GGCCCGGAGGAGGGTGGCGCGGG 0: 1
1: 0
2: 1
3: 45
4: 551
1019343461_1019343471 15 Left 1019343461 7:519057-519079 CCAGCCGGTCTCCTGTGGCGGCG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1019343471 7:519095-519117 CCTTAGGGAGCGCGGCCCGGAGG 0: 1
1: 0
2: 4
3: 7
4: 95
1019343461_1019343466 7 Left 1019343461 7:519057-519079 CCAGCCGGTCTCCTGTGGCGGCG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1019343466 7:519087-519109 GTACCATCCCTTAGGGAGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 51
1019343461_1019343465 0 Left 1019343461 7:519057-519079 CCAGCCGGTCTCCTGTGGCGGCG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1019343465 7:519080-519102 AAATTCAGTACCATCCCTTAGGG 0: 1
1: 0
2: 0
3: 8
4: 128
1019343461_1019343464 -1 Left 1019343461 7:519057-519079 CCAGCCGGTCTCCTGTGGCGGCG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1019343464 7:519079-519101 GAAATTCAGTACCATCCCTTAGG 0: 1
1: 0
2: 2
3: 12
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019343461 Original CRISPR CGCCGCCACAGGAGACCGGC TGG (reversed) Exonic