ID: 1019344018

View in Genome Browser
Species Human (GRCh38)
Location 7:520905-520927
Sequence TGCACAGCACGCCACCCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 77}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019344018_1019344020 -5 Left 1019344018 7:520905-520927 CCAGCGGGGTGGCGTGCTGTGCA 0: 1
1: 0
2: 1
3: 11
4: 77
Right 1019344020 7:520923-520945 GTGCAGACCCCGAGGCTAGACGG 0: 1
1: 0
2: 0
3: 17
4: 104
1019344018_1019344026 16 Left 1019344018 7:520905-520927 CCAGCGGGGTGGCGTGCTGTGCA 0: 1
1: 0
2: 1
3: 11
4: 77
Right 1019344026 7:520944-520966 GGCCTAGGCCCCTGGAGCCCAGG 0: 1
1: 0
2: 5
3: 43
4: 474
1019344018_1019344025 8 Left 1019344018 7:520905-520927 CCAGCGGGGTGGCGTGCTGTGCA 0: 1
1: 0
2: 1
3: 11
4: 77
Right 1019344025 7:520936-520958 GGCTAGACGGCCTAGGCCCCTGG 0: 1
1: 0
2: 1
3: 5
4: 91
1019344018_1019344021 1 Left 1019344018 7:520905-520927 CCAGCGGGGTGGCGTGCTGTGCA 0: 1
1: 0
2: 1
3: 11
4: 77
Right 1019344021 7:520929-520951 ACCCCGAGGCTAGACGGCCTAGG 0: 1
1: 0
2: 0
3: 4
4: 102
1019344018_1019344031 30 Left 1019344018 7:520905-520927 CCAGCGGGGTGGCGTGCTGTGCA 0: 1
1: 0
2: 1
3: 11
4: 77
Right 1019344031 7:520958-520980 GAGCCCAGGAGACGCTTCCTTGG 0: 1
1: 0
2: 1
3: 20
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019344018 Original CRISPR TGCACAGCACGCCACCCCGC TGG (reversed) Intergenic
900956602 1:5889870-5889892 TGCACAGCCCACCACCCTGGGGG + Intronic
901631090 1:10648486-10648508 TTCACAGCAGGCTTCCCCGCGGG + Intronic
906520180 1:46462106-46462128 TGCACAGCACCCCCCACCTCTGG + Intergenic
907373053 1:54015429-54015451 TGCACAGCAGGGCACCCAGGAGG - Intronic
912381271 1:109249538-109249560 TGCAGAGCTCGCCCGCCCGCCGG + Intergenic
922180664 1:223230580-223230602 TGCAGAGCAGGCCACCCTGCCGG + Intronic
923660154 1:235950614-235950636 TGCACAGCCCGGCTCCCCACTGG - Intergenic
1065815535 10:29479493-29479515 TGCACAGCACACAGCCCCACTGG + Intronic
1065957402 10:30705728-30705750 TGCACAGCACACAGCCCCACTGG - Intergenic
1068965197 10:62904955-62904977 TGCACAGTACTCCAGCCCCCTGG - Intronic
1071568173 10:86682184-86682206 TGCACAGGTCCCCACCCCTCTGG + Intronic
1076146474 10:128126243-128126265 TGCAGCGAACGCGACCCCGCGGG - Exonic
1076428197 10:130382174-130382196 TGCACAGCACAGCACCCAGCGGG - Intergenic
1076594412 10:131617153-131617175 TGCACGGGACGCCACCCCGCCGG + Intergenic
1077054992 11:587133-587155 TGCACAGCCCACCTCCCCGCAGG - Intronic
1077282892 11:1753602-1753624 TGGACATCCCGCCACCCAGCGGG - Exonic
1084273073 11:68039229-68039251 AGCTCAGCCCGCCACCCCGCAGG + Intronic
1091290037 11:134434344-134434366 TGCAGACCACGCCACTCTGCAGG - Intergenic
1091407656 12:219349-219371 AGCACAGCACGGCACCACGCGGG + Intergenic
1092995342 12:13944443-13944465 TGGACAGCAGGCCAGCCAGCTGG - Intronic
1096612954 12:52814974-52814996 TGCACACCACCAGACCCCGCTGG - Intergenic
1102224203 12:111216572-111216594 AGCAGAGCACGCCACCCCATCGG + Intronic
1104661379 12:130613414-130613436 AGCCCAGCCCCCCACCCCGCAGG + Intronic
1104981402 12:132574496-132574518 TGCACGGCACACCACCTCCCCGG - Exonic
1113946353 13:114046367-114046389 TGCACAGCAGGACTCCCCACGGG + Intronic
1119847228 14:77839557-77839579 TGCACTGCTCTCCACCCTGCAGG - Intronic
1122445540 14:101765091-101765113 GGCACTGCAGGCCACACCGCAGG - Intronic
1122503624 14:102218017-102218039 TCCACAGCACGCCGGCCAGCTGG + Intronic
1122938914 14:104972569-104972591 TGCACAGCTGGCCACAGCGCTGG + Intronic
1132516058 16:366552-366574 TGCACAGCCCGGCTTCCCGCTGG + Intergenic
1132771526 16:1566335-1566357 AGCACAGCCCACCAACCCGCTGG - Intronic
1140962096 16:79925545-79925567 TGCACTGCACTCCACCCTGGGGG + Intergenic
1141272059 16:82550039-82550061 TGCTCAGCACTCCACCTGGCTGG - Intergenic
1141545952 16:84769316-84769338 TCCACAGCAGGACACCCCGAAGG - Intronic
1141649357 16:85384949-85384971 TGCACAGCACGCTAACCTGCTGG - Intergenic
1144207772 17:12991111-12991133 AGCAAAGCAGGCCACACCGCAGG - Exonic
1151224956 17:72640950-72640972 TGCACTGCACGCCTCTCCTCTGG - Intergenic
1152718160 17:81909761-81909783 TGCTCAGCTCTCCACCCCACTGG + Intronic
1157578191 18:48758022-48758044 GGCTCAGCACCCCACCCCTCAGG + Exonic
1163224006 19:15942400-15942422 ACCACAGCACTCCAGCCCGCTGG - Intergenic
1163382828 19:16980006-16980028 TGCACAGGACGCCCCCACTCTGG + Intronic
1164759129 19:30715108-30715130 TGCACAGCACGCCACTCTGATGG + Intergenic
1166863737 19:45823939-45823961 TGCCCCGCAAGCCACCCTGCCGG - Intronic
1167575319 19:50314990-50315012 TGCACACCTCCCCACCCCCCAGG - Intronic
925330234 2:3053004-3053026 TTCACAGGACGCAACCTCGCAGG + Intergenic
927519295 2:23689457-23689479 TGCCCAGCACCCCTCCCCACCGG + Intronic
929127400 2:38534348-38534370 TGCACAGCCAGCCTCCCCCCTGG - Intergenic
933709793 2:85316438-85316460 TGCACAGCAGGGCACCTTGCAGG - Intergenic
933713270 2:85343325-85343347 TGCACAGCAGGGCACCTTGCAGG + Exonic
938536521 2:132253355-132253377 GGCACAGCACGTCACCCAGAGGG + Intronic
946058856 2:216924398-216924420 TGCAGAGCAAGCTACCCCACGGG - Intergenic
948127320 2:235573926-235573948 TGAACAGAATGCCAACCCGCTGG - Intronic
948189578 2:236047305-236047327 TGCACAGCCCACCTCCCCACTGG - Intronic
1171255513 20:23686600-23686622 TGCCCAGCACCCAGCCCCGCAGG + Intronic
1176167956 20:63684210-63684232 TTCCCAGCACGCCACACCGGTGG + Intronic
1181158468 22:20941020-20941042 AGCACTGCAGGCCACCCAGCAGG - Intronic
1181766941 22:25098944-25098966 TGCAGAGCACGCCTCCACACAGG - Intronic
1183098146 22:35566918-35566940 TGCACAGCTCCCCACTCCCCTGG + Intergenic
1184777280 22:46629498-46629520 TGCACAGCCCCCCACCCCGGGGG - Intronic
961811271 3:129523235-129523257 TCCCCAGCACGCCACCCTGGGGG + Intergenic
962712723 3:138101404-138101426 TGCACAGCAGCCTCCCCCGCTGG + Intronic
963008895 3:140751152-140751174 TGCATAGCACCCCTCCCAGCAGG + Intergenic
963040462 3:141066234-141066256 TGCACAGCCAGCCCCGCCGCTGG - Exonic
963235026 3:142947638-142947660 TGGAAAGCACGACATCCCGCAGG + Intergenic
966879714 3:184343265-184343287 TGCACAGCCCAGCACCTCGCAGG + Intronic
968224569 3:196965681-196965703 TGCACAGCCAGCCACCCCTAAGG - Intronic
968613413 4:1567128-1567150 TTCACAGCATCCCACCCTGCGGG + Intergenic
968949121 4:3681340-3681362 TGCACACAACGCCTCCCCTCGGG - Intergenic
969665337 4:8554149-8554171 TGCGCAGGACGCCACCTGGCAGG + Intergenic
975111941 4:70638336-70638358 GGCATAGCACCCCACCCCCCTGG + Intronic
1000881249 5:166700383-166700405 TTGACAGCACGCCCCCCTGCGGG + Intergenic
1007091740 6:39189134-39189156 TGCAGAGGCCGCCACCCAGCAGG - Exonic
1013584632 6:111567215-111567237 TGCACAGCACACCACCCCCGAGG - Intronic
1015276617 6:131388856-131388878 TGAGCAGCTCGCCACCCCACGGG - Intergenic
1019344018 7:520905-520927 TGCACAGCACGCCACCCCGCTGG - Intergenic
1021966656 7:25926895-25926917 TGCACAGCATGCCATGCCTCCGG - Intergenic
1032116636 7:129123207-129123229 TGCACAGCACACAAGCCAGCGGG + Intergenic
1036561416 8:9903222-9903244 TGCACACCTCCCCACCCCACGGG + Intergenic
1038037973 8:23702492-23702514 TGGCCAGAATGCCACCCCGCAGG - Exonic
1049199843 8:141334648-141334670 TGCCCAGCACCCCACACAGCTGG + Intergenic
1054780965 9:69165808-69165830 TGCAAAGCACGCTCCCCAGCAGG + Intronic
1056929181 9:90860648-90860670 TGCACAGCACCCCACAGCTCAGG - Intronic
1060911378 9:127353954-127353976 TCCACAGCATGCCACCCGGCAGG - Intronic
1061394780 9:130337964-130337986 TGCACAGCCAGTAACCCCGCCGG + Intronic
1061406634 9:130396008-130396030 TGCACAGCCCGCAACGCCGCAGG + Intronic
1061870002 9:133515459-133515481 GGCACAGGACACCTCCCCGCTGG + Intronic
1194810281 X:98380358-98380380 TGCACACCACCCCACCCCAATGG - Intergenic
1198360491 X:135890390-135890412 TGCACAGCAGGCCCCCGCGGAGG + Intronic
1200210966 X:154346433-154346455 TGCACAGGCCTCCAACCCGCAGG - Intergenic
1200219886 X:154385659-154385681 TGCACAGGCCTCCAACCCGCAGG + Intergenic