ID: 1019344722

View in Genome Browser
Species Human (GRCh38)
Location 7:523629-523651
Sequence TCCTGGGCAGGTGGGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019344722_1019344730 0 Left 1019344722 7:523629-523651 CCCTCCTGCCCACCTGCCCAGGA No data
Right 1019344730 7:523652-523674 AAAGCTGCGCTAGCGTGCCCTGG No data
1019344722_1019344731 1 Left 1019344722 7:523629-523651 CCCTCCTGCCCACCTGCCCAGGA No data
Right 1019344731 7:523653-523675 AAGCTGCGCTAGCGTGCCCTGGG No data
1019344722_1019344732 16 Left 1019344722 7:523629-523651 CCCTCCTGCCCACCTGCCCAGGA No data
Right 1019344732 7:523668-523690 GCCCTGGGCAAGCGCCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019344722 Original CRISPR TCCTGGGCAGGTGGGCAGGA GGG (reversed) Intergenic