ID: 1019346276

View in Genome Browser
Species Human (GRCh38)
Location 7:532264-532286
Sequence GACACAGGAGTTCCCCCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019346276_1019346282 1 Left 1019346276 7:532264-532286 CCAGGCGGGGGAACTCCTGTGTC No data
Right 1019346282 7:532288-532310 TTGCTGAAGTTCTGCGTTGGGGG No data
1019346276_1019346280 -1 Left 1019346276 7:532264-532286 CCAGGCGGGGGAACTCCTGTGTC No data
Right 1019346280 7:532286-532308 CCTTGCTGAAGTTCTGCGTTGGG No data
1019346276_1019346283 5 Left 1019346276 7:532264-532286 CCAGGCGGGGGAACTCCTGTGTC No data
Right 1019346283 7:532292-532314 TGAAGTTCTGCGTTGGGGGCTGG No data
1019346276_1019346281 0 Left 1019346276 7:532264-532286 CCAGGCGGGGGAACTCCTGTGTC No data
Right 1019346281 7:532287-532309 CTTGCTGAAGTTCTGCGTTGGGG No data
1019346276_1019346278 -2 Left 1019346276 7:532264-532286 CCAGGCGGGGGAACTCCTGTGTC No data
Right 1019346278 7:532285-532307 TCCTTGCTGAAGTTCTGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019346276 Original CRISPR GACACAGGAGTTCCCCCGCC TGG (reversed) Intergenic
No off target data available for this crispr