ID: 1019348764

View in Genome Browser
Species Human (GRCh38)
Location 7:543370-543392
Sequence GGGTGACTCACTTTGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019348764_1019348772 8 Left 1019348764 7:543370-543392 CCTGGCCTCAAAGTGAGTCACCC No data
Right 1019348772 7:543401-543423 TGATTCAGCCACCCTGAGCCAGG No data
1019348764_1019348774 10 Left 1019348764 7:543370-543392 CCTGGCCTCAAAGTGAGTCACCC No data
Right 1019348774 7:543403-543425 ATTCAGCCACCCTGAGCCAGGGG No data
1019348764_1019348777 18 Left 1019348764 7:543370-543392 CCTGGCCTCAAAGTGAGTCACCC No data
Right 1019348777 7:543411-543433 ACCCTGAGCCAGGGGAGGTGAGG No data
1019348764_1019348781 23 Left 1019348764 7:543370-543392 CCTGGCCTCAAAGTGAGTCACCC No data
Right 1019348781 7:543416-543438 GAGCCAGGGGAGGTGAGGCCGGG No data
1019348764_1019348775 13 Left 1019348764 7:543370-543392 CCTGGCCTCAAAGTGAGTCACCC No data
Right 1019348775 7:543406-543428 CAGCCACCCTGAGCCAGGGGAGG No data
1019348764_1019348773 9 Left 1019348764 7:543370-543392 CCTGGCCTCAAAGTGAGTCACCC No data
Right 1019348773 7:543402-543424 GATTCAGCCACCCTGAGCCAGGG No data
1019348764_1019348780 22 Left 1019348764 7:543370-543392 CCTGGCCTCAAAGTGAGTCACCC No data
Right 1019348780 7:543415-543437 TGAGCCAGGGGAGGTGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019348764 Original CRISPR GGGTGACTCACTTTGAGGCC AGG (reversed) Intergenic
No off target data available for this crispr