ID: 1019348960

View in Genome Browser
Species Human (GRCh38)
Location 7:544269-544291
Sequence CAGCGTGCAGAGGTTGGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019348960_1019348966 11 Left 1019348960 7:544269-544291 CCTAGGCCAACCTCTGCACGCTG No data
Right 1019348966 7:544303-544325 TCCTCATCTGTTCCTTGCACGGG No data
1019348960_1019348965 10 Left 1019348960 7:544269-544291 CCTAGGCCAACCTCTGCACGCTG No data
Right 1019348965 7:544302-544324 TTCCTCATCTGTTCCTTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019348960 Original CRISPR CAGCGTGCAGAGGTTGGCCT AGG (reversed) Intergenic
No off target data available for this crispr