ID: 1019348966

View in Genome Browser
Species Human (GRCh38)
Location 7:544303-544325
Sequence TCCTCATCTGTTCCTTGCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019348962_1019348966 5 Left 1019348962 7:544275-544297 CCAACCTCTGCACGCTGGAACCT No data
Right 1019348966 7:544303-544325 TCCTCATCTGTTCCTTGCACGGG No data
1019348959_1019348966 12 Left 1019348959 7:544268-544290 CCCTAGGCCAACCTCTGCACGCT No data
Right 1019348966 7:544303-544325 TCCTCATCTGTTCCTTGCACGGG No data
1019348958_1019348966 24 Left 1019348958 7:544256-544278 CCTTCTGGGTGGCCCTAGGCCAA No data
Right 1019348966 7:544303-544325 TCCTCATCTGTTCCTTGCACGGG No data
1019348960_1019348966 11 Left 1019348960 7:544269-544291 CCTAGGCCAACCTCTGCACGCTG No data
Right 1019348966 7:544303-544325 TCCTCATCTGTTCCTTGCACGGG No data
1019348956_1019348966 28 Left 1019348956 7:544252-544274 CCTGCCTTCTGGGTGGCCCTAGG No data
Right 1019348966 7:544303-544325 TCCTCATCTGTTCCTTGCACGGG No data
1019348963_1019348966 1 Left 1019348963 7:544279-544301 CCTCTGCACGCTGGAACCTCTGT No data
Right 1019348966 7:544303-544325 TCCTCATCTGTTCCTTGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019348966 Original CRISPR TCCTCATCTGTTCCTTGCAC GGG Intergenic
No off target data available for this crispr