ID: 1019350618

View in Genome Browser
Species Human (GRCh38)
Location 7:552373-552395
Sequence CTCTGGAGAAGGACCCGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 3, 2: 7, 3: 16, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019350618_1019350631 25 Left 1019350618 7:552373-552395 CCCGCCCGGGTCCTTCTCCAGAG 0: 1
1: 3
2: 7
3: 16
4: 186
Right 1019350631 7:552421-552443 CAAACCCCCACCTCCCACCCAGG 0: 9
1: 7
2: 3
3: 89
4: 733

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019350618 Original CRISPR CTCTGGAGAAGGACCCGGGC GGG (reversed) Intronic
900537821 1:3187483-3187505 CTCTGGAGAAGTCCCCAGCCAGG + Intronic
900604023 1:3515920-3515942 CCCTGGAGGAGGACGCAGGCTGG + Intronic
902583616 1:17424838-17424860 ATCTGGAAGAGGACACGGGCAGG + Intronic
902604988 1:17564178-17564200 CCCTGGAGATGCACCCAGGCAGG - Intronic
902652975 1:17848700-17848722 CTCTGGAGAAGGAAGCAGGGGGG - Intergenic
902774976 1:18668895-18668917 CCCTGGAGCAGGACCCTGGCTGG + Intronic
902805248 1:18857294-18857316 CCCTGGAGAAGGACCTGGGGAGG - Intronic
903015011 1:20355920-20355942 CTCTGGGGAGGAACCCAGGCAGG + Intergenic
904035703 1:27557379-27557401 CTCTGGGGAAGGAGGTGGGCGGG - Intronic
905947567 1:41916866-41916888 CCCAGGAGAAGGACCCCTGCAGG - Intronic
906802188 1:48748117-48748139 CTGTCGAGAAGTACCTGGGCAGG + Intronic
912747730 1:112259380-112259402 CTCTCCAGAAGGAGCCAGGCTGG - Intergenic
913046205 1:115075392-115075414 CTGTGGGTAAGGACCCGGCCAGG + Intronic
913565664 1:120069819-120069841 CGCTGGAGAAGGATGCGGACGGG - Intergenic
913632465 1:120723735-120723757 CGCTGGAGAAGGATGCGGACGGG + Intergenic
914286260 1:146229193-146229215 CGCTGGAGAAGGATGCGGACGGG - Intergenic
914547288 1:148679935-148679957 CGCTGGAGAAGGATGCGGACGGG - Intergenic
914801252 1:150964239-150964261 CTCTTCAGAAGAATCCGGGCTGG + Exonic
914994991 1:152535615-152535637 GTCTGGGGCAGGACCCAGGCAGG + Intronic
915146717 1:153799946-153799968 ATCTGGAGAGGGTCCAGGGCAGG + Intergenic
919977685 1:202623398-202623420 CTCTGGAGAAGGAGGTGGGAAGG - Intronic
920032412 1:203045360-203045382 CCCTGGAGGAGGATACGGGCCGG + Intronic
920758920 1:208762818-208762840 GTCTGGAGAAGGTCCAGGGAAGG + Intergenic
920920467 1:210293569-210293591 CTCAGGAGCAGGACCCAGGAGGG - Intergenic
921169099 1:212530038-212530060 CTCTCGAGAAGCACCGTGGCAGG + Intergenic
923144407 1:231187806-231187828 TTCTGGAGAGAGACCCAGGCAGG + Intronic
924459039 1:244241903-244241925 TACTGGAGAATGACTCGGGCAGG + Intergenic
1073098939 10:100997183-100997205 CGCTGGAGCAGGAGCGGGGCCGG + Intronic
1073705235 10:105975773-105975795 CTCTGGGGGAGGAGCAGGGCAGG - Intergenic
1074538581 10:114346218-114346240 TTCTGGAGAAGGGGCCTGGCTGG - Intronic
1074950512 10:118329743-118329765 CTATGTAGAAGGAACTGGGCTGG - Intronic
1076298002 10:129402600-129402622 CTTTGGAGAAGGGTTCGGGCGGG + Intergenic
1076601472 10:131659381-131659403 GTCTGGAGAAGGGGCCAGGCTGG + Intergenic
1079064299 11:17276447-17276469 CTGTGGAGCAGGACTCGGGCGGG - Intronic
1080317914 11:30970866-30970888 CACTGGATAAGGAGCTGGGCTGG - Intronic
1080580718 11:33641248-33641270 CTCTGGGGAAGGTCCCGGATTGG + Intronic
1081860839 11:46332727-46332749 GCCTGGACTAGGACCCGGGCGGG + Intergenic
1083619311 11:64041084-64041106 CTCTGGAGAGTGACGCGGGCAGG - Intronic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1084119310 11:67059730-67059752 CTGTGGAGAAGGCCCTGGTCGGG - Intronic
1084317430 11:68353709-68353731 CTCTGAGGAAGGACCCTGGTGGG - Intronic
1084665481 11:70573998-70574020 GTTTGGAGAAGGACCCGGGCTGG - Intronic
1085353480 11:75815546-75815568 CACTCGGGAGGGACCCGGGCAGG + Intronic
1088509544 11:110560573-110560595 TTCAGGAGAACTACCCGGGCAGG + Intergenic
1089142048 11:116293222-116293244 CTTTGGAGAAGGTCGGGGGCTGG - Intergenic
1089849241 11:121482190-121482212 ATCTGGAGAAGGAGCAGAGCAGG + Intronic
1090620385 11:128555397-128555419 TTCTGGGGAAAGACCTGGGCAGG - Intronic
1091261105 11:134234936-134234958 CCCTGGTGAAGGACCTGGCCCGG + Exonic
1091263723 11:134253933-134253955 GGCCGGAGGAGGACCCGGGCAGG - Intronic
1095883837 12:47167851-47167873 CTCTCGAGCAGTACCTGGGCAGG + Intronic
1096135746 12:49198964-49198986 CTTTGGAGAAGGAAGGGGGCAGG - Intronic
1096630666 12:52924983-52925005 CTGTGGAAAAGGAACAGGGCTGG + Intronic
1096650288 12:53059119-53059141 CTCTGGAGAGGGTGCCGGGGGGG - Exonic
1096754749 12:53789847-53789869 CTCTGGAGAAGGAAGGGGGAGGG + Intergenic
1097088645 12:56488080-56488102 CTCTGCAGAAGGCCCTGAGCCGG - Exonic
1101967861 12:109293240-109293262 GTCTGGAAAAGGACCAGGGTTGG + Intronic
1102588455 12:113939911-113939933 ATCTGGAGAAGGACCAGTGAGGG - Intronic
1102616838 12:114162120-114162142 CTCTTGAGATGGAGACGGGCAGG - Intergenic
1103207800 12:119143899-119143921 CTCTGGAGAAGGCCCAGGGCAGG + Intronic
1103722117 12:122980698-122980720 CTCTCGAGAAGGCGCGGGGCGGG + Exonic
1103902581 12:124311123-124311145 CTCTGGAGGAGAACCTGGGTAGG + Intronic
1108589167 13:51896876-51896898 CACTGGGGTAGGACCCAGGCAGG + Intergenic
1109489526 13:63077631-63077653 CTCTGAAAAAGGACCCTGGAAGG - Intergenic
1110630131 13:77697955-77697977 CTCTGGAGCGGGCTCCGGGCCGG + Intronic
1113680835 13:112243757-112243779 CTGTGGAGAAGGAGCAGGGCAGG + Intergenic
1114263652 14:21058102-21058124 CACTGGAGAAGGGCTCGTGCAGG - Exonic
1116713032 14:48393579-48393601 CCCTGGAGAAGGAGCCTGCCAGG - Intergenic
1117078006 14:52123079-52123101 TTGTGGAGAAGGACCTGAGCGGG - Intergenic
1119747224 14:77052952-77052974 AACTGGAGAAGAACCCGGGCAGG + Intergenic
1121678974 14:95776989-95777011 CTCTGGGGAAAGGCCCGGCCTGG - Intergenic
1122126083 14:99579490-99579512 CTGGGCAGAAGGACCAGGGCTGG - Intronic
1122899909 14:104778146-104778168 CTCTGGAGAGGCACACGGGTGGG - Intronic
1122961672 14:105096688-105096710 CTTTGGAGAAGAGCCGGGGCTGG - Intergenic
1124381275 15:29168816-29168838 CTCTGGGCAAGGACCCAGGAGGG + Intronic
1124493333 15:30171762-30171784 CTCTGGAGAAGGAGGTGGGAAGG - Intergenic
1124750201 15:32366563-32366585 CTCTGGAGAAGGAGGTGGGAAGG + Intergenic
1124878496 15:33619560-33619582 CTCTGGAGAAGTTCTCGGGTAGG + Intronic
1126100353 15:45114948-45114970 TCCTGGAGAAGGACCCCAGCTGG + Intronic
1128629965 15:69254793-69254815 CTCTGAAGAAAGACCTGGCCTGG + Intronic
1129194011 15:73953561-73953583 CTCTGGAGCTGGACCAGGACGGG + Intergenic
1129273102 15:74429630-74429652 CACTGGAGAAGGGCCGTGGCAGG - Intronic
1130026611 15:80276259-80276281 CCCTTGAGAAGGACCCTGGCAGG + Intergenic
1130453454 15:84080287-84080309 CCCGGGAGAAGGAGCAGGGCTGG + Intergenic
1130894635 15:88160516-88160538 CTCTGGAAAAGGGGCAGGGCAGG - Intronic
1132473222 16:118712-118734 CTCTGGTGAAGGTACTGGGCAGG - Intronic
1133164596 16:3937680-3937702 CTCTGGAGATGGAGCTGGGGTGG + Intergenic
1139434009 16:66925862-66925884 CTCTGGAGAAGAATTCGGTCTGG + Intergenic
1142151390 16:88514117-88514139 CTCTGGAGAACGACCATCGCAGG + Intronic
1143013731 17:3880435-3880457 CTATGGAGAAGGATGCGGGGAGG + Intronic
1143141286 17:4743282-4743304 CTCTGGAGAAGGAGAAGGGGAGG - Exonic
1143277451 17:5722303-5722325 CTCAGGGGAAGGGCCCGGGTAGG - Intergenic
1146799655 17:35808593-35808615 CTCTGCAGCAGGAAACGGGCTGG - Intronic
1150777795 17:68095645-68095667 CCCTGGCGGAGGACACGGGCTGG + Intergenic
1151458698 17:74241983-74242005 CTCTGGAGAAGCAGGAGGGCAGG + Intronic
1152582375 17:81171950-81171972 CTCAGGAGAAGGGAACGGGCAGG - Intergenic
1152585817 17:81189029-81189051 CACTGGGGAAGGTCCCAGGCAGG - Intergenic
1153536745 18:6109946-6109968 CTCTGGATCTGGACCAGGGCAGG + Intronic
1154165108 18:12008901-12008923 CTCTGCAGCAGGCCCTGGGCTGG - Intronic
1157761077 18:50266232-50266254 CCCTCGAGAAGGCCCCGGGTGGG + Intronic
1160825879 19:1080425-1080447 CTCTGGTGAAGGGCCAGGGTGGG - Intronic
1161267097 19:3369479-3369501 CTCCCGAGAAGGATCCGGGTCGG - Intronic
1161310325 19:3590237-3590259 TTCTGGAGCAGGGCCGGGGCAGG - Exonic
1161610389 19:5238833-5238855 CTCGGCAGACGGACCCAGGCGGG - Intronic
1162049258 19:8022539-8022561 CTCTGGAAAACGTCCCGAGCTGG - Intronic
1162409881 19:10499343-10499365 GTCAGGAGAAGGACCAGGGATGG - Intronic
1162430909 19:10627852-10627874 CTCTGGAGTGGGAACAGGGCTGG + Intronic
1166783316 19:45353333-45353355 CCCTGGGGAAGGACCCAGGGAGG + Exonic
1166965303 19:46526281-46526303 GCATGGAGAAGGGCCCGGGCAGG + Intronic
925004258 2:428872-428894 GTCAGTGGAAGGACCCGGGCGGG - Intergenic
927690036 2:25201990-25202012 CACTGGAGAGGGACCAGGGCAGG - Intergenic
932497429 2:72153377-72153399 CTCTGGAGAAGGGTCTGGGCAGG - Intergenic
932499899 2:72174153-72174175 CTCTGGACAAGGCCTTGGGCCGG + Intergenic
932775781 2:74527550-74527572 ATCAGGAGAAGGACCAGGGGAGG + Exonic
932901874 2:75710696-75710718 CTCTGGAGGAGGCCGCGCGCAGG - Exonic
933794800 2:85911023-85911045 GTCTGGAGAGGGACGTGGGCAGG + Intergenic
934719598 2:96564424-96564446 CTCTGGAGATGGCCATGGGCTGG - Intergenic
934870320 2:97858854-97858876 CTCTGGACAAGGACTCAGCCCGG + Intronic
935233582 2:101119562-101119584 CTCTGGAGTGGGGCCCAGGCCGG - Intronic
937288801 2:120769461-120769483 CTCTGTAGAAGGACCCCTCCAGG + Intronic
937746759 2:125423364-125423386 CTGTGGAAGAGGACCCGAGCAGG - Intergenic
940343733 2:152607784-152607806 GTCTGGAGAAGGGCACTGGCAGG - Intronic
941444783 2:165587400-165587422 CTCTGGAGTAGTACCCAGCCAGG + Intronic
946180513 2:217946203-217946225 GTCTGGAGAAGGATCCAGGGAGG - Intronic
946309969 2:218877988-218878010 CTCTGGAGAAGGTCACAGGGAGG - Intergenic
946394562 2:219436612-219436634 GTCAGGAGAGGGAGCCGGGCTGG + Intronic
946409899 2:219510701-219510723 CTCGGGAGAAGGTGCTGGGCTGG + Intergenic
948166366 2:235865657-235865679 CTCTGGAGGAGGGGCAGGGCGGG + Intronic
948897828 2:240935398-240935420 CTCTGGAGCAGGAACGGGCCCGG + Intronic
1169715751 20:8615945-8615967 ATCTGGAGAAGGACCCTGTTGGG - Intronic
1170441015 20:16378804-16378826 CCCTGGAGAAGGACCAGGAGAGG - Exonic
1170554803 20:17506250-17506272 CTCTGGACAAGGGCCCAGGCTGG + Intronic
1174047653 20:47744852-47744874 ATCAGGAGAAGGACGCGGCCTGG - Intronic
1179880230 21:44290548-44290570 CCCTGCAGGAGCACCCGGGCTGG + Intronic
1180075479 21:45459477-45459499 CGCTGGAGATGGAGCCGGGCAGG - Intronic
1180244890 21:46540351-46540373 GCCTGGAGAAGCACCCGGCCTGG + Intronic
1183756320 22:39769570-39769592 CTCTGGAGAAAGCTCCGGGGTGG + Intronic
949899696 3:8800334-8800356 CTCTGGAGAAGGATGAGGGCTGG + Intronic
950028119 3:9834539-9834561 CTCTGGAGGAGGAACCGGGAGGG + Intronic
954912637 3:54122210-54122232 CTCTGGGGCTGGCCCCGGGCCGG - Intergenic
955625167 3:60910706-60910728 CGCTAGAGAAAGACCTGGGCCGG - Intronic
955683585 3:61527785-61527807 CTCAGGAAATGGACCCCGGCAGG + Intergenic
960084207 3:113573311-113573333 CTCAGGAGATGGCCCTGGGCTGG + Intronic
960992884 3:123323243-123323265 CTCTGGAGAAGGAGGCTGCCAGG - Intronic
961381103 3:126497091-126497113 CTGTGGAGGAGGAGGCGGGCAGG - Intronic
961815686 3:129548980-129549002 AACTGGAGAAGGACACGGGGTGG - Exonic
962676575 3:137762564-137762586 CTCTGGAGAAAGGCCAGAGCTGG + Intergenic
962748998 3:138419067-138419089 CTCTGAGGAAGGACCAGGCCTGG + Intergenic
963247314 3:143075071-143075093 CTCTGGAGGAAAACCGGGGCGGG + Intergenic
965446616 3:168781101-168781123 CTGTGGAAGGGGACCCGGGCGGG - Intergenic
966878283 3:184335930-184335952 CCCCGGAGAGGGAACCGGGCCGG - Intronic
967028740 3:185586477-185586499 CTCTTCAGGAGGGCCCGGGCAGG - Exonic
967977780 3:195045015-195045037 CTCTGGAGAAGGATCTGTCCAGG - Intergenic
968545362 4:1195201-1195223 CTCTGGAGATGGCCCGAGGCTGG + Intronic
968752026 4:2395187-2395209 CTCTGCAGAAGGAACCGAGATGG - Intronic
968811297 4:2800731-2800753 CTCTGAGGAAGGACCTGGCCTGG + Intronic
969483654 4:7459853-7459875 TTGGGGAGAAGTACCCGGGCAGG + Intronic
976398574 4:84583157-84583179 CTCCGGCGGAGGTCCCGGGCAGG - Exonic
981229929 4:142340707-142340729 CTAACGAGAAGGACCCTGGCTGG - Intronic
985064106 4:186104874-186104896 CTCGGCGGACGGACCCGGGCCGG + Intronic
985145296 4:186889610-186889632 CTCGGGAGAAGGGCGCTGGCTGG - Intergenic
985665997 5:1181768-1181790 CTCTGGAGGAGGATCAGGACAGG + Intergenic
986413144 5:7502041-7502063 CCCTGGAGAAGGAACTAGGCTGG + Intronic
987543967 5:19288577-19288599 GTGTGGAAAGGGACCCGGGCTGG - Intergenic
997830314 5:137144120-137144142 CTCTGGGGAAAGATCAGGGCTGG - Intronic
998167103 5:139850474-139850496 CTCAGGAGCAGGAACCTGGCAGG + Intronic
1003113604 6:3268580-3268602 CTCTGGAGAAGGCCCAAGACTGG - Intronic
1003366497 6:5479912-5479934 CTCAGGAGAAGGAGAAGGGCAGG + Intronic
1006316643 6:33295576-33295598 CACTGGAGAGGGACCTGGGGAGG - Exonic
1006472294 6:34235868-34235890 CGCCCGAGAAGGCCCCGGGCCGG + Intergenic
1008700937 6:54098505-54098527 CACTGGAAAAGAACCAGGGCAGG + Intronic
1012472729 6:99589465-99589487 AGCTGGAGGAGGACCGGGGCGGG + Intergenic
1018774402 6:166999605-166999627 CCCTGGCGAGGGACCGGGGCCGG + Intronic
1019350406 7:551698-551720 CTCTGGAGAAGGACCTGGGCAGG - Intronic
1019350465 7:551883-551905 CTCTGGAGAAGGACCTGGGCGGG - Intronic
1019350505 7:552006-552028 CTCTGGAGAAGGACCTGGGTGGG - Intronic
1019350523 7:552067-552089 CTCTGGAGAAGGACCTGGGTGGG - Intronic
1019350542 7:552128-552150 CTCTGGAGAAGGACCTGGGTGGG - Intronic
1019350561 7:552189-552211 CTCTGGAGAAGGACCTGGGCGGG - Intronic
1019350579 7:552250-552272 CTCTGGAGAAGGACCTGGGTGGG - Intronic
1019350618 7:552373-552395 CTCTGGAGAAGGACCCGGGCGGG - Intronic
1019350656 7:552496-552518 CTCTGGAGAAGGACCTGGGTGGG - Intronic
1021640211 7:22729144-22729166 CTGTGGAGAATGAGCTGGGCAGG - Intronic
1024237690 7:47410262-47410284 CTAAGGAGGAGGACCTGGGCTGG - Intronic
1024563842 7:50665686-50665708 TTCTGTAGAAGCACCTGGGCAGG + Intronic
1026933223 7:74236682-74236704 CCCTGGAGAAGGAGCTAGGCTGG + Intronic
1030116729 7:106067404-106067426 CTCTTGCAAAGGACCAGGGCTGG - Intergenic
1035104456 7:156430278-156430300 CTGGGGAGAGGGACCTGGGCTGG - Intergenic
1035459886 7:159032123-159032145 CTCCTGAGAAGGACCCAGCCAGG - Intronic
1036125273 8:6056613-6056635 CTCTGGAGGAGAAGCAGGGCAGG - Intergenic
1037873429 8:22521586-22521608 TTCTGTAGGAGGACCAGGGCTGG + Intronic
1037948490 8:23004092-23004114 CTCTGGAGAGGGGACAGGGCAGG + Intronic
1042801726 8:72725708-72725730 CTGGGCAGAAGGACCGGGGCTGG - Intronic
1045545131 8:103121901-103121923 CTCAGGAGAAAGATCTGGGCTGG + Intergenic
1048924664 8:139260838-139260860 CTCTGGAGGAGTAACTGGGCTGG - Intergenic
1049255426 8:141611223-141611245 CTCTGCAGAGGGTCCCGGGCTGG + Intergenic
1049340925 8:142112284-142112306 CTCTGGAGAAGGGCAGGGCCCGG + Intergenic
1050106358 9:2170346-2170368 CTAGGAAGAAGGAGCCGGGCGGG + Intronic
1056451546 9:86721749-86721771 CTCTGGAGAGGGTCCCTGGCTGG + Intergenic
1057152757 9:92809103-92809125 CTTTGGAGGAGGAGCGGGGCGGG + Intergenic
1057772970 9:97983862-97983884 CTCAGGGGAAAGACCCCGGCGGG - Intronic
1057914224 9:99043307-99043329 CTGTGGAGATGGACCAGGGCTGG + Intronic
1059884619 9:118731973-118731995 CACTGGACAAGGACCTGGTCAGG - Intergenic
1060301321 9:122376089-122376111 CTCTGGAGCAGCCCCCGTGCTGG - Intronic
1061962023 9:133993161-133993183 CTCGGGAGAGGGCACCGGGCTGG + Intergenic
1062596751 9:137302975-137302997 CTCGGGAGGAAGCCCCGGGCCGG + Intergenic
1062677268 9:137754150-137754172 CTCTGGAGAACCAAACGGGCAGG - Exonic
1185553470 X:1002249-1002271 CCCTGGAGAAGGAGAGGGGCAGG + Intergenic
1190596802 X:52059937-52059959 GTCTGCAGAAGGCCCCAGGCCGG + Intergenic
1190612022 X:52194136-52194158 GTCTGCAGAAGGCCCCAGGCCGG - Intergenic
1190862431 X:54357668-54357690 ATCTGGTGAGGGTCCCGGGCCGG - Exonic
1192928271 X:75778910-75778932 CCCTGGCGAAGGACCCAGCCTGG - Intergenic
1196175969 X:112639297-112639319 CTCTGGCAAAGGAGCCTGGCAGG - Intronic
1198301014 X:135334288-135334310 CTCTGGAGCAGGCCCAGGGAAGG - Intronic