ID: 1019352693

View in Genome Browser
Species Human (GRCh38)
Location 7:562365-562387
Sequence CTGTGGAGCTGGAGGCGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019352693_1019352703 10 Left 1019352693 7:562365-562387 CCCTGTCGCCTCCAGCTCCACAG 0: 1
1: 0
2: 4
3: 20
4: 252
Right 1019352703 7:562398-562420 ACTCCTCGTCTGCCCCCATTAGG 0: 1
1: 0
2: 0
3: 5
4: 71
1019352693_1019352709 26 Left 1019352693 7:562365-562387 CCCTGTCGCCTCCAGCTCCACAG 0: 1
1: 0
2: 4
3: 20
4: 252
Right 1019352709 7:562414-562436 CATTAGGCATCTCTGTCCACAGG 0: 1
1: 0
2: 0
3: 4
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019352693 Original CRISPR CTGTGGAGCTGGAGGCGACA GGG (reversed) Intronic
900560731 1:3304814-3304836 CTGAGGAGGAGGAGGCCACAGGG - Intronic
900948248 1:5843366-5843388 CTATGGAGCAGGAGGGGTCAGGG + Intergenic
902368229 1:15990810-15990832 CTGTGGGGCCGGAGGAGCCAGGG + Intergenic
902818976 1:18932074-18932096 CTCTGGAGCTGGACGGAACAAGG + Intronic
903072064 1:20731557-20731579 CTGGGGTGGTGGAGGCGGCATGG + Intronic
903383946 1:22914805-22914827 GTGTGGAGGGGGAGGCGCCAAGG + Intronic
903542957 1:24107181-24107203 CCGTGGAGCTGGAGGAGCGAGGG - Exonic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904424836 1:30416555-30416577 ATGGGGAGCAGGAGGGGACAGGG + Intergenic
905004317 1:34697947-34697969 CTGAGGCCCTGGAGGGGACATGG + Intergenic
905954030 1:41977279-41977301 TTGTGGAGTTGGAGGAGCCATGG - Intronic
911009356 1:93262837-93262859 CTGTGGAGGTGGAGCCCTCATGG - Intronic
911073436 1:93850270-93850292 CTGTGGGGCTGGACCCTACAAGG - Intergenic
914263934 1:146021674-146021696 CTGGGGACCTGGGGGAGACACGG - Exonic
915980339 1:160416232-160416254 CTGAGGGGCTGGAGGCTCCACGG + Intronic
917790599 1:178496508-178496530 CTGTGGACCAGGGGGCGGCAAGG - Intergenic
919352070 1:196470454-196470476 CTGTGTAGCTGAAGGTGAAATGG + Intronic
919522069 1:198600861-198600883 ATGTGGAGTTGGAGCCCACATGG - Intergenic
920212663 1:204339540-204339562 TTGGGGAGCTGGAGGCTACTGGG - Intronic
920521825 1:206633563-206633585 CTTGGGAGCTGGAGGGGACAGGG + Intergenic
922440808 1:225653496-225653518 CTGGGGAGCGGGAGGCGACGGGG - Intergenic
922790054 1:228306357-228306379 CTGTGGGGCTGCAGGGGGCAGGG - Exonic
923205839 1:231758136-231758158 CTGTGGAGCTGGTCACCACACGG - Intronic
923511253 1:234655733-234655755 CTGTGGAGCTGGAGGCCTTGGGG - Intergenic
924490767 1:244535525-244535547 CTGTGGTGGTGGTGGCCACAGGG - Intronic
1063576518 10:7266526-7266548 GTGGGGAGCTGGAGGGGGCACGG + Intronic
1064137537 10:12763940-12763962 CTGTGGGGGTGGGGGCCACAGGG - Intronic
1064353414 10:14597563-14597585 CTGAGGAGCAGGTGGGGACAAGG + Intronic
1067693348 10:48518596-48518618 GTGGGGAGCTGGAGACCACATGG + Intronic
1072816615 10:98515906-98515928 CAGTGGAGCTGGTGGGGAGAGGG - Intronic
1074120063 10:110487505-110487527 CTCTGCAGCTGAAGGAGACAGGG - Intergenic
1076293767 10:129368012-129368034 CTGTGCAGCTGGAGGCAAGTGGG - Intergenic
1076715860 10:132363388-132363410 CAGAGGAGGTGGAGGCGACTAGG - Intronic
1077054005 11:581377-581399 CTGTGGCGGTGGATGTGACACGG + Intronic
1077150936 11:1072910-1072932 CTGTGGTGGTGGAGGCGATGGGG - Intergenic
1077216532 11:1397483-1397505 CTGGGAAGCTGGAGGCGTCCAGG - Intronic
1077487780 11:2846946-2846968 CTGAGAAGGTGGAGGCCACATGG + Intronic
1078412824 11:11141695-11141717 CTGTGGAGCAGGAGGCAATAAGG - Intergenic
1081525986 11:43928147-43928169 ATGTTGAGCTGGAGGGGAGACGG + Intronic
1081699671 11:45145352-45145374 ATGTGGAGCTGGAGGCGGTGGGG - Intronic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1084480040 11:69414864-69414886 CTGTGGAGCTGTTGGGGAGAAGG + Intergenic
1085385956 11:76158529-76158551 GTGTTGAGCAGGAGGAGACAGGG - Intergenic
1085660886 11:78365623-78365645 CTGTGGAGCTGGGTGGGACCAGG + Intronic
1088009865 11:104986697-104986719 CTGTGGTGCTGGTGGCCACAGGG + Intergenic
1091194580 11:133720126-133720148 CTGTGGAGCGGGAGGGTACTGGG + Intergenic
1091205531 11:133818404-133818426 GAGTGCAGCGGGAGGCGACATGG + Intergenic
1091903404 12:4163981-4164003 CTGTGGAGCTGAAGGAGACAAGG + Intergenic
1093991161 12:25591384-25591406 CTGTGGTGGTGGTGGCCACAGGG + Intronic
1096758138 12:53817112-53817134 CTGAGGAGCTGGGGGCAACATGG - Intergenic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1097322863 12:58245528-58245550 CTGGGCAGGTGGAGCCGACATGG - Intergenic
1099016022 12:77345249-77345271 CTCTGGATGTGGAGGCCACATGG + Intergenic
1099218272 12:79879947-79879969 ATGTGGAGCTTGAGGAGGCAAGG - Intronic
1099394580 12:82121627-82121649 TTGTGGAGCAGGAGTGGACAGGG - Intergenic
1102462228 12:113107008-113107030 CTGAGGAGCTGGAGGGGGAAAGG + Intronic
1103578866 12:121899509-121899531 ATGTGGAGCTAGAGGTGAGAAGG - Intronic
1104053296 12:125210631-125210653 CAGGGGAGGTGGAGGGGACAGGG + Intronic
1104606253 12:130191216-130191238 CTGTGGAGCACTAGGAGACAGGG - Intergenic
1104666462 12:130650538-130650560 ATGTGCTGCTGGAGGGGACACGG - Intronic
1105715330 13:23057103-23057125 CTCTGGAGTTGGAGGCAGCAGGG - Intergenic
1105984981 13:25556910-25556932 CTGTGAAAATGCAGGCGACATGG + Intronic
1108255906 13:48611129-48611151 CTGTGGAGTTGGTGGCCACAAGG - Intergenic
1108543497 13:51467117-51467139 CTCTGGAGCAGGAGAGGACAGGG + Intergenic
1110730921 13:78877442-78877464 CTGTGGAGCTGGTGGGGGCCGGG - Intergenic
1113866755 13:113531493-113531515 GTGTGGACCTGCAGGTGACACGG + Intronic
1113866778 13:113531660-113531682 GTGTGGACCTGCAGGTGACACGG + Intronic
1116471582 14:45291810-45291832 CTGGGGTGCTGGAGGGGAAATGG + Intergenic
1118158649 14:63266893-63266915 CTGTGGAGCTGGATCAGAAAAGG - Intronic
1121253302 14:92514706-92514728 AGGTGGGGCTGGGGGCGACAAGG - Intronic
1121341506 14:93107832-93107854 CTGGGGAGATGCAGGCCACAAGG + Intronic
1122148185 14:99706569-99706591 CTGTGGAGAGGGAGGGCACATGG + Intronic
1122695743 14:103551229-103551251 CTGTGGGGGTGGAGGCGGCCTGG + Intergenic
1124813553 15:32965968-32965990 CTGTGGTGCTGGGGGAGACGGGG + Intronic
1125610036 15:40963712-40963734 ATGTGGGGCTGGAAGCCACATGG + Intergenic
1126567213 15:50113035-50113057 CTGGGCAGCTGGAGGAGAGAAGG - Intronic
1128087823 15:64897917-64897939 CTGTGGAGCTGGAGCCAACAGGG - Intronic
1128566073 15:68700986-68701008 CTGAGGAGCTGGGGGCGGGATGG + Intronic
1128901004 15:71422954-71422976 CTGTGGAGGTGGTGGCCACGGGG - Intronic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1131258473 15:90876411-90876433 GGGTGGAGCAGGAGGCGAGAGGG - Intronic
1132386385 15:101403646-101403668 CTGAGAAGCTGGGGGTGACAGGG - Intronic
1132550637 16:552597-552619 CCGAGGGGCTGGAGGCTACAAGG - Exonic
1132670078 16:1098931-1098953 CTGTGGGGCTGGAGCAGACACGG + Intergenic
1132689339 16:1175505-1175527 CTTAGGAGCTGGAGGCTACAGGG - Intronic
1133769210 16:8858119-8858141 ATGTGAGGCTGGGGGCGACACGG - Intronic
1135167840 16:20156381-20156403 CTGTGAAGCTGGATGGGACCAGG + Intergenic
1135901645 16:26465176-26465198 CAGTGGAGGTGGAGGTGGCAGGG - Intergenic
1138228611 16:55322038-55322060 CTGGGAAGCCGGAGGAGACATGG + Intergenic
1138419496 16:56890078-56890100 CTGTAGAGCTGGAGGAGTCCTGG + Intronic
1141227317 16:82130181-82130203 CTGTGGTGGCGGAGGCCACAGGG - Intergenic
1141579655 16:84988559-84988581 CTGGAGAGCTGGAGGCGGCCAGG - Intronic
1141768546 16:86074711-86074733 CTGGGGTGCTGGAGGTGACTGGG + Intergenic
1141984288 16:87570145-87570167 CTGGGGGGCGGGAGGGGACAAGG + Intergenic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1143539468 17:7560641-7560663 CGGTGGAGCTGGAGAAGGCAGGG + Intronic
1143594690 17:7907270-7907292 CTGTGGAGCGGGAGGGGAGGGGG + Intronic
1144455001 17:15411695-15411717 CTTTGGAGCAGGAGGAGAGAAGG + Intergenic
1145269621 17:21397791-21397813 CAGGGGAGCTGGAGGCCGCAGGG - Intronic
1148053837 17:44781921-44781943 CTGGGGTGCTGGAGGCGGGAAGG + Intergenic
1148846756 17:50534182-50534204 CTCTGGAGTTTGAGGGGACAAGG - Intronic
1149035810 17:52133244-52133266 CTGGGGCGCTGGAGGCTCCAAGG - Intronic
1151199565 17:72457802-72457824 CTCAGGAGCTGGAGCAGACATGG - Intergenic
1151305378 17:73259778-73259800 CTGGGGGGCTGGAGGGGACCAGG - Intronic
1152016728 17:77755900-77755922 CTGTGGCTCTGGTGGGGACAGGG - Intergenic
1152253943 17:79226565-79226587 CTGTGGAGCAGGAGGAGCCTGGG + Intronic
1152407600 17:80106548-80106570 CTGTGCAGATGCAGGGGACAGGG + Intergenic
1153230821 18:2933856-2933878 CTGTGGAGCTGCAGGGGATGTGG + Intronic
1157217806 18:45800191-45800213 CTGTGGAGGTGGAGCCAAGATGG - Intergenic
1157408090 18:47440644-47440666 CTGTGGAGTTTGAGGGGTCAAGG + Intergenic
1157476858 18:48029231-48029253 CTGGTGGGCTGGAGCCGACAGGG + Exonic
1157594481 18:48855858-48855880 GTTTTGAGCTGGAGGTGACATGG + Intronic
1160588667 18:79927559-79927581 CTGTGCAGCAGGCGGCAACAGGG + Intronic
1160735567 19:660877-660899 CTTTGGAGCAGGACGCAACAAGG - Intronic
1160753250 19:745196-745218 CTGGGGAACTGGAGGTTACAGGG - Intronic
1160854232 19:1208990-1209012 CTCTGGAGCTGGAGCAGTCAGGG + Intronic
1163013683 19:14440917-14440939 CTGTGGTGGTGGGGGTGACAAGG + Intronic
1163222880 19:15934589-15934611 CTGTGTAACTGGAGGCCACTTGG - Exonic
1163639138 19:18451584-18451606 CTGGGGGGCTGGAGGCAGCAGGG + Exonic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165245545 19:34496560-34496582 CTGAGCAGCTGGAGGAGTCAGGG + Intronic
1165316641 19:35060217-35060239 CTGGGGAGCTTGAGGGGACGTGG - Intronic
1165335751 19:35168559-35168581 CTGAGGGGCTGGAGGAGGCAAGG + Intronic
1166620168 19:44290379-44290401 CTGTGGAGCTGGTGTCCTCAGGG - Intronic
1166774221 19:45302746-45302768 CTGTAGAAGTGAAGGCGACAAGG - Exonic
1167318488 19:48780672-48780694 CTGTAGGGCTGGACGCTACAAGG - Intergenic
925087203 2:1117518-1117540 CTGGGGAGCTGGAGCCCTCACGG + Intronic
926073800 2:9923899-9923921 CTCTGCAGCTGGAGGAGGCAGGG - Intronic
927542735 2:23927194-23927216 CGGGGCAGCTGGAGGCGGCAGGG - Intergenic
927552759 2:24013350-24013372 CTGTGGCGCTGGAGGCTATCTGG - Exonic
928077535 2:28278831-28278853 CTGGGGAGGTGCAGGTGACAAGG + Intronic
928493112 2:31803963-31803985 CCGTGGAGCAGGGGGCGCCATGG - Intergenic
932593628 2:73081192-73081214 GAGTGGGGCTGGAGGCGGCAGGG - Intronic
934526954 2:95057911-95057933 CTGGGGCGCTGGAGCAGACACGG + Intergenic
935165802 2:100567686-100567708 CTGAGGAGCTGGAGGCGCTGGGG + Intronic
935331759 2:101982490-101982512 CTGTGCAGCTGGAGGACACCAGG + Intergenic
936388085 2:112048175-112048197 CTTGGGAGGTGGAGGGGACAGGG + Intergenic
936797485 2:116224538-116224560 ATGTGGAGCCTGAGGCCACAAGG - Intergenic
938598205 2:132811154-132811176 CTGTTCTGGTGGAGGCGACAGGG + Intronic
939590265 2:144055720-144055742 CTCTGGAACTCGAGGGGACAGGG - Intronic
946179191 2:217939819-217939841 CTGTGGAGCTGGAGCCCATGTGG - Intronic
946821421 2:223633824-223633846 ATGTGGAGCTGGAGGCCATCTGG - Intergenic
946913548 2:224490603-224490625 CTGTGGGGCTGGACCCTACAGGG + Intronic
947532933 2:230924221-230924243 CTGTGGAGCTGCAGCAGACCTGG - Intronic
947639163 2:231696642-231696664 CTGTGGTGCGTGAGGGGACAGGG + Intergenic
948188535 2:236040874-236040896 CTGTGTAGCTGGAGACCACATGG + Intronic
948429398 2:237909535-237909557 CTGTGAAGCAGGAGGTCACAGGG + Intronic
948653905 2:239465099-239465121 CAGGGGAGCTGCAGGGGACACGG - Intergenic
1170600443 20:17837466-17837488 CTTCGGAGCTGGAGGGGTCACGG - Intergenic
1173183303 20:40820708-40820730 CTGTCGGGGTGGAGGGGACAGGG - Intergenic
1173851408 20:46220711-46220733 CTCAGGAGCTGGAAGTGACAGGG - Intronic
1174836092 20:53856362-53856384 CTGTGCAGCTGGAGGCTGCGAGG - Intergenic
1175200465 20:57273338-57273360 CTGGGGAGCTGGAGAGGGCATGG + Intergenic
1178885319 21:36480268-36480290 ATGTGGAGCTGGACGGGTCAAGG + Intronic
1179251197 21:39673253-39673275 ATCTGGAGTTGGAGGCGGCAGGG + Intergenic
1179714618 21:43280611-43280633 CAGTGGAGGTGGAGGGGACGGGG + Intergenic
1180225431 21:46389199-46389221 CTCCGGCGCTGGAGGAGACATGG + Exonic
1181174274 22:21027074-21027096 CTGTGCAGCTGGAGCCAAAAAGG + Exonic
1181569843 22:23762618-23762640 CTATGGACCTGGAAGCGACTAGG + Intergenic
1181781193 22:25194748-25194770 CTGTGGTGCTGGAGGAGACAAGG - Exonic
1183215347 22:36475931-36475953 TGGGGGAGCTGGAGGGGACAGGG - Intronic
1183363242 22:37393850-37393872 TAATGGAGCTGCAGGCGACACGG + Intronic
1183645577 22:39124222-39124244 CTGTGAAGCTGGAGGGGAGGGGG - Intronic
1183866408 22:40707751-40707773 CTGTGAGGCTGGAGGCTAGATGG + Intergenic
1184074047 22:42164891-42164913 CTGAGGAGCTGGAGGCAGCCAGG + Intronic
1184846263 22:47089622-47089644 GTGGGAAGCTGGAGGTGACAAGG + Intronic
1185311508 22:50158258-50158280 CTGTGGAGCTGCAGGAGCCAAGG - Intronic
950021558 3:9791486-9791508 CTGTGGAGCTGGAGAGGACAGGG + Exonic
950304580 3:11908132-11908154 GGGTGGAGCGGGAGGCCACAGGG - Intergenic
950864654 3:16179496-16179518 CTGAGGAGCTGGAAGCCACCAGG + Intronic
951217974 3:20041548-20041570 ATCTGCAGCTGGAGGTGACAGGG - Intronic
953391187 3:42534802-42534824 CTGTGGAACAGGAGCAGACAAGG + Intronic
954296454 3:49677022-49677044 CTGGTGAGCTGGAGGTGGCAGGG + Exonic
954899068 3:54003439-54003461 CTGTGGAGCAGCAGGGCACATGG + Intergenic
956231088 3:67017496-67017518 TTGTGTAGCTGGAGATGACAGGG + Intergenic
960134190 3:114089267-114089289 CTGTGGAGCTAGAGTCTACCTGG - Intergenic
960519487 3:118638588-118638610 CTGTGGAGCTGGAAGGGATGAGG + Intergenic
961627279 3:128272785-128272807 CCCTGGAGCTGGAAGGGACAAGG + Intronic
963828075 3:149977058-149977080 TTGTGGAGCAGGAGGGGAAAGGG + Intronic
964568811 3:158089991-158090013 CTTTGAAGCTGGAGGAGGCAGGG - Intergenic
967313315 3:188127127-188127149 AGGTGGGGCTGGAGGTGACAGGG - Intergenic
968949866 4:3684866-3684888 CTCTGGAGCTGGATTCTACAGGG - Intergenic
969310949 4:6353015-6353037 CCCCGGAGCTGGAGGAGACAAGG + Intronic
971264808 4:25088244-25088266 CTGGAGAGATGGAGGGGACAGGG - Intergenic
972311030 4:37882547-37882569 GTGTGGAGCTGCAGGCGAGTTGG + Intergenic
972931191 4:44072731-44072753 CTGTGGAGCTGGAGGGAGCCAGG - Intergenic
975369450 4:73568014-73568036 CTGTGGTGGTGGTGGCCACAGGG - Intergenic
979856426 4:125638921-125638943 CTGCTGAGCTGCAGGCAACAAGG + Intergenic
981358020 4:143814091-143814113 CTGTGGAACTGGAGTAAACATGG - Intergenic
981369265 4:143940202-143940224 CTGTGGAACTGGAGTAAACATGG - Intergenic
981379010 4:144050144-144050166 CTGTGGAACTGGAGTACACATGG - Intergenic
982979569 4:162115592-162115614 CTGTGAAGATGGAGGTTACAAGG - Intronic
983562842 4:169118173-169118195 ATGTGGAGCTGGAGGCAAGTAGG - Intronic
985744008 5:1636495-1636517 TTGCTGAGCTGGAGGGGACAGGG - Intergenic
986040372 5:3988380-3988402 CTGTGCAGCTTCAGGTGACAGGG - Intergenic
986353634 5:6903486-6903508 CTGTGGAGCAGATGGCAACAGGG + Intergenic
987823156 5:22991742-22991764 CTGTGGTGATGGTGGCTACAGGG + Intergenic
991237805 5:64419267-64419289 CTGTGGTGGTGGTGGCCACAGGG + Intergenic
997828650 5:137130082-137130104 CTGTGAAGCTAGAGGCAAGATGG + Intronic
998045834 5:138985902-138985924 CTGTGGAGCTGGAGATTGCAGGG - Intronic
999194916 5:149775236-149775258 CTGTGGATCTGGAGAGGGCAGGG + Intronic
1000159810 5:158586620-158586642 CTGTGGTGGTGGTGGCTACAGGG - Intergenic
1000233503 5:159336520-159336542 CTGTGGGGCTGCAGGGGTCATGG + Intergenic
1002057656 5:176607999-176608021 CTGAGGAGTTGGAGGCTACAGGG - Intronic
1002330422 5:178436903-178436925 CGGTGGAGCTGGGGTCGACCTGG + Intronic
1002632814 5:180591938-180591960 CTGGGGAGGTGGAGGCGCCAGGG + Intergenic
1003664761 6:8100793-8100815 CTCTGGGGCTGGTGGCGCCAGGG - Intronic
1003871207 6:10404607-10404629 CTGAGGAGCGAGAGGCGACCCGG + Exonic
1005375733 6:25180469-25180491 CTCTAGAGCTGGAGGTGAGAAGG - Intergenic
1005737203 6:28758996-28759018 CTTGGGAGCTGGAGGCTGCAGGG + Intergenic
1006671018 6:35729746-35729768 CTATGGGGCTGGAGGGGAAAGGG - Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007377678 6:41467777-41467799 CTAGGGAGGTGGAGGCGACAGGG + Intergenic
1007494686 6:42251766-42251788 TTGTGGAGATGGAGGAGACCTGG - Intronic
1009439544 6:63660935-63660957 CTGTGGAACTTGAGGAGACAGGG + Intronic
1010040621 6:71378663-71378685 CTGTGGAGATGGAGAAGTCATGG + Intergenic
1011802088 6:91028584-91028606 CTCTGGAGATAGAGACGACAAGG + Intergenic
1012718118 6:102702185-102702207 CTGTGGAGCTGGTGGGGGCCAGG - Intergenic
1012932300 6:105329900-105329922 GTGTGGAGATGGAGGGGAAATGG + Intronic
1013304889 6:108838682-108838704 CTGGGGAGGCGGAGGCGAGAGGG + Intergenic
1013601714 6:111711591-111711613 TGGTGGCGCTGGAGGCCACAGGG - Intronic
1015888599 6:137946296-137946318 CTGTGGAGCTTGAGGTGGAAGGG + Intergenic
1016154044 6:140781182-140781204 CTGTGGTGGTGGAGGCCACAAGG + Intergenic
1016457321 6:144244849-144244871 CTGTGGTGGTGGTGGCCACAGGG - Intergenic
1017993629 6:159511397-159511419 CTGGGGAGCTGGAGGTGTTACGG + Intergenic
1019352693 7:562365-562387 CTGTGGAGCTGGAGGCGACAGGG - Intronic
1022741080 7:33122493-33122515 CTGTGGTGGTGGTGGCCACAGGG - Intergenic
1023277714 7:38538431-38538453 GTGTGGAACTGGAGTGGACAAGG + Intronic
1025233987 7:57221262-57221284 TTGTGGAGCTGGTGGCCCCAGGG + Intergenic
1025261448 7:57421734-57421756 CTGGGGAGGTGGAGGTGAGAGGG + Intergenic
1025738774 7:64178929-64178951 CTGGGGAGGTGGAGGTGAGAGGG + Intronic
1026840408 7:73667706-73667728 CTGGGGTGCTGGAGGCGGCGCGG + Intergenic
1026910601 7:74089681-74089703 GTGTTGAGCTGGAGGGGACATGG + Intronic
1027122318 7:75530700-75530722 GCGTGGAGCTGGAGTAGACAGGG - Intergenic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1031761281 7:125716159-125716181 CTGTGCTGTTGGAGGGGACACGG - Intergenic
1032413979 7:131722165-131722187 CTCTGATGCTGGAGGGGACATGG + Intergenic
1032510130 7:132465819-132465841 CTGCAGAGCTGGAGGAGAGAGGG + Intronic
1034399095 7:150849610-150849632 CTGGGGAGCTGGAGGCCATCGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1037057315 8:14457995-14458017 CTGTGGAGCTGGTTCCTACAGGG + Intronic
1037272045 8:17141088-17141110 CTGTGGAGCTGGAGCAGAATGGG + Intergenic
1037358342 8:18046642-18046664 CTGGGGAGATGGGGCCGACAGGG - Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1038217803 8:25578609-25578631 CTTTGGAGCTCCAGGCTACAGGG - Intergenic
1038402200 8:27293173-27293195 GAGTGGAGTGGGAGGCGACAGGG - Intronic
1038693940 8:29788399-29788421 CTGTGGAGAAGGAGGCGCCTAGG - Intergenic
1040078020 8:43259932-43259954 CTGTGGATCTGCAGGATACATGG + Intergenic
1040392809 8:46964035-46964057 CTGGGGACCTGAAGGCCACAGGG + Intergenic
1040981790 8:53251813-53251835 CTGCGGGGCTGGAGGGGACGCGG - Intergenic
1041467620 8:58172815-58172837 CCGTGTAGCTGGAGGAGATATGG - Intronic
1047997548 8:130350946-130350968 GGGTGGAGCTGGAAGCAACAGGG + Intronic
1048098027 8:131315534-131315556 ATGTGTACCTGGAGGCCACAGGG - Intergenic
1049500271 8:142959472-142959494 GTGTGGAGGTGGAGGCGCGAGGG + Intergenic
1049640619 8:143713512-143713534 CTGTGACACTGGAGGGGACAGGG + Intronic
1049752015 8:144289409-144289431 GTGTGGTCCTGGAGGCCACATGG - Intronic
1050081552 9:1921185-1921207 CTGAGGAGTTGGAGGCTGCAGGG - Intergenic
1050210834 9:3254217-3254239 CTGTGGAGATGAAGGCTCCAGGG + Intronic
1053494916 9:38542918-38542940 CTGTGGGGCTGGAGGATCCAAGG - Exonic
1055520732 9:77078378-77078400 CTATGGAGCTTGAGGGGAAAGGG - Intergenic
1056299603 9:85227543-85227565 CCGTGGAGCTCCAGGCTACAGGG - Intergenic
1057407725 9:94788820-94788842 CTGTGGTGCTGGAGGAGAAATGG - Intronic
1059454290 9:114389930-114389952 ATGTGGGGCTGGGGGCTACAGGG - Intronic
1060520807 9:124292891-124292913 CTGTGGAGCTGGGAGTGACGGGG + Exonic
1060778307 9:126392855-126392877 CTGTGCAGCTGGAAGAGCCAGGG + Intronic
1062200545 9:135300570-135300592 ATGTGGAGGGGGAGGGGACAAGG + Intergenic
1062319626 9:135984385-135984407 CAGAGGGGCTGGAGGGGACAAGG + Intergenic
1062408734 9:136410676-136410698 CTGTGGTGCTGGCGGCGACGCGG + Exonic
1189698748 X:43694290-43694312 CTGTGGGTCCGGAGGCTACAGGG + Intronic
1191703796 X:64071242-64071264 CTGTGGTGGTGGTGGCAACAGGG + Intergenic
1194697140 X:97067039-97067061 GTGTGCAGCTGTAGGCAACATGG + Intronic
1197106751 X:122725890-122725912 CTGCTGTGCTGGAGGGGACAAGG - Intergenic
1198242103 X:134796884-134796906 ATGGGGAGCTGGAGCCGCCAAGG - Intronic
1202251527 Y:22878337-22878359 CTGTGTACATGGAGGCCACACGG - Intergenic
1202404515 Y:24512086-24512108 CTGTGTACATGGAGGCCACACGG - Intergenic
1202466264 Y:25157996-25158018 CTGTGTACATGGAGGCCACACGG + Intergenic