ID: 1019353876

View in Genome Browser
Species Human (GRCh38)
Location 7:568955-568977
Sequence CTCTGGGAGGGGAGGGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 777
Summary {0: 1, 1: 0, 2: 1, 3: 57, 4: 718}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019353867_1019353876 -4 Left 1019353867 7:568936-568958 CCGCGGGGGGTGGTTCGGTCTCT 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1019353876 7:568955-568977 CTCTGGGAGGGGAGGGTTGAGGG 0: 1
1: 0
2: 1
3: 57
4: 718
1019353866_1019353876 -3 Left 1019353866 7:568935-568957 CCCGCGGGGGGTGGTTCGGTCTC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1019353876 7:568955-568977 CTCTGGGAGGGGAGGGTTGAGGG 0: 1
1: 0
2: 1
3: 57
4: 718
1019353864_1019353876 3 Left 1019353864 7:568929-568951 CCGGGGCCCGCGGGGGGTGGTTC 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1019353876 7:568955-568977 CTCTGGGAGGGGAGGGTTGAGGG 0: 1
1: 0
2: 1
3: 57
4: 718

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019353876 Original CRISPR CTCTGGGAGGGGAGGGTTGA GGG Intronic
900324885 1:2103859-2103881 CAGTGGGAGGAGAGGGGTGAAGG + Intronic
900473371 1:2865113-2865135 CTCTGGCCTGGCAGGGTTGAGGG + Intergenic
900576224 1:3383796-3383818 GTCTGGGCGGGCAGGGGTGATGG - Intronic
900679708 1:3910080-3910102 GTCTGTGAGTGGAGTGTTGATGG + Intergenic
900732034 1:4268420-4268442 CCATGGGAGGCGAGGGTGGAAGG + Intergenic
901038467 1:6350140-6350162 CCCTGGCAGGGAAGGGCTGATGG + Intronic
901155263 1:7132556-7132578 CTCTGTGAGGCCAGGGTTGGTGG + Intronic
901642252 1:10698690-10698712 CCCTGGCAGGGGAGGGCTGAGGG + Intronic
901798619 1:11694351-11694373 CTCTGGCTGGGGAGGTTGGAGGG + Intronic
902243360 1:15103015-15103037 CTCTGGGAGGCCAGGGTGGGTGG + Intronic
902245778 1:15119609-15119631 CTCTGGGAGGCCAATGTTGAGGG - Intergenic
902310152 1:15575998-15576020 CTTTGGGAGGCCAGGGTGGATGG - Intronic
902571959 1:17352675-17352697 CCCTGGGAGGGGAGGACTGTGGG + Intronic
902833599 1:19033409-19033431 GGCTGGGTGGGGAGGGTGGACGG - Intergenic
902873331 1:19326927-19326949 GTCGGGGAGGGGAGGCTTGCTGG + Intronic
902931763 1:19736439-19736461 ACCTGGGAGTGGAGGGTGGATGG - Intronic
903204865 1:21773892-21773914 CTTTGGGAGGGCAAGGTGGAAGG + Intronic
904214407 1:28907911-28907933 CTTTGGGAGGCCAGGGTTGGAGG - Intronic
904354927 1:29932843-29932865 CTCTGGGAAGGGAGGCTTGGTGG - Intergenic
905175292 1:36131389-36131411 CTTTGGGAAGGGAAGGTAGAAGG + Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905791542 1:40792198-40792220 CCCTGGGAGGGGAGGGGGCAGGG + Intronic
905846337 1:41236285-41236307 CTTTGGGATGGGAGGGGTGCAGG + Intronic
905990159 1:42330392-42330414 CTTTGGGAGGCCAGGGTTGGCGG + Intronic
906033957 1:42739647-42739669 CTGTGGGAGGGGAGGGCTCTAGG - Intronic
906191793 1:43903655-43903677 CCCTGGGAGGAGAGGGAGGAGGG + Intronic
906567344 1:46810722-46810744 CCCTGGGAGGGCAGGGGAGAAGG - Intronic
906708479 1:47912071-47912093 CTCTTGGAGGAGGGGGCTGAGGG + Intronic
906882633 1:49608916-49608938 CTGTGGTGGGGGAGGGGTGATGG - Intronic
907048390 1:51313753-51313775 CTCTGGGAGGGCAAGGCTGGAGG + Intronic
907071786 1:51542130-51542152 CTTTGGGAGGCCAGGGTGGATGG - Intergenic
907213964 1:52846582-52846604 CTTTGGGAGGCCAGGGTGGATGG - Intronic
907331849 1:53676744-53676766 CTCTTGGAGGTCAGGGTGGAGGG - Intronic
907560478 1:55382906-55382928 GGCTGGGAGGGGAGGGCTGGGGG + Intergenic
908062449 1:60366764-60366786 TTCTGGGAGAGGAGGGAAGAGGG + Intergenic
908114321 1:60925941-60925963 TTCTGGCAGGGAAGGGTGGAGGG - Intronic
908151731 1:61309645-61309667 CTCTGGGAGGCCAGGGTGGGTGG + Intronic
908466943 1:64405553-64405575 ATGTGTGTGGGGAGGGTTGAAGG + Intergenic
908871524 1:68618552-68618574 CTCTGGAATGAGAGGGTAGAAGG - Intergenic
910233198 1:85007946-85007968 CTCTGTGAGGGCAGTGTGGAAGG - Intronic
912451456 1:109770104-109770126 CTGTGGGAGGGCAGGGGAGAAGG + Intronic
912907068 1:113718524-113718546 CTCTGTGAGGGTAGTGTGGAAGG - Intronic
912963670 1:114218211-114218233 GTCTCAGAGGGGAGGGATGAAGG - Intergenic
913307805 1:117450901-117450923 CTCTGCTAGGGGAGGGCCGAAGG + Intronic
913332515 1:117679181-117679203 CCATGAGAGGGGAGGGTTGGAGG - Intergenic
914266458 1:146042218-146042240 ATCTGGGAGGCGAAGGTTGTAGG - Intergenic
914440369 1:147700308-147700330 GTCAGGGAGGGGAGGGATGGAGG - Intergenic
914992493 1:152510977-152510999 TTCTGGAAGGGGAGGGTGGAAGG + Exonic
915109234 1:153552603-153552625 TTCTGGGAGGTGAGGCCTGAGGG + Intergenic
915244298 1:154545192-154545214 CTCTGGAAGGGGAGAGAAGAGGG + Intronic
915388700 1:155520617-155520639 CTCTGGGAGGCTAAGGTGGACGG + Intronic
915536691 1:156540676-156540698 CTCGGGGAGGGGAGGACTGGTGG + Intronic
916027117 1:160842600-160842622 CTCTGTGAGAGGATGGTTGAGGG - Intronic
916286802 1:163115137-163115159 CTGTTGGAGGGTGGGGTTGAGGG + Intronic
917457897 1:175201270-175201292 CTAAGGGAGGCAAGGGTTGAGGG - Intergenic
918938224 1:190952902-190952924 GTTTGAGAGTGGAGGGTTGAAGG + Intergenic
921233298 1:213096443-213096465 CTTTGGGAGGGCAGGGTGGGTGG + Intronic
921599177 1:217089126-217089148 CGCTGGGAGGGGAGGGGTTAGGG - Intronic
922349231 1:224722115-224722137 CTCTGGGAGGGTTGGGTGGGAGG + Intronic
922554323 1:226521320-226521342 TTCTGGGAGTGGGGGTTTGAGGG + Intergenic
923001684 1:230011504-230011526 CTCTGGGGGAGAAGGGTTTAAGG - Intergenic
923232396 1:231999497-231999519 CTCTGGGAGGGGAAGGGAGTTGG - Intronic
923532296 1:234821029-234821051 CCCTGGGAGGGGAGGATGGTGGG - Intergenic
923629397 1:235640004-235640026 CTGTGGGAGGGGAGCAGTGAGGG + Intronic
924043834 1:240008989-240009011 CCCTTGGAGGGCAGGGTGGAAGG + Intergenic
924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG + Intronic
1065068017 10:21992065-21992087 CTCTGGGAGGCCAAGGTTGGCGG + Intronic
1066506477 10:36049800-36049822 ATTTGGGTGGGGAGGGATGAAGG + Intergenic
1066527838 10:36300520-36300542 CTTTGGGAGGCAAGGGTGGAAGG - Intergenic
1066716293 10:38289834-38289856 GTGTGGGAGGGGAGGATGGAAGG - Intergenic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067226212 10:44377832-44377854 CCCTGGGAGGAGAGGGATGCAGG + Exonic
1067757756 10:49017876-49017898 CTTTGGGAGGGGAGGATATATGG - Exonic
1067916781 10:50408357-50408379 CTCTGGGAGGCAAAGGTAGAAGG + Intronic
1068689943 10:59905484-59905506 CTTTGGGTTGGGAGGGTGGACGG - Intronic
1069551724 10:69368744-69368766 CCCAGGCAGGGGAGAGTTGAGGG + Intronic
1069757601 10:70782705-70782727 CTCAGGAAGGGGAGGGGTGTGGG - Intronic
1069920938 10:71815313-71815335 CCCTGGGAGGGGACGGTGGATGG - Exonic
1070125449 10:73617965-73617987 TTCTGGGAGTGCAAGGTTGACGG + Intronic
1070558887 10:77550870-77550892 ATCTGGGAGGTGAAGCTTGAGGG - Intronic
1070776445 10:79112606-79112628 CCCAGAGAGGGGAAGGTTGATGG + Intronic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1071319441 10:84438491-84438513 CTCTGGAAGGGCAGGGAAGAAGG - Exonic
1071569688 10:86690228-86690250 CACTGGGAGGGGAGGGAAGGAGG - Intronic
1071602787 10:86967002-86967024 CTCTGGGAGAGGAGGGGCGGGGG + Intronic
1072142083 10:92597892-92597914 CTTTGGGAGGCCAGGGTGGACGG - Intronic
1072260756 10:93669324-93669346 CTCTGGGAGGCCAGGGTGGGAGG + Exonic
1072285281 10:93908534-93908556 CTCTAGGAGGGGAAGGAGGAAGG - Intronic
1072419735 10:95280130-95280152 CTCTGGGAGGCCAGGGTGGGTGG + Intronic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073104955 10:101027257-101027279 GTGAGGGAGGGGAGGGTGGAGGG - Intronic
1073554243 10:104433329-104433351 CTCTGGGAGGCTAAGGTGGAAGG - Intronic
1073702500 10:105944221-105944243 CTCTGTGAGAGGAGGTTAGAGGG + Intergenic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1074638252 10:115345635-115345657 CTGTTGGAGGGGACGATTGATGG + Intronic
1074858328 10:117490013-117490035 CTCTTGGAGGGGAGGCAGGAAGG + Intergenic
1075367985 10:121909801-121909823 CTTTGGGAGGCGAGGGTGGGAGG + Intronic
1076214103 10:128679124-128679146 ATCTGGGAGGGGATTGTGGAGGG + Intergenic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076377684 10:130002665-130002687 CTTTGGGAGGCCAGGGTGGACGG - Intergenic
1077320536 11:1938971-1938993 CTATGGGAGTGGAGAGTGGAGGG - Intergenic
1077484283 11:2831757-2831779 CTCTGGTGGGGGAGGGAGGAGGG - Intronic
1078129084 11:8596989-8597011 AGAGGGGAGGGGAGGGTTGAAGG + Intergenic
1078454280 11:11462955-11462977 CTCTGAGAGAGGAGGTTTGCTGG - Intronic
1078475585 11:11626384-11626406 CTCTTTGAGGGCAGGGATGAGGG - Intergenic
1078758592 11:14234001-14234023 CTTTGGGAGGCCAAGGTTGATGG - Intronic
1079248205 11:18768865-18768887 CTCTTGGTGGGGAGGGAGGAAGG - Intronic
1080813229 11:35726914-35726936 CTTTGGGAGGCTAGGGTGGAAGG + Intronic
1081535027 11:43990034-43990056 CTCTGGGAAGGGAGGAGTAAGGG - Intergenic
1081690501 11:45074681-45074703 CACTGGGAGGTGAGAGTGGATGG - Intergenic
1081813237 11:45924764-45924786 GTCTGGGAGGGGAGGGCATAAGG - Exonic
1081875762 11:46407476-46407498 CTCTGGGAGGAGGTGGTGGAAGG - Intronic
1081951548 11:47048374-47048396 CTTTGGGAAGGTACGGTTGAAGG + Intronic
1082767612 11:57181610-57181632 GTCTGGGAGGGAGGGGCTGAAGG - Intergenic
1083134288 11:60657080-60657102 CTCCATGAGGGGAGGGATGAGGG - Intergenic
1083627558 11:64079332-64079354 CTCTGGGAGGTTACGGTTAAAGG + Intronic
1083891154 11:65596387-65596409 CTGTGGCAGGGGAGAGTTGGGGG + Intronic
1083894776 11:65614350-65614372 CTCTGGGAGGGGAGCGGTGCAGG - Intronic
1083979877 11:66158452-66158474 CTTTGGGAGGCCAGTGTTGATGG + Intronic
1084558460 11:69889326-69889348 CTCGGGGAGGTGAGGGGTGCTGG - Intergenic
1084574300 11:69978592-69978614 CTTTGGGAGGCCAGGGTAGAAGG - Intergenic
1084590494 11:70087392-70087414 CTATGGTAGGGGATGGTTAATGG - Intronic
1084934493 11:72579607-72579629 CTCTGGGGGGAGAGGAGTGATGG + Exonic
1085297736 11:75440356-75440378 CTATGGGAGAGGAGGGTGAAGGG - Intronic
1085779292 11:79393883-79393905 CTCTGGCAGTGGGGGGTTGGAGG + Intronic
1086098192 11:83071492-83071514 CTCTGGCGGGGGAAGGTTGCTGG + Intronic
1088024258 11:105158619-105158641 CTGTGGGAGGGCAGGGGTGTAGG - Intergenic
1090114079 11:123947665-123947687 GTAAGGGAGGGGAAGGTTGAAGG + Intergenic
1090856367 11:130612382-130612404 CTCTTGGGGTGGAGGGATGAGGG - Intergenic
1091559466 12:1600400-1600422 CTCTGGGAGGCCAGGGTGGGAGG + Intronic
1091631054 12:2161278-2161300 CTCTGGGAGGGGAGAGACGGGGG + Intronic
1092126543 12:6078763-6078785 CTCTGAGAGGGGAGGGTGCCTGG - Intronic
1092263170 12:6963113-6963135 CGCTGGGAGGGAAGGGGTTAAGG + Intergenic
1092484534 12:8891037-8891059 ATCTGGGAGGGGAGGGCAAAGGG + Intergenic
1092646849 12:10584116-10584138 CTTTGGGAGGCCAGGGTTGGTGG - Intergenic
1094089100 12:26628498-26628520 CTCTGGGAGGAGACTGTTGGAGG + Intronic
1094786878 12:33859144-33859166 CTCTGCTAGGGGAGTGTAGAAGG - Intergenic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095626179 12:44318026-44318048 CTCTGCATGGGGAGGGGTGACGG + Intronic
1095660072 12:44722407-44722429 CTTTGGGAGGTCAAGGTTGAAGG - Intronic
1096077338 12:48814055-48814077 CCCGGGGATGGGAGGATTGAGGG + Intronic
1096189214 12:49604261-49604283 CTCTGGGAGGGGAGTGTGGGTGG - Intronic
1096299979 12:50418243-50418265 CTTTGGGAGGCGAAGGTTGGTGG - Intronic
1096351096 12:50902093-50902115 ATCTGGTAGGGTAGGGTTGCTGG - Intergenic
1096660020 12:53118486-53118508 CTCAGGGAGGGGAGAGTAGAAGG - Intronic
1097058362 12:56264294-56264316 CTTTGGGAGGTGAAGGTTGGTGG - Intergenic
1098548283 12:71734673-71734695 CTTTGGGAGGCCAGGGTTGGAGG + Intergenic
1098761869 12:74435033-74435055 CTCTGTGAGGGCAGTGTGGAAGG + Intergenic
1100529857 12:95453105-95453127 CTCTGGGAGAAAAGGGTTGAGGG + Intergenic
1100998622 12:100331362-100331384 CTTTGGGAGGGAAGGGTAGGTGG + Intronic
1101351190 12:103930863-103930885 CTCCGGGCGGGGAGGGGGGAGGG - Intronic
1101465198 12:104941481-104941503 TTTTGGGAGGCGAGAGTTGAGGG - Intronic
1101804835 12:108054647-108054669 CTTTGGGAGGTCAAGGTTGATGG - Intergenic
1102177919 12:110889613-110889635 ATCTGGGAGGTGAGGGCTGCTGG + Intronic
1102651204 12:114443828-114443850 CACTGGGAGGGGAGGGTCGCTGG + Intergenic
1102701613 12:114844230-114844252 CTTTGGGAGGCCAGGGTGGAAGG - Intergenic
1103039696 12:117684997-117685019 ATCTGGGAGGGGAGGGGTAGGGG + Intronic
1103678108 12:122672612-122672634 CTCTGGGAGGGGAGAGGGGCTGG - Intergenic
1103990409 12:124795321-124795343 ACCAGGGAGAGGAGGGTTGACGG - Intronic
1104109142 12:125689089-125689111 CCAGGGGAGGGGAGGGTTGGTGG + Intergenic
1104235860 12:126936120-126936142 CTCTGGGAGGCCAAGGTGGATGG + Intergenic
1104775496 12:131388070-131388092 CTCTGGGAGGGCAGGGGTCTCGG - Intergenic
1104786802 12:131455468-131455490 CTCTGGACAGGGAGGGTTGGCGG + Intergenic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1105917639 13:24931859-24931881 CTTTGGGAGAGGTGGGTGGATGG - Intergenic
1105966292 13:25387818-25387840 CTTTGGGAGGGCAGGGTAGGTGG + Intronic
1106150868 13:27100477-27100499 CTCAGAGAGAGGAGGGTTGAGGG - Intronic
1106862086 13:33920677-33920699 CTTTGGGAGGCCAGGGTAGAGGG - Intronic
1108352242 13:49598165-49598187 CTTTGGGAGGCCAGGGTGGATGG - Intergenic
1108419835 13:50237416-50237438 CTCCCTGAGGGGAGGTTTGAAGG + Intronic
1108441618 13:50459248-50459270 CCCTGAGGGGGGAGGGATGATGG + Intronic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1109067961 13:57724885-57724907 CTCTTGGAGGAGAGGGCTCAGGG - Exonic
1109153441 13:58873722-58873744 CTTTGGGAGGGCAAGGTTGGCGG - Intergenic
1109282892 13:60377561-60377583 CTCTGGGAGGGCAAGGTGGGCGG + Intergenic
1109763336 13:66860333-66860355 CTGGGGGAGGGGAGGGGTGGTGG + Intronic
1110113156 13:71776903-71776925 GTCTGGGTGGGGAGTGATGAAGG - Intronic
1110249645 13:73367014-73367036 CTCTGGGAATGGAAGGTTAAGGG + Intergenic
1110253865 13:73410077-73410099 CTCTTGGAGGGTAAGGTGGACGG + Intergenic
1110434320 13:75462514-75462536 CTCTGAGGGTGGAGGGTAGAGGG + Intronic
1110702366 13:78563547-78563569 CTGTGGGAGGGAAGGGCTGATGG + Intergenic
1110774755 13:79394875-79394897 CTCTGGGAGGCCAAGGTGGACGG - Intronic
1110945598 13:81411552-81411574 CTTTGGGAGGCCAAGGTTGATGG + Intergenic
1111348935 13:87000324-87000346 CCCTGGGAGGTAGGGGTTGAGGG + Intergenic
1111950812 13:94707686-94707708 CTTTGGGAGAGCAGGGTTGCTGG - Intergenic
1112031337 13:95459343-95459365 CTCTGGTAGGGTAGTGTGGAAGG - Intronic
1112430514 13:99346609-99346631 ATGTGGGAGGGGTGGGGTGAAGG - Intronic
1112939371 13:104842443-104842465 CTTTGGGAGGGCAAGGCTGAAGG - Intergenic
1113104415 13:106757759-106757781 CTCCGGGAGGGGTGGGGTGTGGG + Intergenic
1113418967 13:110155136-110155158 CTTTGGAAGGGGATGGTTGGAGG + Intronic
1113516182 13:110901795-110901817 CTCTGGGAGGCCAAGGTGGAAGG + Intronic
1113532407 13:111037810-111037832 CTCTGGGACTGGAGGGATCAGGG + Intergenic
1113536345 13:111069348-111069370 CTGTGGGAGGGGAGAGTGTAAGG + Intergenic
1114341161 14:21745996-21746018 ATCTGGGAGGTGAAGGTTGCAGG + Intergenic
1114532516 14:23404628-23404650 CACAGGGAGGGGAGGGTTAGGGG + Intronic
1114562318 14:23602329-23602351 CTCTGTCAGGGGAGGGGTGCCGG - Intergenic
1116733139 14:48651350-48651372 CTCTCGGCGGGGAGGGTCGGGGG + Intergenic
1117035450 14:51723309-51723331 CTTTGGGAAGGGAGGTATGAGGG + Intronic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1117683185 14:58226351-58226373 CTCTGGGAGGGCAAGGTGGGAGG - Intronic
1118316607 14:64729730-64729752 GTCTGGGAGGGCAGGGTGCAGGG + Intronic
1118361792 14:65063123-65063145 CTCTTGGAGGGGAGAGAAGATGG + Intronic
1118435265 14:65765383-65765405 CCCAGGGAGGGGAGGTTAGATGG + Intergenic
1119285650 14:73452114-73452136 CTTTGGGAGGCCAGGGTGGATGG + Intronic
1119630041 14:76222361-76222383 CTTTGGGAGGCCAGGGTGGATGG + Intronic
1119828877 14:77683093-77683115 CTCTGGGAGGTCAGGGCGGAAGG - Intronic
1119834052 14:77731462-77731484 CTTTGGGAGGCCAGGGTGGAAGG + Intronic
1121076974 14:91076999-91077021 CTCTGGGAGGCCAAGGTGGAAGG + Intronic
1121255570 14:92528039-92528061 CTCAGGGAGGGGGGCGTGGAAGG + Intronic
1121618482 14:95330102-95330124 AGCTGGGAGGGAAGGGTGGAGGG + Intergenic
1121958007 14:98231558-98231580 CTCTGGCAGGGTAGGGTGGAAGG - Intergenic
1122255156 14:100471069-100471091 CCCTGGGAGAGAATGGTTGAGGG + Intronic
1122346044 14:101061007-101061029 CTCTGGGAAGCAAGGGGTGAAGG + Intergenic
1122442564 14:101742289-101742311 CTTTGGGAGGGCAAGGTGGATGG - Intergenic
1122940083 14:104977317-104977339 ATCTTGGAGGGCAGGGCTGAGGG - Intronic
1124100351 15:26687077-26687099 CTCTGGGAAGTGAGGGTGCAGGG + Intronic
1124358587 15:29017612-29017634 CTTTGGGAGGCCAGGGTGGACGG - Intronic
1125516292 15:40323235-40323257 CTCTGGGAGGGGACGGTAAGAGG - Intergenic
1126266159 15:46756173-46756195 CTCTGGTAGGGCAGTGTGGAAGG - Intergenic
1126457923 15:48884816-48884838 CTCTGGGAAGGGAAAGATGAGGG - Intronic
1126819406 15:52487170-52487192 CTCTGGGAGGCCAGGGTGGGAGG + Intronic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1127982730 15:64046425-64046447 CTCTGGGAGGAGAGGACTGCAGG - Intronic
1128252515 15:66172981-66173003 CCCTGGGAGGGGAGTGTTCAAGG + Intronic
1128553609 15:68615048-68615070 CTCTGAGAGGAGAGAGGTGAGGG + Intronic
1128689767 15:69714562-69714584 CTCTCGGAGGGCAGGGAAGAGGG + Intergenic
1128831911 15:70777220-70777242 CTGTGGGTGGAGAGGGTTGTGGG + Intergenic
1128995458 15:72291293-72291315 CTCTGGGAGCGTGGGGTAGAGGG + Intronic
1129359072 15:75013046-75013068 CTCTGTGAAAGGAGGGTGGAGGG - Intronic
1129600988 15:76997992-76998014 CTCTGGGAGGCCAAGGTGGATGG + Intronic
1130859895 15:87876462-87876484 CTCTGGGACGGGAGGAGTTAAGG - Intronic
1131234103 15:90681551-90681573 GTCTGGGAGGTGAGGGATGTGGG - Intergenic
1131527856 15:93166854-93166876 GTCTGGGAGGGGCGGGGTGAGGG + Intergenic
1131798110 15:96041295-96041317 CTCAGAGAGTGGAGGGTGGAAGG + Intergenic
1132724048 16:1331198-1331220 CTCAGGGTGGGGAGGGTGGGCGG + Intergenic
1132944200 16:2523618-2523640 CTCTGTGTGGGGAGGGCTGTGGG - Intronic
1133172720 16:3991824-3991846 CTCTGGGAGGGTGGGGTAGGTGG + Intronic
1133820233 16:9229429-9229451 CTCTGGGAGGCCAGGGCAGATGG - Intergenic
1134165955 16:11929635-11929657 CTCTGGGAGGGCGGGGCGGATGG + Intronic
1134253078 16:12588412-12588434 CTCTGGGAGGGGAAGATTGGAGG - Intergenic
1134545716 16:15106510-15106532 CTCTGGGAGGGCGAGGTGGATGG + Intronic
1134909025 16:18007412-18007434 CTCTGGGAGAGGAGGGTCTTAGG - Intergenic
1135309206 16:21392120-21392142 CACTGGCAGGGAAGGGTGGAGGG + Intergenic
1135311346 16:21407049-21407071 CTCTGGGAGGGCGGGGCGGATGG + Intronic
1135364298 16:21839500-21839522 CTCTGGGAGGGCGGGGCGGATGG + Intronic
1135447545 16:22531848-22531870 CTCTGGGAGGGCGGGGCGGATGG - Intronic
1136045511 16:27611983-27612005 GTCTGGGAGCGGAGGCTAGAGGG + Intronic
1136148787 16:28332447-28332469 CACTGGCAGGGAAGGGTGGAGGG + Intergenic
1136184219 16:28576245-28576267 CACTGGGCGGGGAGGGTAGGAGG + Intronic
1136305949 16:29371250-29371272 CACTGGCAGGGAAGGGTGGAGGG + Intergenic
1136308051 16:29386045-29386067 CTCTGGGAGGGCGGGGCAGATGG + Intronic
1136321467 16:29487589-29487611 CTCTGGGAGGGCGGGGCAGATGG + Intronic
1136436147 16:30227559-30227581 CTCTGGGAGGGCGGGGCAGATGG + Intronic
1136499835 16:30664692-30664714 CTGTGGGAGGGGACGGGAGAAGG - Intronic
1137868835 16:51929873-51929895 CTTTGGGAAGGGAAGGTTGATGG - Intergenic
1138122621 16:54412614-54412636 CTTTGGGAGGTCAGGGTTGGAGG + Intergenic
1138136804 16:54530437-54530459 TGCTGGGAGGGAAGGGTTGGGGG - Intergenic
1139256352 16:65546614-65546636 CATTGTGAGGGGAGGGTTGGGGG + Intergenic
1139507168 16:67404606-67404628 TCCTGAGAGGGGCGGGTTGAGGG - Intronic
1139683466 16:68583299-68583321 CTCGGGGAGAGGAGGAGTGACGG - Intergenic
1139815695 16:69669136-69669158 CTTTGGGAGGCTAAGGTTGAAGG - Intronic
1140357135 16:74316068-74316090 CTCTGGGAGGCAAGGGTGGGTGG + Intergenic
1140498259 16:75409100-75409122 CTCTGGGAGGCGAAGGTGGGTGG - Intronic
1140586967 16:76304429-76304451 CGGTAGGATGGGAGGGTTGAGGG + Intronic
1141314319 16:82946260-82946282 ATGTGGGAGGGAAGGGTGGAAGG + Intronic
1141474261 16:84261864-84261886 CTCTGGGAGGCCAAGGTGGACGG - Intergenic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1142170611 16:88620343-88620365 CTCTGGGAGGCCAGGGTGGGAGG + Intronic
1142196041 16:88739758-88739780 CTCTGAGAGGGGTGGGCTCAGGG - Intronic
1142431508 16:90030859-90030881 CTCTGGGAGGCTGAGGTTGAAGG - Intronic
1142666943 17:1468651-1468673 GTCAGGAAGTGGAGGGTTGATGG - Intronic
1142860871 17:2760582-2760604 CTCTGGGAGGCCAAGGTCGATGG - Intergenic
1142870189 17:2814843-2814865 GTGTTGGGGGGGAGGGTTGACGG + Intronic
1142998185 17:3773727-3773749 TTCTGGGAGAGAAGGGCTGAAGG - Intronic
1143020906 17:3916804-3916826 CCCTGGTGGGGGAGGGTGGAGGG - Intergenic
1143587295 17:7856574-7856596 GGTTGGGAGAGGAGGGTTGAGGG + Intergenic
1143621782 17:8084911-8084933 CTCTGGCAGGGGTGGGTGCAAGG + Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144770733 17:17758019-17758041 CTCTGGAAAGGGAGAGATGAGGG - Intronic
1144782181 17:17813810-17813832 CTCTGGGAGGGGCAGGATGGGGG + Intronic
1144997137 17:19277827-19277849 CTCTGGGAGGCCAGGGTGGGCGG + Intronic
1145040986 17:19578437-19578459 CTTTGGGAGGGCAAGGTGGAAGG - Exonic
1145923660 17:28630105-28630127 CTCTGGGAGGCCAGGGTGGGTGG - Intronic
1146116943 17:30149291-30149313 CTCTGGGAGGCCAAGGTTGGAGG - Intronic
1146184720 17:30717366-30717388 CTGTGTGTGGGGAGGGTTGCTGG - Intergenic
1146286566 17:31578061-31578083 CCATGGGAGGGGATGGTTGAGGG - Intergenic
1146456589 17:33014065-33014087 CTCTGGAAGGGAAGGGTTGGTGG + Exonic
1146992593 17:37288652-37288674 CTCTGGGAGGGCAAGGCAGAAGG + Intronic
1147156377 17:38546409-38546431 CTTTGGGAGGGGGTGGTTGGGGG - Intronic
1147161531 17:38571971-38571993 CCCTGGGAGGGGAGGGGCTAGGG + Intronic
1147972591 17:44227637-44227659 TTCTGGGAGAGGAGGGGTGGGGG - Intergenic
1148046538 17:44748398-44748420 CCCTGGGATGGGAGGGCTGATGG - Exonic
1148061775 17:44841673-44841695 CTCTGGGAGGCGGAGGTTGGTGG + Intergenic
1148273262 17:46280428-46280450 CTCTGGGAGGCCAAGGTTGGCGG + Intronic
1148350454 17:46938104-46938126 CTCTGGGAGGGGTGGGTGGGAGG - Intronic
1148460954 17:47838720-47838742 CTGTGGGAGGGGAGAGTGGCTGG + Intronic
1148570488 17:48664373-48664395 CTTTGGGAGGCCAAGGTTGACGG - Intergenic
1148640776 17:49185595-49185617 CTCTGCGAGGGGAGTGAGGAAGG + Intergenic
1148718837 17:49736006-49736028 CTCTGGGTGTTGAGAGTTGAGGG - Intronic
1148763627 17:50022778-50022800 CTCTGGGAATGGGGGGTTGAGGG - Intergenic
1148806103 17:50264725-50264747 CACAGGGAGGGGAGGGTGGAGGG + Intergenic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1148869543 17:50648302-50648324 CTCGGGGATTGGAGGGCTGAAGG + Intronic
1148873103 17:50670022-50670044 CTCTGGGAGGCCAGGGTGGGAGG - Intronic
1149434287 17:56620016-56620038 CTCTGGCAAGGGAGGGTGAACGG - Intergenic
1149493452 17:57101436-57101458 CTTTGGGAGGCGGGGGTTGGGGG - Intronic
1150466359 17:65396039-65396061 CTCTTTGAGGGGAGGGTTAGTGG + Intergenic
1150719107 17:67599099-67599121 CTCTGGGAGGCCAAGGTGGATGG - Intronic
1151147921 17:72058391-72058413 CTCTGGGAGGGTGGGGGGGATGG - Intergenic
1151586221 17:75010319-75010341 CTCTGGGAGGCCAGGGTGGGTGG - Intergenic
1152140205 17:78532075-78532097 CTCAGGGAGATGAGGGCTGAGGG - Intronic
1153719718 18:7889580-7889602 CTCTGGGAGGCTAGGGTGGCAGG - Intronic
1153912636 18:9717629-9717651 CTCTGGGAGGGAAGGACAGAGGG + Intronic
1153959515 18:10128868-10128890 TTTTGGGAGAGGAGGCTTGAAGG - Intergenic
1154326288 18:13393171-13393193 CTCTGGAAGGCGGGGGCTGAGGG - Intronic
1155076327 18:22359131-22359153 CTTTGGGAGGCCAGGGTGGATGG + Intergenic
1155144329 18:23070860-23070882 CTCAGGGAGGGGAGGCATCAAGG - Intergenic
1155288126 18:24312890-24312912 CTCTGGGAGGGCAAGGTGGGCGG + Intronic
1155612649 18:27684306-27684328 CTCTAGAAGGGGAGGATTCAGGG + Intergenic
1155669445 18:28351068-28351090 CTCTGGGATGGGAGTGTTTAAGG - Intergenic
1155857482 18:30850949-30850971 CTCTGCAAGGGGAGGGTTTATGG + Intergenic
1156320508 18:36017060-36017082 CTCTGGGAGGCGAGGGCAGGTGG + Intronic
1156455341 18:37290103-37290125 GTCTGGGAGGTGAGTGATGATGG + Intronic
1156557133 18:38080056-38080078 CTCCTGGAGGGCAGGGTGGAGGG + Intergenic
1157264745 18:46208709-46208731 ATCTGGGAGGTCAGGGTGGATGG - Intronic
1157270301 18:46269999-46270021 CTCTGGAAGGGGAGGTATGGAGG + Intergenic
1157523229 18:48359793-48359815 CTCTGGGAGGGCAGTGCAGAAGG + Intronic
1157580963 18:48773933-48773955 CTCTTAGAGCGGAGGGTTGAAGG - Intronic
1157954409 18:52081198-52081220 CCTTGGGAGGGAAGGATTGATGG - Intergenic
1158076093 18:53531559-53531581 CTCAGGGAGGGATGGGGTGAAGG - Exonic
1159192574 18:65066477-65066499 CTCTGGGAGGCAAAGGTTGGTGG + Intergenic
1159449593 18:68583402-68583424 CACTGGTAGGGGAGGGTGGTAGG + Intergenic
1159812966 18:73038990-73039012 CTCTGGGAGAAGAGGGATGGGGG - Intergenic
1160764568 19:801691-801713 CTGTGGGAGGCGAAGGTTGGAGG + Intronic
1160824794 19:1074571-1074593 CACTGGGTGGGGAGGGATGGAGG - Intronic
1160871837 19:1281294-1281316 CTCTGGGTGGGGGGGGGTGGGGG + Intergenic
1161412398 19:4123816-4123838 CTCGGCGATGGTAGGGTTGATGG + Exonic
1161485641 19:4534285-4534307 CTCTGGCAAGGTAGGGTTGCCGG + Intronic
1161628485 19:5339936-5339958 CCCTGGGTGGGGAGGCTGGAAGG + Intronic
1162793573 19:13075417-13075439 CTCTGGGTGGGGAGTGGTGCCGG - Intronic
1162821921 19:13228322-13228344 CTTTGGGAGGTGAGGGGTGGAGG + Intronic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1162974063 19:14198327-14198349 CTGTGTGTGGGGAGGGTTGCTGG + Intronic
1163122818 19:15228099-15228121 GTCTGGGGTGGGAGGGTTGGGGG + Exonic
1163312178 19:16521237-16521259 CACTGGGAAGGGTGGGCTGAGGG + Exonic
1164378610 19:27711737-27711759 CTGTGGGAGAGGAAGGCTGAGGG + Intergenic
1164482160 19:28620229-28620251 CTCTGGGAGTTGAGGGTGGGAGG - Intergenic
1165547102 19:36548775-36548797 CTCTGGGAGGGCAAGGTGGGTGG + Intronic
1165885883 19:39077912-39077934 CTCTGGGAGGCCAAGGTGGAAGG + Intergenic
1166252719 19:41582472-41582494 CTCTGCTAGGGAAGTGTTGAAGG - Intronic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166547318 19:43640969-43640991 GTCTGGGCGGGGAGGGGGGAGGG - Intergenic
1166852079 19:45765891-45765913 CTCTGGGAGAGCAGGGCTGGGGG + Exonic
1167014350 19:46830638-46830660 CTCAGGGAGGCGAGGGTTCGAGG - Intergenic
1167072138 19:47227627-47227649 CTTGGGGAGGGAAGGGTTAAAGG - Intronic
1167129238 19:47573357-47573379 TTTTGGGAGGGGGCGGTTGAGGG + Intergenic
1167294149 19:48639668-48639690 CTGGGGGAGGAGAAGGTTGAGGG - Intronic
1167295692 19:48647821-48647843 CTCTGGGAGGTCAAGGTGGATGG + Intergenic
1167361244 19:49031721-49031743 CTCAGGGAGGGGAGGGTTCGAGG - Intronic
1167365549 19:49053414-49053436 CTCTGGGAGGGGGTTGTTCAGGG - Intergenic
1167425216 19:49426693-49426715 TTCTCGGAGGTCAGGGTTGAGGG - Exonic
1167685330 19:50952552-50952574 CTCTGGGGTGGGAGGGTTGTGGG - Intronic
1168702456 19:58449330-58449352 CTCTGGTAGGGCAGTGCTGAAGG + Intergenic
925517842 2:4704522-4704544 CTCTGGGAGGCCATGGTAGATGG + Intergenic
925632454 2:5908793-5908815 CTCAGGGAGAAGAGGGTGGAGGG + Intergenic
926004344 2:9361299-9361321 CTCAGGGAAAGCAGGGTTGAAGG - Intronic
926761902 2:16285467-16285489 GCCTGGGAGGAGAGGGTGGAGGG + Intergenic
927181370 2:20448504-20448526 CTGCGGGAGGGGAGGGCTGCTGG + Exonic
927605647 2:24484044-24484066 CTCTGCTAGGGCAGGGTGGAAGG + Intergenic
927631459 2:24777690-24777712 CTCTGGGAGGCCAGGGTGGGCGG - Intergenic
927797144 2:26059751-26059773 CTGGGGGAGGGAAGGGGTGAAGG + Intronic
927970046 2:27299914-27299936 CTCTGGGAGGCCAAGGTGGACGG - Intronic
928997452 2:37308528-37308550 CTCTGGGTGGGGAGGGAGGTGGG - Intronic
929193272 2:39159763-39159785 ATGTGGGAGGCGAAGGTTGAAGG + Intergenic
929914436 2:46122469-46122491 CTCTGGGAGGCCAAGGTGGATGG - Intronic
929976970 2:46644301-46644323 CTCTGGGAGGGCAAGGTGGGTGG + Intergenic
930066576 2:47332436-47332458 CTGTGGGAAGGGAAGATTGACGG - Intergenic
930198180 2:48529734-48529756 CTCTGGGTGGGGATGATGGAGGG - Intronic
932378640 2:71261367-71261389 CTTTAGAGGGGGAGGGTTGAAGG + Intergenic
932380480 2:71277134-71277156 ATCTGGGAGCGGTGGATTGAGGG + Intronic
932476999 2:72012685-72012707 CAGTGGGAGGGGTGGGTTGGTGG + Intergenic
932819139 2:74884821-74884843 CTCTGGGAGCAGATGCTTGACGG - Intronic
932883216 2:75523607-75523629 GGTTGGGAGGGGAAGGTTGATGG - Intronic
933135422 2:78728129-78728151 GGCTGGGAGGGGTGGGCTGAGGG + Intergenic
933864131 2:86500508-86500530 CTCTGCGAGGGCAGTGTGGAGGG - Intergenic
933990430 2:87629986-87630008 CTCTGGGCGGGCAGGGGTCAAGG + Intergenic
934187557 2:89760572-89760594 CACTGGTAGGGGAGGGGTGGGGG - Intergenic
934654868 2:96112263-96112285 CCCAGGGAGGGGAGGGAGGAAGG - Intergenic
935373962 2:102376682-102376704 TGGTGGGAGGGGAGGGATGATGG + Intronic
936042732 2:109161930-109161952 CCTGGGGAGGGGAGGGTTGGGGG + Intronic
936303416 2:111320838-111320860 CTCTGGGCGGGCAGGGGTCAAGG - Intergenic
936435484 2:112501622-112501644 CTTTGGGAGGCCAGGGTGGATGG + Intronic
936600322 2:113889405-113889427 CCCTGGGAGGTGGGGGTTGGGGG + Intergenic
936788765 2:116125472-116125494 CTCTGGTAAGGCAGTGTTGAGGG - Intergenic
937159614 2:119747590-119747612 AGCTGGGTGGGGAGGGTGGAAGG + Intergenic
937275043 2:120678940-120678962 CACTGAGAGGGGAGGGTATAAGG - Intergenic
937379675 2:121365368-121365390 CTCTGGGAGAGGAGGCAGGAAGG - Intronic
937703156 2:124887188-124887210 CTTTAGGAGGGGCAGGTTGAAGG - Intronic
937751060 2:125476745-125476767 CTCTGCAAGGGCAGTGTTGAAGG + Intergenic
939633955 2:144558897-144558919 CTTTGGGAGGCCATGGTTGACGG + Intergenic
941767599 2:169315371-169315393 CTCTGGGATGGGAGCATGGATGG + Intronic
942505199 2:176634550-176634572 CTGGGGGTGGGGATGGTTGAAGG + Intergenic
945333502 2:208565621-208565643 CTTTGGGAGGCGAGGGTGGGTGG + Intronic
946543055 2:220706962-220706984 CTCTGGGAGGAAAGGGCAGAGGG - Intergenic
946549310 2:220783136-220783158 TTCTGTTAGGGGAGGGTTGTTGG + Intergenic
946640319 2:221776790-221776812 CTTTGGGACGGCAAGGTTGATGG - Intergenic
947179200 2:227397240-227397262 CTTTGGGAGGCCAGGGTGGAAGG + Intergenic
947532128 2:230916128-230916150 CTTTGGGAGGCCAAGGTTGAAGG + Intronic
947535779 2:230939842-230939864 CCCTGGGTGGGGAGGGATGGTGG - Intronic
947573068 2:231250558-231250580 CTCCCAGAGGGGAGGGTAGACGG + Intronic
1168990903 20:2095124-2095146 TCCTGGGAGGGAAGGGTGGATGG - Intergenic
1169033768 20:2433119-2433141 CTCTGTAATGGGAGTGTTGAGGG - Intergenic
1170496304 20:16928777-16928799 CTTTGGGAGGCCAGGGCTGAAGG - Intergenic
1170874716 20:20239912-20239934 TTATAGGAGGGGAGGGTTGTGGG + Intronic
1171498562 20:25575507-25575529 CTTTGGGAGGGCAAGGTGGATGG + Intronic
1172080867 20:32339596-32339618 TTCTGGAAGGGCAGGGTTCATGG - Intergenic
1172169575 20:32920838-32920860 CTCTGGGAGGGGAGGTAGGGAGG + Intronic
1172338484 20:34136359-34136381 CTCTGCGAGGGGAGTGTGGCGGG - Intergenic
1172467529 20:35167129-35167151 CTCTGGGAGGCCAAGGTGGATGG - Intergenic
1172535284 20:35667984-35668006 CTTTGGGAGGCGAAGGTGGATGG - Intronic
1172581772 20:36053982-36054004 ACCTGGGAGGCGAGGGTTGCAGG - Intergenic
1172734069 20:37112721-37112743 CTTTGGGAGGCCAGGGTGGATGG - Intronic
1173062853 20:39678986-39679008 GTCTGGGAGGGGAGGATCAATGG - Intergenic
1173313353 20:41920479-41920501 CTCTGGGAGGTGGAGGTTGCAGG + Intergenic
1173477690 20:43373472-43373494 CTCTGGGTGGTGAGATTTGAGGG - Intergenic
1173491316 20:43484823-43484845 CTTTGGGAGGCCAGGGTGGATGG + Intergenic
1173515436 20:43662419-43662441 CTTTGGGAGGGCAAGGTGGAAGG - Intergenic
1173530880 20:43768622-43768644 CTATGGGAGGGGAGGCATGAGGG - Intergenic
1173596528 20:44262172-44262194 CTCTGGTAGGGGTGGGGAGAAGG + Intronic
1174030700 20:47623542-47623564 CTCTGGGAGGCCAGGGTGGGTGG + Intronic
1174107482 20:48172800-48172822 CTCTAGCTGGGGAGGGGTGATGG + Intergenic
1174177398 20:48653609-48653631 CTCTGGGGTGGGAGGGGTGGAGG - Intronic
1174240043 20:49126316-49126338 CTCTGGGAGGCCAGGGTGGGAGG + Intronic
1174316039 20:49702609-49702631 CTCTGGGAGGCGGGGGTGGGAGG + Intronic
1174466011 20:50718042-50718064 CTCTGGGAGGTCAAGGTGGAAGG - Intergenic
1175097284 20:56551686-56551708 AGCTGGGAGGGGAGGGTGTACGG + Intergenic
1175337663 20:58206731-58206753 CTGGGGGAGGGGAGGGGTGTGGG - Intergenic
1175349567 20:58309042-58309064 CCCTGGGCGGGGCGGGCTGAGGG - Intergenic
1175926470 20:62473962-62473984 CACTGGCAGGGGAGGGATGAAGG + Intronic
1176073741 20:63239263-63239285 CTGGGGCAGGGGAGGGCTGAGGG + Intronic
1176182578 20:63757911-63757933 CTCTGGACGGGGCGGGTGGAGGG - Intronic
1176182587 20:63757942-63757964 CTCTGGACGGGGCGGGTGGAGGG - Intronic
1176182638 20:63758123-63758145 CTCTGGATGGGGCGGGTGGAGGG - Intronic
1176182647 20:63758154-63758176 CTCTGGACGGGGCGGGTGGAGGG - Intronic
1176184219 20:63769318-63769340 CTCTGAGGGTGGAGGGTGGAGGG + Intronic
1177190674 21:17847845-17847867 CTCTAAGAGGGGAGGGTTCAGGG - Intergenic
1178753797 21:35328623-35328645 CTGTGGGAGTTGGGGGTTGAGGG + Intronic
1179103848 21:38380749-38380771 GACTGGGGGTGGAGGGTTGAGGG + Exonic
1179176069 21:39009230-39009252 CTCTTGGAGGGCTGGGATGATGG - Intergenic
1179959317 21:44759308-44759330 GTCAGGGTGGGGAGGGTTCAGGG - Intergenic
1180795678 22:18603807-18603829 CTCTGGGAGGGCGGGAATGAGGG - Intergenic
1181107323 22:20582880-20582902 CTCTGGGAGGGCTGCGGTGAGGG - Exonic
1181226051 22:21391465-21391487 CTCTGGGAGGGCGGGAATGAGGG + Intergenic
1181252585 22:21543347-21543369 CTCTGGGAGGGCGGGAATGAGGG - Intergenic
1181314579 22:21963088-21963110 CTCTGGGAGGCTAAGGTGGATGG + Intronic
1181795031 22:25301830-25301852 CTCTGGGAGCGGAGGGAAAAAGG + Intergenic
1182144791 22:27990727-27990749 CTCGGGGGTGGGTGGGTTGAGGG + Intronic
1182253165 22:29018071-29018093 GTGTGGGAGGGGAGGGCGGACGG + Intronic
1182310972 22:29406217-29406239 CCCGGGCAGGGGAGGGTGGAAGG - Intronic
1182422149 22:30253868-30253890 CACTGGGTGGGGAGGATGGAGGG + Intergenic
1182690138 22:32154885-32154907 CCCGGGCAGGGGAGGGTGGAAGG + Intronic
1182756808 22:32687023-32687045 CTATAGGAGGGGAGAGGTGATGG - Intronic
1182827021 22:33274218-33274240 CTCTGGGAATGCAGGGTTGTGGG + Exonic
1183261288 22:36797523-36797545 CTCTGGGTGGAGAGGGGAGAGGG + Intergenic
1183289999 22:36995336-36995358 GGCTGGGAGGGGAGAGTAGAGGG - Intronic
1183293294 22:37015842-37015864 CTCTTGGAGGAGGGGGTTGGGGG + Intronic
1183446206 22:37857116-37857138 CTTTGGGAGGTGAAGGTGGACGG + Intronic
1183459598 22:37941808-37941830 CTATGGGAGAGGAGGAGTGATGG + Exonic
1183748149 22:39704114-39704136 CCCTGGGAGGGGAGGGGAGAAGG + Intergenic
1184212489 22:43044083-43044105 CTCTCGGGGAGGAGGGTTGTTGG - Intronic
1184359548 22:44006766-44006788 CTATGAGAGGAGAGGGCTGAAGG - Intronic
1184606341 22:45576811-45576833 CCCTGTGTGGGGAGGGTGGAGGG - Intronic
1184718851 22:46297299-46297321 CTCTGTGAGCCGAGGGCTGAAGG + Intronic
1185381188 22:50508086-50508108 CTCCGGGAGGGGGGGGTGGGCGG - Intergenic
949775328 3:7626185-7626207 TTCTGGGAGGGGAGGGACGAGGG - Intronic
950187603 3:10954670-10954692 GACTGGGAGGTGAGTGTTGAGGG + Intergenic
950191363 3:10978650-10978672 CTCTGGGAGGCCAAGGTAGATGG + Intergenic
950654059 3:14425709-14425731 CTCGGGGCAGGGAGGGTGGAAGG + Intronic
950671458 3:14528610-14528632 CTTTGGGAGGCCAGGGTAGAAGG + Intronic
951322785 3:21267185-21267207 CTCTGAGAAGGGATGGCTGAAGG + Intergenic
952011046 3:28901827-28901849 CTCGGGGTGGGGAGGGGTGGGGG - Intergenic
952071068 3:29636478-29636500 ATGTGCGAGGGGAGGGTGGAAGG + Intronic
952192967 3:31043197-31043219 GTCAGGGAGGGGAGGGTGGAGGG - Intergenic
952529079 3:34244545-34244567 CTGTGGAAGGCGAGGGTTGTGGG - Intergenic
952801737 3:37299096-37299118 CTCCGGGAGAGGAGAGTGGATGG + Intronic
952841976 3:37654259-37654281 CTGTGGCAGGAGAGGGCTGAAGG + Intronic
952859176 3:37798231-37798253 CTCTGGGAGGCCAGGGTGGGAGG - Intronic
953876520 3:46669859-46669881 GCCTGTGAGGGGAGGGTTGAGGG - Exonic
954316704 3:49805436-49805458 CCCTGGTAGGGGTGGGTTTAGGG + Exonic
954419190 3:50409679-50409701 CTCTCTGAGGGCAGGGTGGAAGG + Intronic
954501346 3:51019620-51019642 CTGTTGGAGGTGAGGGTGGAAGG - Intronic
954672840 3:52299763-52299785 TTCGGGAAGGGGATGGTTGATGG + Intergenic
955633234 3:60997487-60997509 CTGTGGGGTGGGAGTGTTGAGGG + Intronic
956085692 3:65606899-65606921 CTCTGGGAGGCCAGGGTGGGTGG - Intronic
956822770 3:72968816-72968838 CTTTGGGAGGGCAAGGTTGGCGG + Intronic
958042621 3:88244855-88244877 CTCTGGTAGGGCAGCGTAGAAGG + Intergenic
959113786 3:102152098-102152120 CTTTGCTAGGGGAGTGTTGAAGG - Intronic
959319917 3:104859490-104859512 CTTTGGGAGGCCAAGGTTGAAGG + Intergenic
960005435 3:112776687-112776709 CTTTGGGAGGTGAGGGTGGGCGG + Intronic
960574840 3:119219214-119219236 CTTTTGCAGGGGAGGGTTGAAGG + Intronic
960907975 3:122620721-122620743 GCCTGGGAGGGGAGGGTGGGAGG + Intronic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
962841318 3:139235294-139235316 CCCTAGGAGGGCAGGGTGGAGGG - Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963288083 3:143456804-143456826 CTCTGGGAGGCCAAGGTGGATGG - Intronic
963974076 3:151461044-151461066 CTCTGGGAGGGAAGGAAGGAAGG + Intergenic
964466273 3:156996819-156996841 CTCTGGGAGGCCAAGGTGGATGG + Intronic
965871401 3:173269534-173269556 ATGTGGAAGGGGATGGTTGAAGG + Intergenic
966393205 3:179474858-179474880 CTTTGGGAGGGCAAGGTGGAAGG - Intergenic
968234671 3:197024484-197024506 CTCTAGGAGGGGAGGGGAGTGGG + Exonic
968281682 3:197481786-197481808 CTCTGGGAGGCCAAGGTTGGTGG + Intergenic
968727895 4:2256708-2256730 CTCTGGGAGGAGAGGACAGAGGG + Intronic
968815352 4:2818755-2818777 CTCTGGGCAGGGAGGGGTCAGGG - Intronic
969111069 4:4844605-4844627 TTGTGGCAGGGGAGGGTTGGGGG - Intergenic
970099339 4:12503027-12503049 CTCTGGTAGGGCAGTGTGGAAGG - Intergenic
970420089 4:15897984-15898006 CTCGGGGAGGGGAGAGATGTTGG - Intergenic
970909280 4:21255516-21255538 CTGAGGGAGGGGAGAGTTTAAGG - Intronic
971161685 4:24140043-24140065 CTCTGGAATGGTAGGGCTGATGG - Intergenic
971231049 4:24800367-24800389 CTCTGGGTGGAGAGGGCTGCGGG - Exonic
972353158 4:38256076-38256098 CTCTGGGAGGCCAGGGTAGGAGG + Intergenic
972466676 4:39363969-39363991 CTTTGGGAGGCCAGGGTGGAAGG + Intronic
973896249 4:55416282-55416304 CTCTGGGAGGCCACGGTGGAAGG - Intronic
974001809 4:56519366-56519388 CTTTGGGAGGGCAGGGGTGGGGG + Intronic
974629134 4:64460572-64460594 CTGTAGGAGGGGAGGGGTGGGGG - Intergenic
975614594 4:76234120-76234142 GGCAGGGAGGGGAGGGTGGAGGG + Intronic
977472276 4:97455879-97455901 CTCTGGGAGGAGAATGTAGATGG - Intronic
977686925 4:99857296-99857318 CTGCAGGAGGGGTGGGTTGAGGG + Intronic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
980654046 4:135759294-135759316 CTCTGCTAGGGCAGGGTGGAGGG - Intergenic
981033765 4:140151279-140151301 ACCTGGGAGGGGAGGGAGGAGGG + Intronic
981359645 4:143831708-143831730 CTCTGGTAGGGCAGTGTAGAAGG + Intergenic
981370407 4:143952781-143952803 CTCTGGTAGGGCAGTGTAGAAGG + Intergenic
981380164 4:144062705-144062727 CTCTGGTAGGGCAGTGTAGAAGG + Intergenic
981751436 4:148095786-148095808 GGCTGGGATGGGAGGGTGGAGGG + Intronic
981860127 4:149344912-149344934 AAATGGGAGGGAAGGGTTGATGG + Intergenic
982116879 4:152105428-152105450 TTCTGGGGGTGGGGGGTTGAGGG - Intergenic
982693162 4:158570882-158570904 CTCTGGGAGGGTTGTGGTGATGG - Intronic
983555112 4:169052998-169053020 CTCTGGGAGGAAAAGGTTGGGGG - Intergenic
983848798 4:172553811-172553833 CTTTGGGAGGCAAGGGTGGAAGG + Intronic
983941551 4:173538511-173538533 GTCTGGGAGGTGAGGGTGGGAGG - Intergenic
984117749 4:175703412-175703434 CTTTGGGAGGCTAGGGTGGATGG - Intronic
985276589 4:188243423-188243445 CTTTGGGAGGCCAAGGTTGACGG - Intergenic
985777209 5:1851070-1851092 TTCGGTGAGGGGAGGGGTGAGGG + Intergenic
987252537 5:16114731-16114753 CTTTGGGAGGCCAGGGTGGAAGG - Intronic
987565522 5:19579888-19579910 CTTTGGGGGGGGTGGATTGAAGG - Intronic
987655779 5:20804075-20804097 CTATGGGAGGGGAGTGTTAGTGG - Intergenic
988649444 5:33131957-33131979 CTCTGGTAGGGCAGTGTGGAAGG + Intergenic
988675361 5:33427854-33427876 CTATGGGAGGGGAGGATGGATGG + Intergenic
988767775 5:34399831-34399853 CTATGGGAGGGGAGTGTTAGTGG + Intergenic
990502204 5:56407833-56407855 CTCTGAAAGGAGAGGGTTGCAGG + Intergenic
990956359 5:61344136-61344158 CTCTGGGAGGCCAAGGTGGATGG - Intronic
991061275 5:62379030-62379052 CTTTGGGAGGCCAGGGTGGATGG + Intronic
992004627 5:72465363-72465385 CTGGGGAAGGGGAGTGTTGAAGG + Intronic
992057123 5:73001151-73001173 CTTTGGGAGGCCAGGGTGGAGGG + Intronic
992785150 5:80163096-80163118 CTTTGGGAGGGCAGGGTGGGTGG - Intronic
994620698 5:102158154-102158176 CATTGGGAGGGGAGAGTTTATGG - Intergenic
995806402 5:116057244-116057266 CTTTTTGAGGGGAGGGTAGAGGG + Intronic
996179314 5:120399733-120399755 CTCTGGTAGGGCAGTGTAGAAGG + Intergenic
996916813 5:128721965-128721987 ACCTGGGAGGTGAAGGTTGAAGG + Intronic
997368244 5:133339356-133339378 CTCAGGGAGGGAGGGGTGGAGGG + Intronic
997836465 5:137197314-137197336 CTCTGGGAGATGAGGGATGAGGG + Intronic
999052153 5:148534461-148534483 CTCTGGCAGGGGATGGCTGGAGG - Intronic
999143453 5:149377797-149377819 GTGTGGGAGGGGTGGGTTGGGGG + Intronic
999267401 5:150275909-150275931 CTCAGGGAGGGGAGGGGGGCTGG - Intronic
999669352 5:153945081-153945103 CTCTGCTAGGGGAGTGTGGAAGG - Intergenic
999962909 5:156776175-156776197 CACTGAGTGGGGATGGTTGAAGG - Intergenic
1000044430 5:157510229-157510251 CTCTGGGAGGCTAAGGTGGATGG + Intronic
1000486392 5:161849056-161849078 CTGGGGGAGGGGGAGGTTGAAGG + Intronic
1001266216 5:170276390-170276412 GTCTGGGAGGGGAAGATGGAAGG - Intronic
1001540851 5:172537678-172537700 CTCTGGGAGGCCAAGGCTGATGG - Intergenic
1002149298 5:177214086-177214108 CTCTGGGAGGCCAAGGCTGATGG + Intronic
1002165848 5:177345095-177345117 CTCTGGGAGGGCAAGGTGGGTGG + Intronic
1002327633 5:178420386-178420408 CTCAGGGAGGGGAGGGGGAAAGG - Intronic
1002435095 5:179226518-179226540 CTGTGGGAGGCCAGGGTGGATGG - Intronic
1002466625 5:179411931-179411953 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466717 5:179412141-179412163 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466977 5:179412739-179412761 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002506387 5:179682005-179682027 CTTTGGGAGGGGAAGGTGGGTGG + Intronic
1002718546 5:181244239-181244261 CTTGGTGCGGGGAGGGTTGACGG + Intronic
1002878319 6:1230569-1230591 CACTAGGAGGGCACGGTTGAGGG - Intergenic
1002885598 6:1290799-1290821 CTCTTGGGGAGGAGGGTTGGGGG - Intergenic
1003025739 6:2554085-2554107 CTCTGTGAGGGGTGGGGAGAAGG - Intergenic
1003294735 6:4815175-4815197 TTCTGGAAGGTTAGGGTTGAGGG - Intronic
1004175945 6:13340251-13340273 GGCTGGGATGAGAGGGTTGAAGG + Intergenic
1004222277 6:13757057-13757079 CTTTGGGAGGCGAAGGTGGATGG + Intergenic
1004735915 6:18406350-18406372 ATCTGGGAGAAGAGGGTTGTAGG + Intronic
1005006132 6:21289328-21289350 CTTTGGAAGGGGTGGATTGAGGG + Intergenic
1005025652 6:21460671-21460693 CTCTGGGAGGGCAAGGTGGGTGG + Intergenic
1005159460 6:22842297-22842319 AAATGGGAGGGGAGGTTTGAGGG + Intergenic
1005455018 6:26011478-26011500 CTTTGGGAGGCCAAGGTTGATGG + Intergenic
1005810050 6:29508504-29508526 TAATGGGAGTGGAGGGTTGAGGG + Intergenic
1005882155 6:30070065-30070087 CTCTGGGAGAGGAAGGAAGAGGG + Exonic
1007224418 6:40302863-40302885 CTGTGTGAGGGGAGGGCTGGTGG + Intergenic
1007460322 6:42013425-42013447 CTATAGGAGGGCAGGGTTGTTGG + Intronic
1007464712 6:42043822-42043844 CTCTGGAAGGAGACGGTTGCTGG - Intronic
1009699758 6:67161046-67161068 CTCTGGTAGGGGAGTGCAGAAGG + Intergenic
1010013304 6:71074854-71074876 TTGTGGGAGGGAAGGGTTGGGGG + Intergenic
1010053172 6:71532161-71532183 GCGTGGGAGGGGAGGGTTGCTGG + Intergenic
1010120344 6:72368667-72368689 CTCTGGCAGGAGTGTGTTGAGGG + Intronic
1010194239 6:73223976-73223998 CTCAGGGAGGAGAGGGTAGCAGG - Intronic
1010274479 6:73953210-73953232 ATATGGGAGGGGAGAGATGATGG + Intergenic
1010991467 6:82484868-82484890 AGCTGGGAGGGGAGGGTTAGGGG - Intergenic
1011236918 6:85228274-85228296 CTCTGCTAGGGGAGTGTGGAAGG - Intergenic
1012691273 6:102314557-102314579 TACTGGGTGGGGAGGGTGGAAGG + Intergenic
1012715153 6:102659707-102659729 GACTAGGAGGGGAGGGTGGAGGG + Intergenic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1012904002 6:105042976-105042998 CTATGGGAGATGGGGGTTGAAGG + Intronic
1013250336 6:108327001-108327023 CTTTGGGAGGCCAGGGTGGAAGG + Intronic
1013422258 6:109977982-109978004 AGCTGGGAGGGGAGGGGTGAAGG - Intergenic
1013932838 6:115555481-115555503 CTCTGGGAGATGAGGGAAGATGG - Intergenic
1015282609 6:131449898-131449920 CTCTGGAAAGGCAGGGTTCAGGG - Intergenic
1017884331 6:158586702-158586724 CTTTGGGAGGGTAGGGTGGGAGG + Intronic
1018134511 6:160766992-160767014 CTGTGAGAAGTGAGGGTTGAAGG - Intergenic
1018207143 6:161446263-161446285 CTTTGGGAAGGGAGGCTTGGAGG + Intronic
1018466148 6:164047479-164047501 CTCTGTTAGGGTAGGGTGGAAGG + Intergenic
1019353876 7:568955-568977 CTCTGGGAGGGGAGGGTTGAGGG + Intronic
1019394238 7:808429-808451 CTCTGGGAGGGGAGCCCAGAAGG - Intergenic
1019619963 7:1987135-1987157 AGCTGGCAGGGGAGGGGTGAGGG - Intronic
1020725633 7:11810284-11810306 CTCTGAGAGGTGAGAGATGAAGG - Intronic
1021873128 7:25023187-25023209 CTCTGAAGGGGGAGGGTTGGGGG - Intergenic
1021920417 7:25479432-25479454 CTCTTGGTGGGGAGGGTCAATGG + Intergenic
1021945814 7:25726253-25726275 CGCTGGGAGGCGAGGGCTGCTGG - Intergenic
1022084026 7:27049087-27049109 CTTTGGGAGGCCAGGGTAGAAGG + Intergenic
1022240965 7:28512103-28512125 CTGTGGGAGGAGTGGGTTTAAGG + Intronic
1022511222 7:30935880-30935902 CTGGGGAAGGGGAGGGTTGGTGG + Intergenic
1022645433 7:32224927-32224949 CTCTGGAAGGGGATGGGAGAAGG + Intronic
1023322750 7:39016996-39017018 CTTTGGGAGGGGAAGGCTGGAGG + Intronic
1023907354 7:44532005-44532027 CTCAGGGAGAGCAGGGTTGGAGG - Intronic
1023965401 7:44961251-44961273 CTGAGGGAGCTGAGGGTTGAGGG + Intergenic
1024246558 7:47475437-47475459 CTCTGGTGTGGGAGGGTTCAGGG - Intronic
1024300650 7:47885088-47885110 CTCTGGGAAAGGAGGGCTGAGGG - Intronic
1024499258 7:50085550-50085572 CTCTGGGAGGGAGGCTTTGAAGG - Intronic
1024517628 7:50272830-50272852 TTCTGGGAGGGGAGGGTAACAGG + Intergenic
1025064594 7:55842361-55842383 CTCTGGGAGGGCAAGGTGGGTGG + Intronic
1025175366 7:56798178-56798200 CTTTGGGAAGGCAGGGTAGAAGG - Intergenic
1025620787 7:63168717-63168739 CTTTGGGAGGTGAAGGTTGGGGG - Intergenic
1025696434 7:63778235-63778257 CTTTGGGAAGGCAGGGTAGAAGG + Intergenic
1025913214 7:65844545-65844567 CTTTGGGAAGGCAGGGTAGAAGG + Intergenic
1025923055 7:65932339-65932361 CTCTGGGAGGCCAAGGTGGATGG - Intronic
1026374168 7:69733510-69733532 CTCTGAGAAGGGAGTGTTCAAGG + Intronic
1026446821 7:70492076-70492098 CACTGGGAGGGGTGGGGTGGAGG - Intronic
1026777156 7:73237684-73237706 CTCTGGGAGGCCAAGGTGGAAGG + Intergenic
1027018002 7:74791056-74791078 CTCTGGGAGGCCAAGGTGGAAGG + Intergenic
1027070024 7:75154856-75154878 CTCTGGGAGGCCAAGGTGGAAGG - Intergenic
1027126347 7:75559357-75559379 CTCTGGGAGGCCAGGATGGAAGG - Intronic
1027542647 7:79487489-79487511 ATCTGGGAGAGAAGGCTTGAGGG + Intergenic
1028443348 7:90890127-90890149 CTTTGGGAGGCCAGGGTGGAAGG + Intronic
1029184255 7:98727310-98727332 TTCTGGGAGGTGAATGTTGAGGG - Intergenic
1029471719 7:100758780-100758802 TTCTGTAAGGTGAGGGTTGAAGG + Intronic
1029817820 7:103114552-103114574 CTCTGAGAGGGCAGGGAGGAAGG - Intronic
1029995911 7:105007932-105007954 CTTTGGGAGGCCAGGGTTGGTGG - Intergenic
1031850579 7:126858126-126858148 CTTTGGCAGTGTAGGGTTGAAGG - Intronic
1031870332 7:127083829-127083851 CTCTGGAAGGACAGGGATGAAGG - Intronic
1032117075 7:129126555-129126577 CTCGGCGATGGTAGGGTTGATGG - Intergenic
1032223006 7:130008485-130008507 CTCTGGGAGGCCAGGGTGGGTGG - Intergenic
1032311586 7:130792421-130792443 GTCTGTGGGGAGAGGGTTGAGGG - Intergenic
1032395106 7:131583764-131583786 CTCTGGGAGGCGAAAGTGGAAGG + Intergenic
1032513383 7:132489730-132489752 CGCTGGGAGGGGTTGGATGAGGG - Intronic
1033287978 7:140058850-140058872 CTCTAGGAGGCCAGGGTGGATGG + Intronic
1033423796 7:141225273-141225295 CTATGGTGGGGGAGGGGTGAAGG - Intronic
1033587762 7:142787079-142787101 CTCTAGGAGGGGTGCGATGAGGG + Intergenic
1034362768 7:150515078-150515100 CTGTGGGAGGGGTGAGTAGAAGG + Intronic
1034434105 7:151054976-151054998 CTCTGGGAGGGGAGAGTCCATGG - Intronic
1034936715 7:155204703-155204725 CTTTGGGATGGGATGGTGGAGGG - Intergenic
1035051130 7:155999566-155999588 CCCTGGGAGGGGAAGGTGGCTGG + Intergenic
1035397252 7:158543259-158543281 CTCGGGGTGGGGAGGGTTGGAGG - Intronic
1035741811 8:1934089-1934111 CTCTGGGAGGCCAAGGTTGGAGG + Intronic
1035839561 8:2795707-2795729 TCCTGGGAGGGGAGGGCAGAGGG + Intergenic
1036293721 8:7518136-7518158 CACTGGGTGGGGAGGGGAGAGGG - Intergenic
1036328840 8:7802859-7802881 CACTGGGTGGGGAGGGGAGAGGG + Intergenic
1037607971 8:20453493-20453515 CTCTGGGAGGCCAAGGTGGAAGG - Intergenic
1038001525 8:23395915-23395937 CTCTGGGAGGCCAAGGTTGGGGG - Intronic
1038026423 8:23595143-23595165 CTCTGGGAGCGGGGGGTGGGGGG - Intergenic
1038165246 8:25079676-25079698 CTTTGGGAGGCCAAGGTTGATGG - Intergenic
1038644111 8:29349203-29349225 CTCTGGGAGCGGGAGGCTGAAGG - Intronic
1039839343 8:41282270-41282292 CTCTGGGAGGCCAAGGTTGGGGG + Intronic
1039945324 8:42123820-42123842 CCCTGGGAGGGGAGGGTGGCTGG - Intergenic
1040459550 8:47634209-47634231 CTTTGGGAGGCCAGGGTGGATGG + Intronic
1040661588 8:49582272-49582294 CTTTGGGCGGGGAAGGTTGGTGG - Intergenic
1040983556 8:53269523-53269545 CTCAGGGAGGAGAGGGTGGAAGG + Intergenic
1041425150 8:57712694-57712716 TTCTGGGTGTGGATGGTTGAGGG - Intergenic
1042081151 8:65052927-65052949 CTTAGGGAGGGGAGGGAAGATGG - Intergenic
1042483800 8:69330611-69330633 CCCTGGGAGGTGAGTGTGGATGG - Intergenic
1042538147 8:69879992-69880014 CTCTGGGAGGACAAGGTGGAAGG - Intergenic
1042619941 8:70693964-70693986 CTCTGGCAGGGGGTGGTTGGAGG + Intronic
1045302575 8:100926399-100926421 CTCTGGGAGGCTAGGGTGGCAGG + Intronic
1046967670 8:120185409-120185431 CTTTGGGAGGCCAGGGTTGCAGG + Intronic
1046975838 8:120276352-120276374 CTCAGAGTGGGGAGGGTGGAAGG + Intronic
1047336025 8:123937148-123937170 CTCTGGGAGGGCGAGGTGGACGG - Intronic
1047430288 8:124785260-124785282 CTCGGGGTGGGGAGCGCTGAGGG - Intergenic
1047528445 8:125654114-125654136 CTCTGGTAGGGGAGTGAGGAAGG + Intergenic
1048658597 8:136571504-136571526 CTCTGCTAGGGCAGGGTGGAAGG + Intergenic
1049487954 8:142876212-142876234 CTCTGGGTGGGGCTGGTTGCCGG + Intronic
1049492843 8:142914235-142914257 CTCTGGGTGGGGCTGGTTGCTGG + Intronic
1049797815 8:144504583-144504605 CCCTGGGAGGGGAGGGGAGCAGG - Exonic
1051286951 9:15507404-15507426 CTCTGGGAGGGCAAGGTGGATGG + Intronic
1051585151 9:18719605-18719627 CTTTGGGAGGCCAGGGTGGACGG - Intronic
1051664416 9:19455347-19455369 CTTTGGGAGGGGAAGGTGGGTGG + Intergenic
1051735113 9:20189924-20189946 TGCTGGGAGGGGAGGGGAGATGG + Intergenic
1052848881 9:33363525-33363547 CTCTGGGAGGCCAAGGTAGATGG - Intronic
1053122441 9:35557044-35557066 CTCTTGGAGGGGGCGGGTGAAGG + Intronic
1053361314 9:37488582-37488604 CTCTGAGAGGGGAGAGTGCAGGG - Intronic
1053486098 9:38457519-38457541 CTTTGGGAGGCCAGGGTGGAAGG + Intergenic
1054163231 9:61694432-61694454 CTTTGGGAGGGCAAGGTGGATGG + Intergenic
1056481865 9:87013768-87013790 CTCTGGAAGAGGAGGCTTAAAGG - Intergenic
1057433167 9:95014221-95014243 CTTTGGGAGGCCAGGGTGGATGG + Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1058165652 9:101615891-101615913 ATCTGGTAGGAGTGGGTTGATGG - Intronic
1059354037 9:113686129-113686151 CTCTGGGCGCTGAGGGTGGAGGG + Intergenic
1059405702 9:114097435-114097457 ACCTGGGAGGGGAGGGAGGAGGG + Exonic
1059533363 9:115058496-115058518 TTCTGGGAAGGGATGGTTTATGG + Intronic
1060214766 9:121732040-121732062 CTCTGGGGGGCCAGGGCTGAGGG + Intronic
1060238548 9:121884146-121884168 CTCTGGGAGGGGGAGGTGGATGG - Intronic
1060486791 9:124052663-124052685 GTCTTGCAGGGGAGGGCTGATGG + Intergenic
1060553926 9:124498836-124498858 ATCTGGGAGTCGAGGATTGATGG - Intronic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1060822799 9:126671360-126671382 TGCTGGGAGGGGAGGGCTGTGGG - Intronic
1060841023 9:126793215-126793237 CTTTGGGAGGCCAGGGTGGATGG + Intergenic
1060964298 9:127703979-127704001 CCCTGGGAGGGGAAGGCTGCTGG - Intronic
1061089536 9:128419300-128419322 CACTGCAAGGGGAGGGCTGAAGG - Intronic
1061226076 9:129281695-129281717 CGCTGGGAGTGGAGGGCTGAGGG + Intergenic
1061233473 9:129328444-129328466 CCCTGGAAGGGGAGGGAGGAAGG + Intergenic
1061330740 9:129890643-129890665 CCCTGGGAGGGGAGGGTAGTGGG + Intronic
1061349058 9:130049468-130049490 CTTTGGGAGGTGAAGGTTGGAGG + Intergenic
1061612042 9:131753470-131753492 CTCTGGGAGGCCAAGGTGGAAGG - Intergenic
1062105742 9:134753855-134753877 CCCTGGGAGCGGAGGTTTGAAGG + Exonic
1062192804 9:135256418-135256440 GTCGGGGAGGGGAAGATTGAAGG - Intergenic
1062502275 9:136856658-136856680 CTCTGGAGGGGGAGGGGAGAAGG + Intronic
1062572328 9:137191386-137191408 CTCTGGGAGGCTGGGGTGGAGGG + Intergenic
1062704014 9:137924846-137924868 CCCTGTGAGGGCAGGGTTGCTGG - Intronic
1203406188 Un_KI270538v1:15766-15788 TTGTGGGGGGGGAGGGGTGAGGG + Intergenic
1185528693 X:799861-799883 CTTTGGGAGGTCAGGGTGGATGG - Intergenic
1186309475 X:8302150-8302172 CTCTGGAAGGGCATGGTGGATGG + Intergenic
1186542203 X:10411971-10411993 ACCTGGGCGGGGAGGGCTGAAGG + Intergenic
1187347228 X:18477009-18477031 CTTTGGGAGGCCAGGGTGGACGG - Intronic
1187484105 X:19685828-19685850 CTGAGGGAGGGGAGTGGTGATGG - Intronic
1187578780 X:20586462-20586484 CTCAAGGAGGGGAGGGGTGGTGG - Intergenic
1187580420 X:20601949-20601971 CTGAGGGAGGGAAGAGTTGAAGG + Intergenic
1188201375 X:27295823-27295845 GTCTGGGAGGGGCGGGGCGATGG + Intergenic
1188514098 X:30966552-30966574 CTGTTGGAGGGGAAGGTTGGGGG + Intronic
1189447658 X:41095617-41095639 TACTGGGAGGGGAGGGGTTATGG + Intronic
1189784919 X:44550683-44550705 CTTTGGGAGGCCAGGGTGGAGGG + Intergenic
1190119754 X:47650395-47650417 CTCTGGGCCTGGAGGGTGGAGGG - Intronic
1190180771 X:48190412-48190434 ACCTGGGAGGGGAGGTTAGATGG + Intronic
1190196514 X:48323899-48323921 ACCTGGGAGGGGAGGTTAGAAGG - Intergenic
1190199699 X:48350266-48350288 ACCTGGGAGGGGAGGTTAGAAGG + Intronic
1190663238 X:52674265-52674287 ACCTGGGAGGGGAGGTTAGAAGG - Intronic
1190666471 X:52700722-52700744 ACCTGGGAGGGGAGGTTAGAAGG + Intronic
1190672947 X:52757688-52757710 ACCTGGGAGGGGAGGTTAGAAGG - Intronic
1190676185 X:52784217-52784239 ACCTGGGAGGGGAGGTTAGAAGG + Intronic
1191716105 X:64194619-64194641 ATCTGGGAGGAGAGGGGAGAGGG + Intronic
1192358202 X:70423001-70423023 CTCAGGGAGGCGAGGGCTGAGGG - Intergenic
1192444921 X:71203801-71203823 CTTTGGGAGGTCAGGGTAGAAGG + Intergenic
1193460521 X:81786416-81786438 CTCTGCTAGGGCAGGGTGGAAGG - Intergenic
1194089813 X:89571214-89571236 TTCTGGGAGGGAAGAGTTAATGG - Intergenic
1194397518 X:93403999-93404021 CTCTGGTAGGGCAGTGTAGAAGG - Intergenic
1194527204 X:94991207-94991229 CTCTGGGAGGGCAAGGCGGATGG + Intergenic
1194962347 X:100250281-100250303 CACTAGGAGGGGAGAATTGAGGG - Intergenic
1195322093 X:103728526-103728548 GTCTTGGAGGGGAGGGAGGAGGG + Exonic
1196778102 X:119359620-119359642 CTCAGGGAGTGGAGGGTGGCAGG + Intergenic
1197627804 X:128822543-128822565 CTCTGGGAGGCTAGGGGTGGGGG - Intergenic
1198024043 X:132687503-132687525 CTGGGGGAGGGGAGAGTTAATGG + Intronic
1198696366 X:139342736-139342758 CTCAGGGAGCGCAGGGTTGGGGG + Intergenic
1198711329 X:139507746-139507768 CTCTGGTACGGGAGGGTGGCAGG + Intergenic
1198857769 X:141035917-141035939 CTTTGGGAGGTCAGGGTGGATGG - Intergenic
1198904927 X:141551454-141551476 CTTTGGGAGGTCAGGGTGGATGG + Intergenic
1199165902 X:144674923-144674945 ACCTGGGAGGGGAGGGTACAGGG - Intergenic
1199307840 X:146288571-146288593 CACAGGGAGGGAAGGGTTGTGGG - Intergenic
1200051005 X:153431681-153431703 CTCTGGGAGGCTGGGGGTGAGGG + Intergenic
1200114159 X:153762843-153762865 CTCCAGGAGGGGAGGCTTGGGGG - Intergenic
1200442467 Y:3227264-3227286 TTCTGGGAGGGAAGAGTTAATGG - Intergenic
1201012699 Y:9564065-9564087 CTCTGGGAGGGAAAGGTTGGAGG + Intergenic
1201577776 Y:15478799-15478821 CTGATGGAGGTGAGGGTTGAGGG + Intergenic
1201755485 Y:17482004-17482026 CTCTGGGTGGGGGGTGTTGACGG + Intergenic
1201846067 Y:18423981-18424003 CTCTGGGTGGGGGGTGTTGACGG - Intergenic
1202107993 Y:21390396-21390418 TTCAGGGAGGAGAGAGTTGAAGG - Intergenic