ID: 1019354418

View in Genome Browser
Species Human (GRCh38)
Location 7:571303-571325
Sequence CCCCGTGCACACCCCGTCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019354418_1019354424 2 Left 1019354418 7:571303-571325 CCGATGACGGGGTGTGCACGGGG 0: 1
1: 0
2: 2
3: 12
4: 68
Right 1019354424 7:571328-571350 CTCCAGGGGTGCTGTTTTGCAGG 0: 1
1: 0
2: 3
3: 16
4: 172
1019354418_1019354427 4 Left 1019354418 7:571303-571325 CCGATGACGGGGTGTGCACGGGG 0: 1
1: 0
2: 2
3: 12
4: 68
Right 1019354427 7:571330-571352 CCAGGGGTGCTGTTTTGCAGGGG No data
1019354418_1019354425 3 Left 1019354418 7:571303-571325 CCGATGACGGGGTGTGCACGGGG 0: 1
1: 0
2: 2
3: 12
4: 68
Right 1019354425 7:571329-571351 TCCAGGGGTGCTGTTTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019354418 Original CRISPR CCCCGTGCACACCCCGTCAT CGG (reversed) Intronic
901305122 1:8227230-8227252 CTCCGTGCACAGCCAGTCCTTGG - Intergenic
901671126 1:10856905-10856927 CCCCCTGCTCACCCCCTCCTGGG + Intergenic
902329747 1:15725462-15725484 CCCCGTGCACACCACCTCTCAGG + Exonic
902519071 1:17005579-17005601 CCCCGTTCCCACCCCGACCTGGG - Intronic
904494805 1:30880550-30880572 CCCCCTGCACACCCTGCCATTGG - Intronic
904858856 1:33520116-33520138 CCACGTGCACACTCAGTCCTTGG + Intronic
905890905 1:41517809-41517831 CCCCGTACACACCCCGGCCATGG - Intronic
908823858 1:68115098-68115120 CCCCCACCACACCCGGTCATGGG + Intronic
910978264 1:92931303-92931325 CCATGTGCAGACCCCATCATTGG + Intronic
912232848 1:107815870-107815892 CCCCCTCCACACCCCGCCACGGG - Intronic
922590256 1:226770088-226770110 ACCCGTCCACTCCACGTCATGGG - Intergenic
1071154462 10:82673037-82673059 CACCGTGCCCAGCCCTTCATGGG + Intronic
1071420467 10:85492308-85492330 CCCCTCGCACCCCCCTTCATAGG + Intergenic
1076841381 10:133047566-133047588 CCCAGTGCACACCCGGCCCTCGG + Intergenic
1077414921 11:2420484-2420506 GGCCGTGCACACCACGCCATGGG + Intronic
1091397730 12:163923-163945 CCCTGTGCACTCCCTGTCCTGGG - Intronic
1100460572 12:94795420-94795442 CCCCAGGCACACCCGGACATGGG + Intergenic
1102787423 12:115616233-115616255 CCCCTACCACACCCCATCATTGG + Intergenic
1113962412 13:114133096-114133118 CCCCCTGCAGACCCCAGCATGGG + Intergenic
1113962432 13:114133139-114133161 CCCCCTGCAGACCCCGGCATGGG + Intergenic
1113962451 13:114133181-114133203 CCCCCTGCAGACCCCGGCATGGG + Intergenic
1113962469 13:114133222-114133244 CCCCCTGCAGACCCCGGCATGGG + Intergenic
1113962486 13:114133260-114133282 CCCCCTGCAGACCCCGGCATGGG + Intergenic
1113962504 13:114133299-114133321 CCCCCTGCAGACCCCGGCACGGG + Intergenic
1113962521 13:114133338-114133360 CCCCCTGCAGACCCCGGCACCGG + Intergenic
1113962569 13:114133460-114133482 CCCCCTGCAGACCCCAGCATGGG + Intergenic
1113962586 13:114133498-114133520 TCCCCTGCAGACCCCGGCATGGG + Intergenic
1113962604 13:114133537-114133559 CCCCCTGCAGACCCCGGCATGGG + Intergenic
1113962623 13:114133578-114133600 CCCCCTGCAGACCCCGGCATGGG + Intergenic
1113962640 13:114133617-114133639 TCCCCTGCAGACCCCGGCATGGG + Intergenic
1113962691 13:114133736-114133758 CCCCCTGCAGACCCCGGCATGGG + Intergenic
1113962708 13:114133776-114133798 CCCCTTGCAGACCCCAGCATGGG + Intergenic
1113962725 13:114133816-114133838 CCCCCTGCAGACCCCGGCATGGG + Intergenic
1113962742 13:114133855-114133877 CCCCCTGCAGACCCCAGCATGGG + Intergenic
1128766396 15:70253620-70253642 TCCCGTGCAGCCCTCGTCATGGG + Intergenic
1128769205 15:70269166-70269188 CCCCATGCACACCCCGACATGGG - Intergenic
1132691955 16:1185665-1185687 CCCCGTACACACCCCGCCTCCGG - Intronic
1132692016 16:1185875-1185897 CCCCGTACACACCCCGCCTCCGG - Intronic
1132692031 16:1185921-1185943 CCCCGTACACACCCCGCCTCCGG - Intronic
1132692046 16:1185971-1185993 CCCCGTACACACCCCGCCTCCGG - Intronic
1132692060 16:1186021-1186043 CCCCGTACACACCCCGCCTCCGG - Intronic
1132692075 16:1186067-1186089 CCCCGTACACACCCCGCCTCCGG - Intronic
1132692089 16:1186117-1186139 CCCCGTACACACCCCGCCTCCGG - Intronic
1138840973 16:60505624-60505646 CCCAGTGCAGACCCAGTTATGGG + Intergenic
1140905090 16:79402817-79402839 CCCCATGGACACCCAGGCATGGG - Intergenic
1144846405 17:18221912-18221934 CCCAGTGCATGCCCCATCATAGG + Intergenic
1145033202 17:19520849-19520871 CCCCATGTACACCCCGACAGAGG - Intronic
1148547694 17:48530068-48530090 CCCCATGCACACCAGGTCCTGGG + Intronic
1148565060 17:48627692-48627714 CCCCCTGCAGACCCCTTCATTGG + Intronic
1157466622 18:47952611-47952633 CCCCGTGAGCACCTCCTCATTGG - Intergenic
1162396166 19:10419142-10419164 CCCCGTGCGCCCCCTGTCACGGG - Intronic
1163265269 19:16217080-16217102 CCCCATGCTAACCCCATCATCGG - Intronic
1166395248 19:42434889-42434911 CACCGTGCCCAGCCTGTCATAGG - Intronic
935582120 2:104765449-104765471 CCTCCTGCACATCCCCTCATGGG - Intergenic
938493440 2:131777811-131777833 CCCACTGCACAGCCCCTCATGGG + Intergenic
947418320 2:229921194-229921216 CCCCGCGCAGACCCCGTCTCCGG + Intronic
1176297673 21:5082894-5082916 CCTCGTGGACCCCCCTTCATGGG - Intergenic
1178664954 21:34538496-34538518 CCCCATCCACTCCCCGCCATGGG + Intronic
1179304424 21:40141659-40141681 CCTCCTGCACCCCCCGTCACTGG - Intronic
1179859356 21:44179055-44179077 CCTCGTGGACCCCCCTTCATGGG + Intergenic
1180963060 22:19771085-19771107 GCCCGAGCACACCGCCTCATTGG - Intronic
953185908 3:40638246-40638268 CCCTGTGCACACCCAGCCAGTGG + Intergenic
969995305 4:11306275-11306297 CCCCATGCTCACCCTGTCAATGG + Intergenic
982854597 4:160364764-160364786 CCCACTGCACATCCCTTCATAGG - Intergenic
991615797 5:68496030-68496052 CCCCTTGCACACCCTCTCACAGG + Intergenic
999727293 5:154446883-154446905 CCCCGGGCACTCCCCGCCGTGGG + Intronic
1002282786 5:178142718-178142740 CCACGTGCTCACCCTGTCAATGG - Exonic
1005696982 6:28360632-28360654 CCCTGTGCACACACCCTCAGAGG + Intronic
1006452151 6:34111577-34111599 CCCCATCCACACCCCGGCAGGGG + Intronic
1018845155 6:167551030-167551052 CCCCATACACACCCTGTCCTTGG + Intergenic
1019354418 7:571303-571325 CCCCGTGCACACCCCGTCATCGG - Intronic
1026587157 7:71665263-71665285 CACCGTGCACAACCTCTCATTGG + Intronic
1035247087 7:157569728-157569750 CCCCGTGCAGACGCTGTCACTGG + Intronic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1036169041 8:6465397-6465419 CCCCATGTCCACCCCGTCCTCGG + Intronic
1049189709 8:141280226-141280248 CCCCCTGCCCACCCTGTCCTGGG + Intronic
1049577051 8:143394284-143394306 CCCCGTGGACACCCCGTGATGGG - Intergenic
1050151164 9:2621300-2621322 CCAGGTGCACGCCCCGTCAGTGG + Intergenic
1056938293 9:90934748-90934770 CCCCTTGCTCACCCCGTCCTTGG + Intergenic
1057305820 9:93911382-93911404 CCCTGGGCAGACCCCGTGATGGG + Intergenic
1057339011 9:94182700-94182722 CCCTGTGCACACTCCGGCATGGG + Intergenic
1061540786 9:131277107-131277129 CCCCGCGCCCGCCCCGTCAGTGG + Intergenic
1062471419 9:136707229-136707251 CCCCGTACACGCCCCGCCACTGG + Intergenic