ID: 1019355960

View in Genome Browser
Species Human (GRCh38)
Location 7:579111-579133
Sequence CGCCCGTCCGGGGCCTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019355960_1019355968 8 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355968 7:579142-579164 CAGGGCAGCACTGACTCCAGAGG 0: 1
1: 0
2: 6
3: 68
4: 343
1019355960_1019355969 9 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355969 7:579143-579165 AGGGCAGCACTGACTCCAGAGGG 0: 1
1: 0
2: 2
3: 26
4: 263
1019355960_1019355972 18 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355972 7:579152-579174 CTGACTCCAGAGGGAGGGTGAGG 0: 1
1: 0
2: 4
3: 45
4: 339
1019355960_1019355974 22 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355974 7:579156-579178 CTCCAGAGGGAGGGTGAGGCGGG 0: 1
1: 1
2: 13
3: 140
4: 1146
1019355960_1019355973 21 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355973 7:579155-579177 ACTCCAGAGGGAGGGTGAGGCGG 0: 1
1: 0
2: 7
3: 59
4: 626
1019355960_1019355976 28 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355976 7:579162-579184 AGGGAGGGTGAGGCGGGCAGTGG 0: 1
1: 1
2: 15
3: 212
4: 1691
1019355960_1019355967 -10 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355967 7:579124-579146 CGGACGGGCGTGCGGTCACAGGG 0: 1
1: 0
2: 0
3: 3
4: 42
1019355960_1019355970 12 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355970 7:579146-579168 GCAGCACTGACTCCAGAGGGAGG 0: 1
1: 0
2: 2
3: 28
4: 274
1019355960_1019355971 13 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355971 7:579147-579169 CAGCACTGACTCCAGAGGGAGGG 0: 1
1: 0
2: 3
3: 49
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019355960 Original CRISPR CGCCCGTCCGGGGCCTCCAT GGG (reversed) Intronic
906639424 1:47432839-47432861 CGCCCTTCCGGGCCCTGAATTGG - Intergenic
910289051 1:85582161-85582183 AGGCCGTCCTGGTCCTCCATGGG - Exonic
914490088 1:148146363-148146385 CGCCCGGGCCGGGCCTCCACCGG - Intronic
921163338 1:212488176-212488198 CCCCCGTCCTGGCCCTCCACAGG + Intergenic
1067711759 10:48656059-48656081 CGGCCGCCCGGGGCCTGCCTGGG + Intronic
1073208259 10:101779992-101780014 CGCCCGCCCGGAGCCTCTAGAGG + Intronic
1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG + Exonic
1086728777 11:90222751-90222773 TGCCCCTCCTGGGCCTCCCTTGG - Intronic
1091383652 12:78316-78338 CGCCCCTCCTCGGCCTCCACGGG + Intronic
1092894809 12:13001220-13001242 CGCGCGTCCCGGGCGTCCGTCGG + Intergenic
1104575659 12:129963764-129963786 CTCCCCTGCAGGGCCTCCATGGG - Intergenic
1113082326 13:106533217-106533239 TGCCCGCCCGGTGCCTCCAGAGG - Intronic
1113311690 13:109139477-109139499 CGCACCTCCGCAGCCTCCATGGG + Intronic
1122230756 14:100305529-100305551 CGCCCGCCCGGGCCCTCCCGGGG + Intronic
1122858381 14:104571062-104571084 TGCACGTCCGGGGCCCCCAGAGG - Intronic
1128651184 15:69414694-69414716 CGCCCCGCCTGGGCCTCCAAGGG + Intronic
1132500782 16:283720-283742 CACACGTCAGGGACCTCCATGGG - Intronic
1132884899 16:2178367-2178389 CGCCTGGCCGGGGGCTCCAAGGG - Exonic
1137454725 16:48609732-48609754 CGCGCGCCCGCGGCCTCGATCGG - Intronic
1138443759 16:57050446-57050468 CCCCTCTCCGGGGCCTCCAAGGG - Intronic
1144841200 17:18187098-18187120 CTCCTGTCTGAGGCCTCCATGGG - Intronic
1148081015 17:44967793-44967815 CGGCCCTCCGGGGCCTCCCGGGG - Exonic
1151696688 17:75721559-75721581 CGCCCGTCCTGGACCTACCTCGG - Exonic
1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG + Intergenic
1160354184 18:78213047-78213069 CGCCTGTCAGGTGTCTCCATGGG + Intergenic
1160683785 19:424230-424252 CGCCCGGCTGGGGGCTCCCTCGG + Intronic
1160763698 19:797935-797957 CGCGCGTGCGCGGCCGCCATCGG + Intronic
1162581867 19:11536218-11536240 CGCCCCTCCCGGGCCGCCAGGGG + Intergenic
926171649 2:10556475-10556497 TGCCCATCCCAGGCCTCCATGGG + Intergenic
936077064 2:109408328-109408350 CTCCCGTCCAGGGCCATCATGGG - Intronic
936271643 2:111053781-111053803 CCCCAGCCAGGGGCCTCCATGGG + Intronic
938994771 2:136666449-136666471 TGCCCCTCTGTGGCCTCCATGGG + Intergenic
941979036 2:171434560-171434582 GGCCCGGCCCGCGCCTCCATGGG + Exonic
941992885 2:171574283-171574305 CGCCAGCCCGGGGCCTCCACGGG + Intergenic
949008591 2:241665632-241665654 CTCCCATCCGGGGCCTGCAGTGG + Intronic
1174062016 20:47839533-47839555 TGCCAGTACGGGGTCTCCATAGG + Intergenic
1174194451 20:48763273-48763295 CGCCCATCTGGGGCCTGCATGGG + Intronic
1175539710 20:59740911-59740933 AGGCCGTCCTGGGCCTCCTTGGG + Intronic
1176019842 20:62957002-62957024 CGCCCCACTGGGGCCTCCAGGGG + Intronic
1181334558 22:22118015-22118037 CGCCCGGGCCGGGCCTCCACCGG + Intergenic
955916276 3:63911941-63911963 CGGCCGGCCGGCTCCTCCATAGG + Intronic
977176766 4:93828626-93828648 CGCCTGCCCGCGCCCTCCATTGG + Intergenic
985995552 5:3595387-3595409 CGCGCGGCCGGGGCCTCCAGGGG - Intergenic
994106820 5:95959094-95959116 CTCCCTTCTGGGGCCTCCAGTGG + Intronic
995738090 5:115324905-115324927 AGCCCTTCAGGGGCCTCCATGGG - Intergenic
1002139971 5:177132702-177132724 CGCCCGGCCGTGGCCTCCGCGGG - Intergenic
1003482463 6:6546250-6546272 CGCCTGTCCGCGGCCTAGATGGG + Intergenic
1007431449 6:41779704-41779726 CGCCCGCCCGGGGCTTCCTAGGG + Intronic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1020021806 7:4873745-4873767 CGCCTGTCCTGCGCCTCCCTGGG - Intronic
1020192165 7:6008858-6008880 CGCCACTCCGGGGCCTCCAGGGG + Intronic
1020281794 7:6653592-6653614 CGCGCGTTCGGGCCCGCCATCGG + Exonic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1023623632 7:42095990-42096012 CACCAGTCAGGGGCCTCCAAGGG + Intronic
1029972725 7:104805056-104805078 CTCCCCTCAGGGGCCCCCATAGG + Intronic
1032322248 7:130896077-130896099 GGGCCGTCCAGGGCCTCCACAGG - Intergenic
1049245720 8:141561274-141561296 TGGCCATCCAGGGCCTCCATGGG - Intergenic
1049421450 8:142518399-142518421 GGCCCCTCCGAGGCCTCCACAGG + Intronic
1050552074 9:6757626-6757648 CGCGCGTCGGAGGCCGCCATAGG + Intronic
1057294648 9:93828058-93828080 CGCCCGCCCTGGGCCGCCAGCGG - Intergenic