ID: 1019355960

View in Genome Browser
Species Human (GRCh38)
Location 7:579111-579133
Sequence CGCCCGTCCGGGGCCTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019355960_1019355974 22 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355974 7:579156-579178 CTCCAGAGGGAGGGTGAGGCGGG 0: 1
1: 1
2: 13
3: 140
4: 1146
1019355960_1019355976 28 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355976 7:579162-579184 AGGGAGGGTGAGGCGGGCAGTGG 0: 1
1: 1
2: 15
3: 212
4: 1691
1019355960_1019355969 9 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355969 7:579143-579165 AGGGCAGCACTGACTCCAGAGGG 0: 1
1: 0
2: 2
3: 26
4: 263
1019355960_1019355967 -10 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355967 7:579124-579146 CGGACGGGCGTGCGGTCACAGGG 0: 1
1: 0
2: 0
3: 3
4: 42
1019355960_1019355971 13 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355971 7:579147-579169 CAGCACTGACTCCAGAGGGAGGG 0: 1
1: 0
2: 3
3: 49
4: 298
1019355960_1019355970 12 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355970 7:579146-579168 GCAGCACTGACTCCAGAGGGAGG 0: 1
1: 0
2: 2
3: 28
4: 274
1019355960_1019355973 21 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355973 7:579155-579177 ACTCCAGAGGGAGGGTGAGGCGG 0: 1
1: 0
2: 7
3: 59
4: 626
1019355960_1019355968 8 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355968 7:579142-579164 CAGGGCAGCACTGACTCCAGAGG 0: 1
1: 0
2: 6
3: 68
4: 343
1019355960_1019355972 18 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355972 7:579152-579174 CTGACTCCAGAGGGAGGGTGAGG 0: 1
1: 0
2: 4
3: 45
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019355960 Original CRISPR CGCCCGTCCGGGGCCTCCAT GGG (reversed) Intronic