ID: 1019355968

View in Genome Browser
Species Human (GRCh38)
Location 7:579142-579164
Sequence CAGGGCAGCACTGACTCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 6, 3: 68, 4: 343}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019355961_1019355968 7 Left 1019355961 7:579112-579134 CCATGGAGGCCCCGGACGGGCGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1019355968 7:579142-579164 CAGGGCAGCACTGACTCCAGAGG 0: 1
1: 0
2: 6
3: 68
4: 343
1019355960_1019355968 8 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355968 7:579142-579164 CAGGGCAGCACTGACTCCAGAGG 0: 1
1: 0
2: 6
3: 68
4: 343
1019355955_1019355968 13 Left 1019355955 7:579106-579128 CCCACCCCATGGAGGCCCCGGAC 0: 1
1: 0
2: 1
3: 19
4: 153
Right 1019355968 7:579142-579164 CAGGGCAGCACTGACTCCAGAGG 0: 1
1: 0
2: 6
3: 68
4: 343
1019355964_1019355968 -3 Left 1019355964 7:579122-579144 CCCGGACGGGCGTGCGGTCACAG 0: 1
1: 0
2: 1
3: 3
4: 58
Right 1019355968 7:579142-579164 CAGGGCAGCACTGACTCCAGAGG 0: 1
1: 0
2: 6
3: 68
4: 343
1019355959_1019355968 9 Left 1019355959 7:579110-579132 CCCCATGGAGGCCCCGGACGGGC 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1019355968 7:579142-579164 CAGGGCAGCACTGACTCCAGAGG 0: 1
1: 0
2: 6
3: 68
4: 343
1019355956_1019355968 12 Left 1019355956 7:579107-579129 CCACCCCATGGAGGCCCCGGACG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1019355968 7:579142-579164 CAGGGCAGCACTGACTCCAGAGG 0: 1
1: 0
2: 6
3: 68
4: 343
1019355951_1019355968 23 Left 1019355951 7:579096-579118 CCACAGACCACCCACCCCATGGA 0: 1
1: 0
2: 1
3: 238
4: 724
Right 1019355968 7:579142-579164 CAGGGCAGCACTGACTCCAGAGG 0: 1
1: 0
2: 6
3: 68
4: 343
1019355963_1019355968 -2 Left 1019355963 7:579121-579143 CCCCGGACGGGCGTGCGGTCACA 0: 1
1: 0
2: 0
3: 4
4: 23
Right 1019355968 7:579142-579164 CAGGGCAGCACTGACTCCAGAGG 0: 1
1: 0
2: 6
3: 68
4: 343
1019355953_1019355968 16 Left 1019355953 7:579103-579125 CCACCCACCCCATGGAGGCCCCG 0: 1
1: 0
2: 3
3: 60
4: 464
Right 1019355968 7:579142-579164 CAGGGCAGCACTGACTCCAGAGG 0: 1
1: 0
2: 6
3: 68
4: 343
1019355965_1019355968 -4 Left 1019355965 7:579123-579145 CCGGACGGGCGTGCGGTCACAGG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1019355968 7:579142-579164 CAGGGCAGCACTGACTCCAGAGG 0: 1
1: 0
2: 6
3: 68
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019355968 Original CRISPR CAGGGCAGCACTGACTCCAG AGG Intronic
900543443 1:3215624-3215646 CAGAGGAGCACTGACTCGACAGG - Intronic
900746112 1:4361812-4361834 CAGGGCCACACTCCCTCCAGAGG - Intergenic
901035393 1:6333288-6333310 CAGGGCATCCCTGGCTCCACAGG - Intronic
901628170 1:10635175-10635197 TGGGGCAGCACTGACTCCTGGGG - Intergenic
902147456 1:14415537-14415559 GGGGGCAGCACAGACTTCAGTGG - Intergenic
902659793 1:17893057-17893079 CAGGGCCACACTCCCTCCAGAGG - Intergenic
902676254 1:18010545-18010567 AAGACCAGCACTGACTCCTGTGG + Intergenic
902957910 1:19939152-19939174 CAGGTCAGCAAAGATTCCAGAGG + Intergenic
903101675 1:21035580-21035602 CAGGGCAGCACTGACCCGCTGGG + Intronic
903145565 1:21369893-21369915 CGGTGCAGCTCTGACTCCTGAGG + Intergenic
903768133 1:25747720-25747742 CAGGGCAGCCAGGACTCCAGAGG - Intronic
904425712 1:30421613-30421635 CAGGGCAGAACTGACACCAGAGG + Intergenic
905792398 1:40797193-40797215 CCAGGCAGCACGGAGTCCAGTGG + Intronic
906246922 1:44282849-44282871 CAGGTCAGCACAGTCTGCAGGGG + Intronic
907912667 1:58840521-58840543 CAGGGCAGCACTGGCTACTCTGG - Intergenic
908532236 1:65044821-65044843 CAGGGCATCACAGTCTCCAAGGG - Intergenic
910369324 1:86499089-86499111 CTGGGTAGCAGTGACTCCTGGGG + Intronic
911838544 1:102652168-102652190 CAGGGCCGCACTCTCTCCAGAGG + Intergenic
912558645 1:110534552-110534574 CAGGGCAGCAGTGAGTATAGTGG + Intergenic
914343156 1:146777012-146777034 CAGGGCAGCACAGAGGCCAGTGG - Intergenic
915056043 1:153132100-153132122 CAGGCCAGCTCTGATTCAAGGGG - Intergenic
915119153 1:153617687-153617709 CAGGGCAGCTATGAGTCCAGAGG - Intergenic
915141765 1:153772463-153772485 CAGGGCAGCACCGTCTACACTGG - Intronic
915147028 1:153801399-153801421 CAGGGCAGCAGGGGCTGCAGAGG - Intergenic
915648720 1:157292364-157292386 CAGTGCAGCCCATACTCCAGGGG - Intergenic
916047838 1:161013881-161013903 CAGCGCAGGACTTACTTCAGGGG + Intronic
916117070 1:161494628-161494650 GTGGGCAGCACTGACTATAGTGG + Intergenic
916254700 1:162774843-162774865 CAGGACGGCATTGATTCCAGTGG + Intronic
916699167 1:167273150-167273172 CCGGGCAGCACTGATGCAAGGGG + Intronic
917450412 1:175143179-175143201 CAGGGCAGCTCTTAGTCCCGTGG - Intronic
917927087 1:179798442-179798464 CAGGGCTGCACTGAAGCCACTGG - Intronic
918652692 1:186985247-186985269 CAGGGCAGCATTCAGTTCAGAGG - Intronic
919662126 1:200257484-200257506 CAGGGCTGCACTGGCTCCGGAGG - Intergenic
919772985 1:201174593-201174615 CAGGTCAGGACTGAATACAGTGG - Intergenic
919790822 1:201289776-201289798 CATGTCAGCACTCAATCCAGCGG - Intronic
919979453 1:202633318-202633340 GAGGGCTGCAGTGACTCCAGAGG + Intronic
920721732 1:208393850-208393872 TAGGGCAGCAGTTACTGCAGCGG - Intergenic
921365936 1:214373785-214373807 CAGAGCAGCAGTGACAGCAGAGG - Intronic
922241117 1:223756008-223756030 GAGGGCAGGACTGAGTCCATGGG + Intronic
922372494 1:224925313-224925335 CAGGGCTGCACTGCCTGCAGAGG - Intronic
922410393 1:225368322-225368344 AATGTCAGTACTGACTCCAGAGG + Intronic
922728926 1:227940105-227940127 CAGGGCAGGGCTTATTCCAGGGG - Intronic
922786168 1:228283353-228283375 CAGAGCAGCTCAGGCTCCAGGGG - Intronic
922858343 1:228794404-228794426 CAGGGCTGCACAGCCTCTAGGGG + Intergenic
923539607 1:234878479-234878501 CAGGGCAGCTCTGGGTGCAGGGG - Intergenic
924030880 1:239884407-239884429 CAGGGCCACACTCCCTCCAGAGG - Intronic
924466385 1:244302504-244302526 CCGTGCAGCACTGCCTCCATGGG - Intergenic
1064110545 10:12535030-12535052 CAGGGCAGCAATGTGGCCAGCGG - Intronic
1064145595 10:12823922-12823944 CAGGGCACCACTCACACCCGTGG - Intronic
1065004033 10:21363106-21363128 CAGGGCTGCACTCCCTTCAGAGG - Intergenic
1065974946 10:30833867-30833889 CAGGGTAGCCCCGTCTCCAGAGG + Intronic
1066659774 10:37728115-37728137 CAGTGCTGCACTGCCTGCAGTGG + Intergenic
1067087169 10:43249059-43249081 TAGGGAAGAACTGACCCCAGAGG + Intronic
1067569248 10:47359705-47359727 CAGGGCTGAGCTGACTCCTGGGG - Intergenic
1067778251 10:49178212-49178234 AAGGGCAGCATGGACTACAGGGG - Intronic
1069878059 10:71575095-71575117 CAGGGCAGAACTGGCACTAGTGG - Intronic
1069888308 10:71637686-71637708 GAGGGCAGCACTGACTCTGGGGG + Intronic
1070168080 10:73912971-73912993 AAGGCCAGCACTGACACCATGGG + Exonic
1070362053 10:75700013-75700035 CAGGGCCACACTCCCTCCAGAGG - Intronic
1071404595 10:85317976-85317998 CAGGGCCACACTCTCTCCAGAGG + Intergenic
1073330984 10:102669692-102669714 CAGGCCACCACTGACTCATGTGG - Intergenic
1075245049 10:120813787-120813809 CAGAGCTGCACTGACACCCGTGG + Intergenic
1075245486 10:120818513-120818535 CAGGGCTGCGCTCCCTCCAGAGG - Intergenic
1075341230 10:121648244-121648266 CAGGGCACCAGTGACTGCAGAGG - Intergenic
1075474868 10:122725946-122725968 GAGGGCAGCACTGAGGGCAGGGG - Intergenic
1075724632 10:124605011-124605033 CAGGCCAGCACCGCCTCCTGGGG - Intronic
1076438716 10:130464468-130464490 CAGGGCAGCCCAGCCTCCATGGG - Intergenic
1076651686 10:131994007-131994029 CAGGGCTGCACTCCCTCCAGAGG + Intergenic
1076817185 10:132920761-132920783 GAGGGCGGCACGGGCTCCAGGGG - Intronic
1077055455 11:590207-590229 GAGGGCACCCCAGACTCCAGAGG + Intronic
1077341626 11:2028826-2028848 CAGGGCAGCACTGGTTCCCTTGG - Intergenic
1077551590 11:3202942-3202964 CAGGGCAGCACTGCCCGCCGTGG - Intergenic
1077792277 11:5453898-5453920 CATTGCAGCAATGACTTCAGTGG - Exonic
1080754729 11:35185923-35185945 CTGAGCAGCACTGTCTCAAGCGG - Intronic
1081680309 11:44997989-44998011 CAGGGCAGAGCTTACTCCATGGG - Intergenic
1084371731 11:68749960-68749982 CAGGGCAGAATTCCCTCCAGGGG + Intronic
1084482244 11:69428704-69428726 CAGGGCAGCACTGGCCACACAGG - Intergenic
1084672254 11:70614213-70614235 CAGGGCAGCGCTCCCTCCAGAGG - Intronic
1085407124 11:76269961-76269983 CAGGGCTGCCCAGACCCCAGGGG + Intergenic
1085478565 11:76803856-76803878 CAGGCCAGCCCAGACTCAAGAGG - Intergenic
1085532383 11:77199598-77199620 CTGGGCAGGACTGACCCCGGCGG + Exonic
1086001431 11:81990050-81990072 CATGGCCTCACTGACTTCAGAGG + Intergenic
1086006582 11:82045865-82045887 AAGGACAGCACTGAGTTCAGTGG - Intergenic
1086174116 11:83869533-83869555 CAGGGCAGGCCTAACTCCATAGG - Intronic
1088099995 11:106144349-106144371 CAGAGCAGTACTGTTTCCAGTGG - Intergenic
1088326053 11:108602620-108602642 CACTGCAGCCTTGACTCCAGGGG + Intergenic
1090468570 11:126957687-126957709 GAGGTCAGCACTGACTCAACAGG - Intronic
1202824612 11_KI270721v1_random:84015-84037 CAGGGCAGCACTGGTTCCCTTGG - Intergenic
1092225586 12:6746234-6746256 CAGCCCAGCACTTACTCCTGGGG - Intergenic
1093094792 12:14960098-14960120 CAGGCCAACCCTGACTCCAGGGG + Intronic
1093337923 12:17932272-17932294 CAGGGCCACACTCTCTCCAGAGG - Intergenic
1095729670 12:45492981-45493003 CAGGGCCACACTTTCTCCAGAGG + Intergenic
1097307052 12:58081008-58081030 CTGGGCACCACTGCCTCCACTGG - Intergenic
1100010601 12:89948196-89948218 CAGGGAAACACTGAATCCTGGGG + Intergenic
1100371056 12:93969053-93969075 CAGGGCCACACTCCCTCCAGGGG + Intergenic
1101445476 12:104734126-104734148 CTGGTCAGCACTGGCGCCAGAGG + Intronic
1101732355 12:107437244-107437266 CAAGGCAGCACCCATTCCAGAGG + Intronic
1102366218 12:112338094-112338116 CAGGGCTGCACTCCCTCCAGGGG + Intronic
1102920298 12:116786801-116786823 CGGGGCTGCACTGCCTCCGGAGG + Intronic
1103730762 12:123026373-123026395 CAGGGCTGCACTTCCTCCAAAGG - Intronic
1104954159 12:132456358-132456380 CAGGGCAGCTCTGACTGGAGGGG - Intergenic
1105606624 13:21931460-21931482 CAGTTAAGCACTGACTCCGGTGG + Intergenic
1107550033 13:41465362-41465384 CTGAGCAGCACTGACTCAAAGGG - Intronic
1108832888 13:54500568-54500590 CAGGACAACACTGAGTCCACAGG - Intergenic
1109022847 13:57119820-57119842 CAGGGCAGCACTGAGTTCCAAGG + Intergenic
1111549162 13:89784442-89784464 CAGGGCAGCACTGACACACCAGG - Intergenic
1111562404 13:89968040-89968062 CAGGGTAGGCCTGACTGCAGGGG - Intergenic
1112068329 13:95818680-95818702 CAGGGCAGGACTGATTACTGGGG + Intronic
1112589307 13:100749114-100749136 CTGGGCAGCACTGAATCCCTAGG - Intergenic
1112834838 13:103501776-103501798 CAGGGAAGGACTTACTGCAGTGG - Intergenic
1113485273 13:110648467-110648489 CAGCGCAGCACAGACTGCAAGGG + Intronic
1113735302 13:112674184-112674206 CACGGCAGCACTGAGTCTACAGG + Intronic
1113790741 13:113026726-113026748 CAGGAAAGAACTGACCCCAGAGG + Intronic
1115336304 14:32246885-32246907 CAGGGCAGTTCTGTTTCCAGTGG + Intergenic
1117015435 14:51512882-51512904 CATGGCAGCACTGACCACTGAGG + Intronic
1119092668 14:71799307-71799329 CTGGCCAGCACTGACTCCTAGGG + Intergenic
1122266903 14:100550865-100550887 CAGGGAACAACTGACTTCAGGGG - Intronic
1122298172 14:100717172-100717194 CAGAGCTTCACTGAATCCAGTGG - Intergenic
1122716388 14:103699118-103699140 CATGGCTGCACTCACCCCAGCGG + Exonic
1122961287 14:105094591-105094613 CAGGGCAGGAGTGTCTCGAGTGG + Intergenic
1123124643 14:105937725-105937747 CAGGGCAGGATGCACTCCAGAGG - Intergenic
1123578408 15:21695255-21695277 CAGGGCAGGAATGACTCATGTGG + Intergenic
1123615033 15:22137737-22137759 CAGGGCAGGAATGACTCATGTGG + Intergenic
1124495051 15:30181274-30181296 GAGGGCTGCAGTGACTCCAGAGG + Intergenic
1124748518 15:32357371-32357393 GAGGGCTGCAGTGACTCCAGAGG - Intergenic
1125242262 15:37588751-37588773 CAGGGCAGCACTGGCACTGGTGG + Intergenic
1126189216 15:45862289-45862311 CAGGGCATTACTGACCCCTGAGG + Intergenic
1128136944 15:65270864-65270886 TAGGACAGCACTGAATCCAGTGG - Intronic
1128613183 15:69089926-69089948 CAGGGCAGCTCGCAGTCCAGAGG - Intergenic
1128755533 15:70181127-70181149 CTGGGGAGCGCAGACTCCAGTGG + Intergenic
1129028972 15:72604988-72605010 CAAGGCAGCAGTGTGTCCAGAGG - Intergenic
1129387705 15:75204960-75204982 CTGGGCTGCCCTGACTCCTGCGG + Intronic
1129698599 15:77754722-77754744 AAGGGCAGCCCTGACTTCTGAGG - Intronic
1131052345 15:89357266-89357288 GACCACAGCACTGACTCCAGAGG + Intergenic
1132005914 15:98226780-98226802 CAGGGCATCTCTGACTCATGTGG - Intergenic
1202987278 15_KI270727v1_random:429500-429522 CAGGGCAGGAATGACTCATGTGG + Intergenic
1132463992 16:69273-69295 CAGGGCAGGCCTGAGTACAGAGG - Intronic
1132515489 16:363967-363989 CAGGGCAGCTCTGCCTCCTGTGG + Intergenic
1133022630 16:2973662-2973684 CAGGGCTCCCCAGACTCCAGAGG + Intronic
1133228490 16:4354837-4354859 CAGGTCAGCAGTGAGACCAGGGG + Exonic
1133268100 16:4596813-4596835 CAGGGCTGCACTCCCTCCAAAGG + Intronic
1133709026 16:8383120-8383142 CAGGTGAGCACTAAATCCAGGGG + Intergenic
1135255664 16:20939691-20939713 AAGGACAGCCCTGATTCCAGAGG - Intronic
1136389295 16:29952255-29952277 CAGGGCAGCACTGAGTTCACTGG + Intronic
1139990836 16:70938316-70938338 CAGGGCAGCACAGAGGCCAGTGG + Intronic
1141656645 16:85420286-85420308 CAGGGCCACACTCCCTCCAGAGG - Intergenic
1141762175 16:86035844-86035866 CAGGGCTCCACTCCCTCCAGAGG - Intergenic
1141773894 16:86109510-86109532 CAGGACAGTACTCCCTCCAGAGG - Intergenic
1141897899 16:86970368-86970390 CGGGGCTGCACTCCCTCCAGAGG - Intergenic
1142284754 16:89167209-89167231 CAGGCCAGCAGGGACTCCTGAGG - Intergenic
1142699500 17:1650445-1650467 CAGGTCTCCACTGAGTCCAGGGG + Intergenic
1143254562 17:5546067-5546089 TTGGGCAGCAGTGACCCCAGTGG + Intronic
1143309949 17:5979740-5979762 AAGGCCAACACTGACCCCAGAGG - Intronic
1143832821 17:9665927-9665949 CAGGGCTGCACTCCCTCCGGAGG - Intronic
1143847068 17:9780339-9780361 CAGGGTTGCACTGACTCCAGTGG + Intronic
1144363188 17:14516285-14516307 CAGGGAAGTGCTGCCTCCAGGGG + Intergenic
1145416215 17:22715849-22715871 AAGGGGAGCACTGTCTCAAGGGG - Intergenic
1145871488 17:28277153-28277175 CAGGGCAGCATGGGGTCCAGGGG - Intergenic
1146286515 17:31577776-31577798 CAGCCCAGCCCTGGCTCCAGTGG + Intergenic
1147449468 17:40495016-40495038 CAGGGCACCACCGAGTCCAAAGG - Intronic
1147999712 17:44380580-44380602 CAGGTGAGCACTGGCTCCAGGGG - Exonic
1148215295 17:45830791-45830813 CAGTGCAGCCCAGGCTCCAGGGG - Intronic
1149370436 17:55988828-55988850 CAGGGCTGCCCTGATTCCTGTGG + Intergenic
1150265279 17:63828207-63828229 CAGGTGAGGACGGACTCCAGAGG + Exonic
1150441453 17:65194981-65195003 CAGGGGACCCCTGACTCCAGAGG - Intronic
1151102332 17:71570376-71570398 CTGGTCAGCACTGAGTCAAGAGG - Intergenic
1151880701 17:76892899-76892921 CAGGGAAGCACAGACTCCTGGGG + Intronic
1152243838 17:79175131-79175153 CAGGGCAGCGGTGACTCATGGGG + Intronic
1153193317 18:2567031-2567053 AAATGCAGCACAGACTCCAGAGG + Exonic
1154226468 18:12509275-12509297 AAGAGAAGCACTAACTCCAGAGG - Intronic
1154266852 18:12885867-12885889 CAGGGCTGCACTGAAGCCCGGGG + Intronic
1156432711 18:37092718-37092740 CAGCCCATCACTGACACCAGTGG + Intronic
1156589075 18:38465775-38465797 CAGGTCACCACTGACTCTAAGGG - Intergenic
1156675530 18:39523238-39523260 CAGAGAAGCACTGACTACATTGG + Intergenic
1159703945 18:71663624-71663646 CAGGGCTGCACTCCTTCCAGAGG - Intergenic
1160798365 19:955927-955949 CAGGGCTGCGCTCCCTCCAGGGG + Intronic
1160856832 19:1221556-1221578 CAGGGCAGCACTGCCCTCTGGGG - Intronic
1160942298 19:1626104-1626126 CAGGGCAGCCCTGGCTCCCCAGG - Intronic
1161055641 19:2189488-2189510 CAGGGAAGCACTGAGCCCTGAGG - Intronic
1161218180 19:3105132-3105154 CAGGGGAGCACGCACTCCACGGG - Intronic
1161495197 19:4582507-4582529 CAGGACAGCACTCAGTCCAGTGG - Intergenic
1162490137 19:10986818-10986840 GTGGGCAGCCCTGGCTCCAGGGG - Intronic
1164743625 19:30594941-30594963 CAGGGCAGCACTGAGCACACAGG - Intronic
1165700537 19:37933760-37933782 CTGGGCTGCACAGACTGCAGGGG - Intronic
1166148136 19:40851036-40851058 CAGCCCAGCACTGGGTCCAGGGG + Intronic
1167408697 19:49332093-49332115 CAGGGCCACACTCCCTCCAGAGG + Intergenic
1168623468 19:57897634-57897656 CATGGCAGCACTGCCTGCTGTGG - Intronic
925215183 2:2088278-2088300 GAGAGCAGCACTGGCACCAGTGG + Intronic
925348660 2:3187143-3187165 CACAGGAGCACTCACTCCAGGGG + Intergenic
925617170 2:5754504-5754526 GAGAACTGCACTGACTCCAGTGG + Intergenic
925741282 2:7007955-7007977 CAGCCCAGCACTGCCTCCAGAGG + Intronic
928138475 2:28706960-28706982 CAGGGCTGCACTCCCCCCAGAGG - Intergenic
928232521 2:29511278-29511300 CAGGGCAGGATTGACTGCAAAGG - Intronic
928310029 2:30201941-30201963 CAGGCCAGCCCAGACTCAAGGGG - Intergenic
928730565 2:34227017-34227039 CTGGGGAAAACTGACTCCAGTGG + Intergenic
929298603 2:40275786-40275808 CAAGGCAGCACTGACTCTTGAGG + Intronic
929464147 2:42129673-42129695 GAGGGCAGCCCTGAGTCCTGGGG - Intergenic
929567912 2:43001004-43001026 CAGGGCAGCCCAGGCTCGAGAGG - Intergenic
929825595 2:45307133-45307155 CAGGGCCACACTGACTCCTGTGG + Intergenic
930037907 2:47099356-47099378 CAGGGCAGCTCTCACACCTGGGG - Intronic
930632400 2:53767986-53768008 CAGGGCAGCACGGACCACCGCGG + Exonic
931131791 2:59344387-59344409 CAGGGCAGGAGAGACTCCTGAGG + Intergenic
931321464 2:61177664-61177686 CAGGGCAGCCCCGGCTCCCGCGG - Exonic
931343481 2:61425473-61425495 CAGGACAGCACTGAGTTCAGTGG - Intronic
932887520 2:75560840-75560862 CAGGCCAGCCCTGACCCCGGCGG - Intronic
934551425 2:95265115-95265137 CAGGGGAGCATTGACTCCAAAGG - Intergenic
934609289 2:95722729-95722751 CAGAGAAGCACTCACCCCAGGGG + Intergenic
936398589 2:112149174-112149196 AAGGGCAGCCCTGATTGCAGAGG + Intronic
936542618 2:113364306-113364328 CAGAGAAGCACTCACCCCAGGGG + Intergenic
937319636 2:120953379-120953401 CAGGGCCGCACTCCCTCCAGAGG - Intronic
938382379 2:130843842-130843864 CAGGGGGGCCCTGAATCCAGAGG + Intronic
938590271 2:132729093-132729115 TTGGGCAGCACAGACTACAGTGG - Intronic
940461711 2:153972108-153972130 CAGGGCTGCACTCCCTCCAGAGG - Intronic
941031051 2:160512125-160512147 CAGGGCTGCACTCCATCCAGAGG + Intergenic
941041883 2:160632573-160632595 CAGGGCAGCATTGACAACAGAGG - Intergenic
943848593 2:192686722-192686744 CAGGGCTGCACTTTCTCCAGAGG + Intergenic
948567034 2:238893934-238893956 CCGGGGAGAACTGACACCAGGGG - Intronic
948589536 2:239040250-239040272 CAGGGCAGGGCTGAGTCCATGGG - Intergenic
948904928 2:240975239-240975261 CAGGGCAGGCCAGAGTCCAGAGG + Intronic
1168841860 20:914813-914835 CGGAGAAGCACTGACTACAGAGG - Intronic
1169029868 20:2398692-2398714 CAGGCCAGCCCAGACTCAAGAGG + Intronic
1169146954 20:3259005-3259027 CAGGACAGCAAGGGCTCCAGAGG + Intronic
1169953969 20:11080991-11081013 CATGACTGCACTGGCTCCAGCGG - Intergenic
1170263151 20:14435108-14435130 CAGGGCCACACTCACTCCAAAGG + Intronic
1171006222 20:21467881-21467903 CAGGGCAGCAATGACTTCAGGGG + Intergenic
1171387650 20:24780945-24780967 CAAAGCAGCACTGCCCCCAGAGG + Intergenic
1172012745 20:31855842-31855864 CAAGTCATCACTGACTCCAAAGG - Intronic
1172572419 20:35981039-35981061 CAGAGCATCACTGACCTCAGTGG - Intronic
1172591735 20:36122594-36122616 CAGGGCAGCACTGCCTCCTCAGG - Intronic
1174404166 20:50292901-50292923 CAGGGCAGCCCTGACAACTGGGG - Intergenic
1175759208 20:61549994-61550016 CAGGGCTGCAGTGAGTCCCGGGG - Intronic
1175826989 20:61941837-61941859 CAGGGCACCTCTGGCTGCAGTGG - Intergenic
1175848030 20:62069214-62069236 CAGGGCTGCACTCCCTCTAGAGG + Intergenic
1175899487 20:62354409-62354431 CTGGGTAGCACTGACTGCTGGGG - Intronic
1175996082 20:62812921-62812943 CAGGGCTGCACTGCCTCCCCAGG - Exonic
1176376739 21:6090491-6090513 CAGGGCTGCACTCCCTCCAGAGG - Intergenic
1176513585 21:7766930-7766952 CAGGGCAGCACTCTCTCCAGAGG - Intronic
1178328682 21:31666343-31666365 CAGGTCAGCACTTTCTCCATGGG + Intronic
1178647698 21:34397454-34397476 CAGGGCAGCACTCTCTCCAGAGG - Intronic
1179167553 21:38946694-38946716 CAGGACAGCCCTGTCCCCAGGGG + Intergenic
1179521479 21:41948362-41948384 CAGGGCATAAGTGACTCCGGGGG + Intronic
1179568815 21:42265814-42265836 CAGGACACCACTGACTGTAGAGG - Intronic
1179746736 21:43447753-43447775 CAGGGCTGCACTCCCTCCAGAGG + Intergenic
1180155845 21:45977164-45977186 CAGGGCCTCTCTGACTCCTGCGG - Intergenic
1181263010 22:21612226-21612248 CAGGGCAGAACAGTCTCTAGTGG + Intronic
1181308524 22:21930876-21930898 CTGGGCTGCACTGACTGCACTGG + Intronic
1183642193 22:39099571-39099593 CAGAGCAGCTCTGAGCCCAGGGG + Intronic
1183717489 22:39542133-39542155 CAGGGCAGTAATTACTCCACAGG + Intergenic
1184521073 22:44994472-44994494 CAGGGCCGCACTCCCTCCGGAGG - Intronic
1184620326 22:45671902-45671924 CAGGGCAGCGCGGGCTGCAGCGG + Exonic
1184952333 22:47852649-47852671 CAGGGCAACACGGACTTCACTGG + Intergenic
949849238 3:8405316-8405338 TAGGGCTGCACTCCCTCCAGAGG - Intergenic
950714942 3:14841412-14841434 CAGGGCAGCATTTAACCCAGCGG - Intronic
951275477 3:20679926-20679948 CAGCACAGGACTGACTCCTGGGG - Intergenic
952762242 3:36924822-36924844 CAGGGCAGTCCTGTTTCCAGTGG - Intronic
952951618 3:38530132-38530154 CAGTGCTGAACTGAGTCCAGGGG + Intronic
954275101 3:49536783-49536805 CAGGGCAGAGCTGAGGCCAGAGG - Intergenic
954326602 3:49867516-49867538 CAGGGAAGCAGAGCCTCCAGTGG - Intronic
954588823 3:51762556-51762578 CACGGCAGCACGGAGTCCAGGGG + Intergenic
955468190 3:59258101-59258123 CAGGATTGCACTGACTGCAGAGG + Intergenic
957136244 3:76293370-76293392 CTAGGCAGCAATGACACCAGAGG + Intronic
958164506 3:89862386-89862408 CAGGGCAGCCTTGTCTCAAGAGG + Intergenic
960536261 3:118817613-118817635 AAGGCCAGCACTGACCCCTGAGG + Intergenic
961191895 3:124969089-124969111 CGGGGCAGAACTGTCCCCAGTGG + Exonic
961919311 3:130409323-130409345 CAGGGCAGCCCAGGTTCCAGAGG + Exonic
962482122 3:135806883-135806905 CAGGGCCCCACAGACTCCAGGGG - Intergenic
964740418 3:159959646-159959668 CAAGGCAGCATAGACTTCAGTGG - Intergenic
966933556 3:184691271-184691293 CAGGGGAGCCCTGACTGTAGAGG - Intergenic
967826955 3:193884680-193884702 CAGGGCAGCACAGACGAGAGAGG + Intergenic
968027512 3:195454984-195455006 CAGAGAAGGACTGACTACAGTGG + Intergenic
968694860 4:2019242-2019264 CAGGTCAGCACTGCCTTCAGTGG + Intronic
968739782 4:2321690-2321712 GGGGGCAGCCCTGACTCCAGTGG + Intronic
968910361 4:3474159-3474181 CAGGGCAGCTCAGCCCCCAGAGG - Intronic
971487758 4:27177361-27177383 CAGCTCCGCACTGTCTCCAGTGG - Intergenic
973717194 4:53688628-53688650 CAGGGCCGCACTGATTTCAGAGG - Intronic
975376017 4:73646408-73646430 CAGGGCAGCACTGAGTTCAATGG + Intergenic
975988160 4:80225803-80225825 CTGGGCAGCACTGAAGCCACAGG - Intergenic
978536145 4:109765732-109765754 CAGGTCAGCAGTGGCTCAAGCGG + Intronic
978581542 4:110236535-110236557 CAGGGCTTCACTGTCTCCGGAGG + Intergenic
979730953 4:124022009-124022031 CAGGGCCGCCCTGTCTCCAGAGG - Intergenic
980442488 4:132867142-132867164 CAGGGCAGCATTGACTTCAATGG - Intergenic
981568907 4:146131282-146131304 CAGGGCAGCAGTGAAGCCAGGGG - Intergenic
981642420 4:146959860-146959882 GGGAGCAGCAATGACTCCAGGGG - Intergenic
982179185 4:152734167-152734189 CAGGGAAGCAGTGTCACCAGGGG + Intronic
985635081 5:1031871-1031893 CAGGGCAGCACTGACTGAAGGGG + Intronic
985820365 5:2156040-2156062 CAGGGGCGCACTCCCTCCAGCGG + Intergenic
986204575 5:5611288-5611310 CAGGGCAGCCCTGACTGGATGGG + Intergenic
986294166 5:6423519-6423541 CAGGTCAGCAGTGACTCAGGAGG - Intergenic
987645781 5:20671283-20671305 CAGAGCTGCCCTGACCCCAGTGG + Intergenic
988612860 5:32744322-32744344 CTGGGCTGCACTGCCTCCAGTGG - Intronic
991957181 5:72006732-72006754 CTGGGAAACACTGACTCCAAAGG - Intergenic
992339211 5:75805171-75805193 CAGGGCCACACTCCCTCCAGAGG - Intergenic
994235708 5:97359380-97359402 CAGGACAGCACTGAGTTCAGTGG + Intergenic
994453251 5:99971049-99971071 CAGGGCTGCACTTCCTCCAAAGG - Intergenic
994742907 5:103643463-103643485 AAGGGCTGCACTGTCTCTAGGGG - Intergenic
995382235 5:111548136-111548158 CAGTGCAGTGCTGGCTCCAGAGG + Intergenic
996192668 5:120564534-120564556 CAAGGCAGCACTGAGTTCAATGG + Intronic
996459426 5:123724756-123724778 CAGAGCAGCAATGACTTCAATGG - Intergenic
996519763 5:124413768-124413790 GATAGCAGCACTGACTCCATAGG + Intergenic
996606095 5:125324658-125324680 AAGGGCAGCACTTACCCCAAAGG + Intergenic
997589551 5:135064433-135064455 AAGGGCAGCCCTGACTGCATGGG + Intronic
997766039 5:136504335-136504357 GAGGGTAGAAGTGACTCCAGAGG + Intergenic
998401469 5:141850971-141850993 CAGGGAAGAAATGGCTCCAGAGG + Intergenic
998404191 5:141864437-141864459 CATGCCAGCACTGAGTCCAGTGG - Exonic
999227783 5:150041570-150041592 CAAGGCAGCTATCACTCCAGTGG + Intronic
999735380 5:154509170-154509192 CAGGGCATAACTGAGTCCACTGG + Intergenic
999855608 5:155589896-155589918 CATGGGAGCGCTGACTGCAGAGG + Intergenic
1000252404 5:159508107-159508129 CAGGGAAGCAATGAATCAAGAGG - Intergenic
1000617630 5:163446439-163446461 CCAGGCAGTTCTGACTCCAGAGG + Intergenic
1000658900 5:163915452-163915474 CTGGGCAGGATCGACTCCAGGGG - Intergenic
1000961389 5:167605517-167605539 CTCAGCAGCAGTGACTCCAGGGG - Intronic
1001282694 5:170398721-170398743 CAGGTCAGGACCGGCTCCAGGGG + Intronic
1001641357 5:173246239-173246261 CAAGTCAGCTCTGACTCCGGCGG + Intergenic
1002122408 5:177015740-177015762 CAGGGAAGCAGTGTCTTCAGGGG - Intronic
1002182478 5:177437974-177437996 AAGGGCAGGACTGGCTCCAGTGG - Intronic
1002458771 5:179362061-179362083 CAGGGCCACACTCCCTCCAGAGG + Intergenic
1004016628 6:11737637-11737659 CAGGGCAGCACTGGGTGAAGAGG + Intronic
1004215059 6:13694718-13694740 CAGGGCGGGACTGAATCCAATGG - Intronic
1004390775 6:15207824-15207846 CAGGGCTGCTCTGTCTACAGAGG + Intergenic
1004487206 6:16077866-16077888 CAGGCAAGAACTGACTCCTGGGG - Intergenic
1004555250 6:16690779-16690801 CCAGGCAGCACTGACTACATTGG - Intronic
1006620166 6:35358319-35358341 CAGGGCCACACTTCCTCCAGAGG - Intronic
1007266398 6:40599619-40599641 CAGCGCAGGACTGTCTCCCGCGG - Intergenic
1007655422 6:43448564-43448586 CTGTGTGGCACTGACTCCAGGGG - Intronic
1007786205 6:44280880-44280902 GAGGGTAGCACTGAACCCAGGGG + Intronic
1008464976 6:51820327-51820349 AAGGCCAGCACAGATTCCAGGGG + Intronic
1008880644 6:56377446-56377468 CAGGACAGCACTGAGTTCAATGG - Intronic
1008977816 6:57448467-57448489 CAGGGAAGCACAGTCTCAAGAGG + Intronic
1009165964 6:60341414-60341436 CAGGGAAGCACAGTCTCAAGAGG + Intergenic
1010009952 6:71038022-71038044 CAGGGCCACACTCTCTCCAGAGG - Intergenic
1012425902 6:99114181-99114203 CAGGGCTGCACTGTCTGCAGAGG + Intergenic
1017622522 6:156314065-156314087 CATGACAGTACTGACTCCATGGG + Intergenic
1017742368 6:157418082-157418104 GATGGCTGCACTGACTCCAGGGG + Intronic
1018604814 6:165585641-165585663 CAGGGCTGCACACCCTCCAGAGG - Intronic
1018684897 6:166296747-166296769 CAGGGCAGAGGTGACACCAGTGG + Intergenic
1018978488 6:168583364-168583386 CAGGGCAGGGCTGAGCCCAGTGG - Intronic
1019355968 7:579142-579164 CAGGGCAGCACTGACTCCAGAGG + Intronic
1019502528 7:1371527-1371549 CAGACCAGAACTGAATCCAGAGG - Intergenic
1019826643 7:3289982-3290004 AAGGCCAGCCCAGACTCCAGAGG - Intergenic
1024381807 7:48705034-48705056 CAGTGCTGCACTTTCTCCAGCGG + Intergenic
1024602025 7:50991146-50991168 CAGGGTAACACTGACTTCATGGG - Intergenic
1024944769 7:54797699-54797721 CAGGGCAGCACAGGCTTCAGGGG + Intergenic
1025280310 7:57621979-57622001 CAAGGCAGCAGTGACCTCAGGGG - Intergenic
1025304423 7:57843522-57843544 CAAGGCAGCAGTGACCTCAGGGG + Intergenic
1026534455 7:71228538-71228560 CAGGGCTGCACTCCCTCCAGAGG + Intronic
1027669402 7:81077299-81077321 CTGGGCAGCAATCCCTCCAGGGG + Intergenic
1029257323 7:99278354-99278376 GAGCCCAGCCCTGACTCCAGGGG - Intergenic
1029379258 7:100202039-100202061 CAGGTGAGTACTGACTCAAGTGG + Exonic
1029599873 7:101557454-101557476 CAGGGCAGCAAGGACCCCATCGG - Exonic
1030084227 7:105803360-105803382 CAGGGGAGCACTGACTCATGGGG - Intronic
1030934881 7:115573245-115573267 CAGGGAAGTACTGACTCTGGCGG - Intergenic
1031967432 7:128037189-128037211 CAGGGCTGCACTCCCTCCAGAGG + Intronic
1032850512 7:135791014-135791036 CAGGTCACCACTGAGTCAAGTGG - Intergenic
1034233533 7:149551070-149551092 CAGTGCAGCAAACACTCCAGGGG + Intergenic
1034908333 7:154971070-154971092 CAGGACAGCACAGAGGCCAGAGG + Intronic
1035311589 7:157973070-157973092 CAGGGCCCCACTGAAGCCAGGGG + Intronic
1036407697 8:8469740-8469762 CAGGGCCGCACTGCCTCAGGAGG - Intergenic
1037589876 8:20303688-20303710 CAGGGCAGCAGACCCTCCAGGGG + Intronic
1037974027 8:23196812-23196834 CATGGCACCACTGACTTCAGTGG - Intronic
1038644404 8:29350623-29350645 CAGGGCAGCGCTGGCGCCAGTGG - Exonic
1039563169 8:38529243-38529265 CAAGGAAGCAGAGACTCCAGTGG - Intergenic
1039568248 8:38566041-38566063 CAGGGCTGAACCGACTCCAGAGG - Intergenic
1040340505 8:46438172-46438194 CAGGGCTGCAGAGACTCAAGGGG - Intergenic
1040351091 8:46569188-46569210 GAGGGCAGCACTGTTTCCTGGGG - Intergenic
1041141142 8:54820559-54820581 CAGGGCAGCACTGAGTTCCATGG + Intergenic
1043355593 8:79408505-79408527 CAGGGAAGCAGAGACTCCAATGG + Intergenic
1043857881 8:85282444-85282466 AAGGGCAGCTCTGACTGCACTGG - Exonic
1044497325 8:92902354-92902376 CAGGGCAGCACTGAGTTCCAAGG + Intronic
1045496531 8:102714229-102714251 CAGGGCTGCACTGCCTCCGAAGG + Intergenic
1045525985 8:102941649-102941671 CAGGACAGCACTGGCTACACTGG + Intronic
1045815233 8:106270568-106270590 GAGGGCAGAACTAGCTCCAGCGG + Intronic
1047644123 8:126851704-126851726 CACAGCAACACTGACCCCAGAGG - Intergenic
1048996880 8:139799992-139800014 AAGGGCAGGACTAGCTCCAGAGG + Intronic
1049296190 8:141840872-141840894 CAGGGCAGGGCTGACCCCAGAGG - Intergenic
1049386419 8:142345110-142345132 CAGGGCTGCACTGGCAACAGTGG + Intronic
1049433123 8:142574393-142574415 CAATCCAGCACTGACTCCCGAGG - Intergenic
1049695927 8:143984285-143984307 AAGGGCAGCACCTTCTCCAGGGG - Exonic
1050259406 9:3825818-3825840 CAGGGCTGCACTGGGTCCTGTGG + Intronic
1050547951 9:6724956-6724978 CAGGACTGCACTCCCTCCAGAGG + Intronic
1050775413 9:9253875-9253897 CAGGGCTGCACTTCCTGCAGAGG + Intronic
1050829935 9:9998219-9998241 GAGGGCAGTTCTGTCTCCAGTGG - Intronic
1052301599 9:26958437-26958459 CAGGGCATCACTGACTCAGGTGG - Intronic
1055816186 9:80209773-80209795 CAGGGCAGGACACACTCTAGCGG - Intergenic
1056306699 9:85297925-85297947 TAGGGCTGCACTCCCTCCAGAGG + Intergenic
1056549820 9:87642996-87643018 CAGAGAAGCACAGACTGCAGGGG - Intronic
1056646880 9:88420439-88420461 CTGGGTAGCACAGAATCCAGAGG + Intronic
1056676899 9:88683487-88683509 CAGAGCACCACTGACTCCTGGGG - Intergenic
1057007087 9:91569865-91569887 CAGGGCTGCACTTCCTGCAGAGG - Intronic
1059232009 9:112729265-112729287 CAGGGCCACACTTTCTCCAGAGG - Intergenic
1059453980 9:114388165-114388187 CTGGGCAGCGCTGACTGCGGAGG - Intronic
1060322223 9:122573050-122573072 CAGGGAGGCCCTGACTCAAGTGG + Intergenic
1060968277 9:127723681-127723703 CCTGGCAGGAGTGACTCCAGGGG + Intronic
1061638143 9:131928585-131928607 CAGGGCAGCACTGAGTTCAATGG - Intronic
1061814929 9:133188881-133188903 CAGGCCACCCCAGACTCCAGGGG - Intergenic
1061846055 9:133389003-133389025 CAGGGTGGCCCTGAATCCAGGGG + Intronic
1062457561 9:136646705-136646727 CAGGGCAGCCAGGACCCCAGGGG - Intergenic
1062599707 9:137314372-137314394 CACCCCAGCACTGTCTCCAGTGG - Intronic
1062624703 9:137437472-137437494 CAGGGCCGCACCCCCTCCAGAGG - Intronic
1185456575 X:313790-313812 CAGGGCTGCGCTCCCTCCAGGGG - Intronic
1185918586 X:4063606-4063628 CAGGGCCACACTCCCTCCAGGGG - Intergenic
1186971873 X:14854828-14854850 CAGGGTAGTATTGACTCCAGGGG - Intronic
1187088953 X:16073601-16073623 CAGGGCCACACTCACTCCAAAGG - Intergenic
1187134152 X:16530399-16530421 CTAGGCAGCACTGATTTCAGGGG - Intergenic
1187580455 X:20602161-20602183 CAGAGCAGCCCTGCCTTCAGAGG + Intergenic
1187710022 X:22043955-22043977 CAGGGCTGCACTTTCTGCAGGGG - Intronic
1190455051 X:50618880-50618902 CAGGGAAGCAGGGACTCCTGGGG + Intronic
1192164702 X:68820700-68820722 CTGGGCACCATTGACTCCAGTGG + Intergenic
1192632344 X:72787120-72787142 CAGGGCAGCAGTGCCATCAGGGG + Intronic
1192649365 X:72933681-72933703 CAGGGCAGCAGTGCCATCAGGGG - Intronic
1193413602 X:81195645-81195667 TTGGGTATCACTGACTCCAGAGG - Intronic
1195175579 X:102312306-102312328 CAGGGCAGCCCCGGCTCCAGTGG - Intronic
1195183285 X:102374787-102374809 CAGGGCAGCCCCGGCTCCAGTGG + Intronic
1198687673 X:139244760-139244782 CAGGGCTGCACTTCCTCCAGAGG - Intergenic
1199592221 X:149477881-149477903 CAGGGGACCACTGAGTGCAGTGG + Intergenic
1200050984 X:153431610-153431632 CAGGGCTGCGCTCCCTCCAGAGG - Intergenic
1200145472 X:153924156-153924178 CAGGGCAGGGCAGGCTCCAGAGG - Intronic
1200592137 Y:5087912-5087934 CAGAACAGCACTGAGTTCAGTGG + Intronic
1200967725 Y:9113876-9113898 CAGAGCAGCAGTGGCTCCAAAGG - Intergenic