ID: 1019355969

View in Genome Browser
Species Human (GRCh38)
Location 7:579143-579165
Sequence AGGGCAGCACTGACTCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 263}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019355959_1019355969 10 Left 1019355959 7:579110-579132 CCCCATGGAGGCCCCGGACGGGC 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1019355969 7:579143-579165 AGGGCAGCACTGACTCCAGAGGG 0: 1
1: 0
2: 2
3: 26
4: 263
1019355955_1019355969 14 Left 1019355955 7:579106-579128 CCCACCCCATGGAGGCCCCGGAC 0: 1
1: 0
2: 1
3: 19
4: 153
Right 1019355969 7:579143-579165 AGGGCAGCACTGACTCCAGAGGG 0: 1
1: 0
2: 2
3: 26
4: 263
1019355953_1019355969 17 Left 1019355953 7:579103-579125 CCACCCACCCCATGGAGGCCCCG 0: 1
1: 0
2: 3
3: 60
4: 464
Right 1019355969 7:579143-579165 AGGGCAGCACTGACTCCAGAGGG 0: 1
1: 0
2: 2
3: 26
4: 263
1019355960_1019355969 9 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355969 7:579143-579165 AGGGCAGCACTGACTCCAGAGGG 0: 1
1: 0
2: 2
3: 26
4: 263
1019355961_1019355969 8 Left 1019355961 7:579112-579134 CCATGGAGGCCCCGGACGGGCGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1019355969 7:579143-579165 AGGGCAGCACTGACTCCAGAGGG 0: 1
1: 0
2: 2
3: 26
4: 263
1019355956_1019355969 13 Left 1019355956 7:579107-579129 CCACCCCATGGAGGCCCCGGACG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1019355969 7:579143-579165 AGGGCAGCACTGACTCCAGAGGG 0: 1
1: 0
2: 2
3: 26
4: 263
1019355963_1019355969 -1 Left 1019355963 7:579121-579143 CCCCGGACGGGCGTGCGGTCACA 0: 1
1: 0
2: 0
3: 4
4: 23
Right 1019355969 7:579143-579165 AGGGCAGCACTGACTCCAGAGGG 0: 1
1: 0
2: 2
3: 26
4: 263
1019355951_1019355969 24 Left 1019355951 7:579096-579118 CCACAGACCACCCACCCCATGGA 0: 1
1: 0
2: 1
3: 238
4: 724
Right 1019355969 7:579143-579165 AGGGCAGCACTGACTCCAGAGGG 0: 1
1: 0
2: 2
3: 26
4: 263
1019355964_1019355969 -2 Left 1019355964 7:579122-579144 CCCGGACGGGCGTGCGGTCACAG 0: 1
1: 0
2: 1
3: 3
4: 58
Right 1019355969 7:579143-579165 AGGGCAGCACTGACTCCAGAGGG 0: 1
1: 0
2: 2
3: 26
4: 263
1019355965_1019355969 -3 Left 1019355965 7:579123-579145 CCGGACGGGCGTGCGGTCACAGG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1019355969 7:579143-579165 AGGGCAGCACTGACTCCAGAGGG 0: 1
1: 0
2: 2
3: 26
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019355969 Original CRISPR AGGGCAGCACTGACTCCAGA GGG Intronic
901040276 1:6359306-6359328 AGGCCAGCAAGGACTCCAGCAGG + Intronic
901403786 1:9032395-9032417 ATGGCAGCAGCCACTCCAGACGG - Intergenic
902147455 1:14415536-14415558 GGGGCAGCACAGACTTCAGTGGG - Intergenic
902676255 1:18010546-18010568 AGACCAGCACTGACTCCTGTGGG + Intergenic
903145566 1:21369894-21369916 GGTGCAGCTCTGACTCCTGAGGG + Intergenic
904723030 1:32525023-32525045 AGGGCAGCACCGAGTCCTGCTGG + Intronic
904789547 1:33008700-33008722 AGGACAGTTCTGACTCCACAGGG + Intronic
912459812 1:109823092-109823114 AGGCCAGCACAGCCTCTAGAGGG + Intergenic
913445196 1:118943708-118943730 CAGGAAGCCCTGACTCCAGATGG + Intronic
914198583 1:145464817-145464839 AGGGCGGAACTGACTGCAAAGGG - Intergenic
914477690 1:148037952-148037974 AGGGCGGAACTGACTGCAAAGGG - Intergenic
914511175 1:148333799-148333821 AGGGCGGGACTGACTGCAAAGGG - Intergenic
916117071 1:161494629-161494651 TGGGCAGCACTGACTATAGTGGG + Intergenic
917617412 1:176760355-176760377 AGGCCAAGACTGACTCCAGAAGG - Intronic
917628956 1:176874319-176874341 CCAGCAGCACTCACTCCAGAGGG + Intronic
920100820 1:203515961-203515983 AAGGCAGCAGTGAGGCCAGACGG - Intergenic
922476900 1:225912526-225912548 AGGGCAGCAGTGCCTGCACATGG + Intronic
922701226 1:227762274-227762296 GGGGCAGCTGTGCCTCCAGAGGG + Intronic
923142508 1:231172613-231172635 CTGCCAGCACTCACTCCAGAAGG + Intronic
924490924 1:244536534-244536556 AGGGCAGCACTGAATTCCGACGG + Intronic
924877017 1:248116732-248116754 AGGGCAGCACTTATTTCAGATGG - Intergenic
1064632025 10:17326212-17326234 AGGGCAGCATTAAATCAAGAGGG + Intronic
1066101675 10:32123181-32123203 ATGGCAGCGGTGGCTCCAGATGG + Intergenic
1067038619 10:42936437-42936459 AAGGCAGCAGTGACTCCTGAAGG - Intergenic
1067152457 10:43748174-43748196 AGGGGAGCAGTGAGCCCAGAAGG + Intergenic
1069619304 10:69826676-69826698 AGGGCATCATAGACTCCATATGG + Intronic
1070776723 10:79114059-79114081 GGGGCAGCACTGCCCTCAGAGGG - Intronic
1070834363 10:79438597-79438619 AGGGCACCACTGCCTCCTGGAGG + Intronic
1071092046 10:81930217-81930239 GGGTCTGCACTAACTCCAGATGG - Intronic
1072971461 10:100021084-100021106 ATGGCAGCAGCCACTCCAGATGG + Intergenic
1073180052 10:101578135-101578157 AGGGCAGCTTTGGCTCCACAGGG - Intronic
1074362191 10:112832549-112832571 AGGGCGGCACTGACCCAAGTTGG + Intergenic
1076314560 10:129531452-129531474 AGGGCATCACGGACACCAGGAGG - Intronic
1076335948 10:129706530-129706552 GGAGCAGCACTGTCTGCAGAAGG + Intronic
1076561156 10:131365342-131365364 AAGGCAGCCCTGACTCCTGATGG - Intergenic
1076714109 10:132354622-132354644 CAGGCAGCACTGACTCGGGATGG + Intronic
1077225487 11:1437523-1437545 GGGGCAGAAGTGACCCCAGAGGG - Intronic
1078526573 11:12105992-12106014 AGGGCATTACTGACTTCAGCAGG + Intronic
1079339634 11:19601396-19601418 AGGGCTGCTCTGAGTCCAGGAGG - Intronic
1082984556 11:59157353-59157375 AGGGCTGTACTTTCTCCAGAAGG + Intergenic
1084482243 11:69428703-69428725 AGGGCAGCACTGGCCACACAGGG - Intergenic
1084861750 11:72023308-72023330 AGGATAGAACTGACTTCAGATGG - Intronic
1085203277 11:74714547-74714569 TGGGAAGCAGTGACCCCAGAAGG - Intronic
1086174115 11:83869532-83869554 AGGGCAGGCCTAACTCCATAGGG - Intronic
1086413425 11:86566038-86566060 AGGGCAGCCCTCACTCCAGCAGG - Intronic
1088616107 11:111630317-111630339 AGGGGAGAACTGACTGGAGAGGG + Intronic
1088976035 11:114817297-114817319 AGGTGACCACTGACTCCAGGAGG + Intergenic
1089695185 11:120212145-120212167 AGGGCAGCACTTCTCCCAGAGGG - Intronic
1089995092 11:122899012-122899034 ACGCCAGCACTTCCTCCAGAAGG + Intronic
1090423057 11:126588914-126588936 AGGGCATCAGTCACTCCAGCAGG + Intronic
1091221161 11:133930851-133930873 AGGGCTGCACTGACTTAGGAAGG + Intronic
1092290720 12:7158231-7158253 GGGGCAGGGCGGACTCCAGAGGG - Exonic
1093384122 12:18530271-18530293 ATGGAAGGACTGACTTCAGAAGG - Intronic
1094303852 12:28995870-28995892 AGGGCCCCAGTGACTGCAGATGG + Intergenic
1097106234 12:56627399-56627421 AGGGTTGCAGTGAGTCCAGATGG + Intronic
1097703456 12:62844160-62844182 TGGGCAGCACACACTCCAAATGG + Intronic
1100867308 12:98870541-98870563 AGGGCAGCAGGGAGTCCAGCTGG + Intronic
1101445477 12:104734127-104734149 TGGTCAGCACTGGCGCCAGAGGG + Intronic
1102199832 12:111049637-111049659 AGAACATCACTGAATCCAGATGG - Intronic
1103134780 12:118498057-118498079 AGGGAAGCACCTATTCCAGATGG - Intergenic
1103969478 12:124661034-124661056 AGGGCGGCAGTGTCTGCAGAAGG + Intergenic
1106439880 13:29756950-29756972 AGGGCAGCACTGAGCCACGAGGG - Intergenic
1108542587 13:51457307-51457329 AGGGCAGCAGCCACTTCAGACGG + Intergenic
1108745250 13:53386809-53386831 ACTTCAGCACTGAGTCCAGACGG + Intergenic
1109030169 13:57180204-57180226 ATGGCAGCAGACACTCCAGATGG - Intergenic
1109772517 13:66995383-66995405 AGGGCAGCACGGTCCCCAAATGG + Intronic
1110290095 13:73795485-73795507 ATGGCATCACTGACACCAGAAGG - Intronic
1111237632 13:85430700-85430722 ATGGCAGCAGCCACTCCAGATGG - Intergenic
1112589306 13:100749113-100749135 TGGGCAGCACTGAATCCCTAGGG - Intergenic
1113735303 13:112674185-112674207 ACGGCAGCACTGAGTCTACAGGG + Intronic
1117060643 14:51958932-51958954 AGATCACCAATGACTCCAGACGG + Intronic
1118842201 14:69521770-69521792 TGGGAAGCAATGACTCCAGGTGG - Intronic
1121419973 14:93806402-93806424 AGGGCAGCCCAGAGTGCAGAGGG - Intergenic
1122256512 14:100481616-100481638 AATGCAGGACTGACTCCATATGG - Intronic
1122370805 14:101228000-101228022 TGGGGAGCACAGACTCAAGAGGG + Intergenic
1122905973 14:104801678-104801700 AGGGCAGCCTTGACCCCAAACGG - Exonic
1123122554 14:105924561-105924583 AGGGTGGCATTGCCTCCAGATGG + Intronic
1124495052 15:30181275-30181297 AGGGCTGCAGTGACTCCAGAGGG + Intergenic
1124748517 15:32357370-32357392 AGGGCTGCAGTGACTCCAGAGGG - Intergenic
1125381762 15:39093159-39093181 ATGGCAGCAGCCACTCCAGATGG + Intergenic
1126215087 15:46145803-46145825 ATGGCAGCAGCCACTCCAGATGG - Intergenic
1128270014 15:66300811-66300833 AGGGCCGCACTGACGCCAAATGG + Intronic
1128847704 15:70916625-70916647 ATGGCAGCAGCCACTCCAGATGG - Intronic
1131160079 15:90099977-90099999 AGGGCAGCCCTGACCACAGATGG - Intronic
1132061665 15:98697424-98697446 AGTGCTGCACTGACTCCCCAGGG - Intronic
1132515490 16:363968-363990 AGGGCAGCTCTGCCTCCTGTGGG + Intergenic
1132774393 16:1584129-1584151 AGGGCAGCAAGGGCCCCAGATGG - Intronic
1133572519 16:7055512-7055534 AGGGCAGCACTCTCATCAGAAGG + Intronic
1134061674 16:11202990-11203012 AGGGCAGTGCTGAACCCAGAGGG + Intergenic
1134829105 16:17309176-17309198 AGGACAGCACTCACCCAAGACGG - Intronic
1135094661 16:19555286-19555308 GGGGCAGAAAGGACTCCAGAAGG - Intronic
1136645252 16:31608492-31608514 AGCCCCTCACTGACTCCAGAAGG - Intergenic
1140286873 16:73611293-73611315 AGGGGGTCACTGACTCCTGAGGG + Intergenic
1140507260 16:75481676-75481698 AAGGCAGCATGGGCTCCAGAGGG + Intronic
1141700906 16:85641615-85641637 AGGGCTGCGGTGACTCCAGAAGG + Intronic
1142102395 16:88282228-88282250 AGGGCAGTGCTGGCTCCACAGGG + Intergenic
1143254563 17:5546068-5546090 TGGGCAGCAGTGACCCCAGTGGG + Intronic
1143845061 17:9767640-9767662 AGGGCAGGATTGGCTCCCGAGGG + Intergenic
1147020014 17:37523767-37523789 ATGGCTGCACTGATTCCAGTTGG + Intronic
1147194245 17:38754647-38754669 AGAACAGCAGTGACTGCAGAAGG - Intronic
1147588212 17:41665259-41665281 AGGGCAGCAGGGAGTCCAGGTGG - Intergenic
1147719629 17:42531028-42531050 AAGGCTGCAGTGAGTCCAGATGG - Intergenic
1150265280 17:63828208-63828230 AGGTGAGGACGGACTCCAGAGGG + Exonic
1151880702 17:76892900-76892922 AGGGAAGCACAGACTCCTGGGGG + Intronic
1152536818 17:80955275-80955297 AGCGCAGCAGTGAGCCCAGAAGG + Intronic
1152603907 17:81279204-81279226 CGGGCAGCACTGAGCCCAGGAGG - Intronic
1153784653 18:8523942-8523964 AAGGCAGCATTTTCTCCAGATGG + Intergenic
1154226467 18:12509274-12509296 AGAGAAGCACTAACTCCAGAGGG - Intronic
1154344654 18:13531918-13531940 TGGGAAGCTCTGTCTCCAGAGGG - Intronic
1155399705 18:25424619-25424641 AGAGCAGCATTGGCTCCATATGG - Intergenic
1155730084 18:29146090-29146112 AGCCCAGCACTGGCTACAGAGGG + Intergenic
1155868781 18:30999376-30999398 AGGGTAGCACTGCCACCAAATGG - Intronic
1156493513 18:37510894-37510916 AAGGCAGAGCTGCCTCCAGAAGG - Intronic
1157151394 18:45222302-45222324 AGGTCAGTACTGAGACCAGATGG - Intronic
1157958859 18:52129919-52129941 AGATCAGCTCTGTCTCCAGATGG - Intergenic
1158077624 18:53549055-53549077 AAGAAAGCACTGAATCCAGATGG - Intergenic
1158393739 18:57063769-57063791 AGGGCTTCACTCACCCCAGAAGG - Intergenic
1159038423 18:63299454-63299476 AGGGCAGCAAGGAGGCCAGATGG - Intronic
1160391992 18:78540806-78540828 AGCTCAGCACGGCCTCCAGACGG + Intergenic
1160862977 19:1245407-1245429 CGGGCAACACTGGCTCCAGCTGG + Intergenic
1161215942 19:3095061-3095083 AAGGCAGGGCTGACCCCAGAGGG - Intronic
1161495196 19:4582506-4582528 AGGACAGCACTCAGTCCAGTGGG - Intergenic
1162467071 19:10848773-10848795 TGGGCACAGCTGACTCCAGAGGG - Intronic
1163701007 19:18786506-18786528 AGGGCAGGCCAGACTCCAGCTGG - Intronic
1165329953 19:35135808-35135830 ATGACAGCACTAACTTCAGAGGG - Intronic
1166732267 19:45065681-45065703 AGGGCAGCCCTGACCCCAACAGG - Intronic
1167697558 19:51024270-51024292 GGGGCAGCACAACCTCCAGAAGG - Exonic
1168084384 19:54034718-54034740 ATGGCAGCAGCCACTCCAGACGG + Intergenic
1168438315 19:56340334-56340356 AGGGCAGCTCTCACTGCAGACGG + Intronic
925215184 2:2088279-2088301 AGAGCAGCACTGGCACCAGTGGG + Intronic
925455783 2:4015575-4015597 AGGGAAACACTGACTCCAAATGG - Intergenic
926195135 2:10759122-10759144 AGGGCACCACTGCCTGCAGCCGG + Intronic
926859437 2:17292471-17292493 ATGGCAGCAGCCACTCCAGATGG + Intergenic
928232520 2:29511277-29511299 AGGGCAGGATTGACTGCAAAGGG - Intronic
931141459 2:59462973-59462995 AGGGCAGCAATGACTGCTGAAGG - Intergenic
932453743 2:71832840-71832862 AGGGGAGCACAGCCTTCAGATGG + Intergenic
932818484 2:74880138-74880160 AGGGCAGCACCCACTCCTGCAGG + Intronic
934551424 2:95265114-95265136 AGGGGAGCATTGACTCCAAAGGG - Intergenic
934946572 2:98546828-98546850 AGAGCAGCACAGGCTCCATAAGG - Intronic
935120791 2:100181810-100181832 AGGCCAGCACAGAGTCAAGAAGG + Intergenic
935314150 2:101814988-101815010 GGAGAAGCACTGACTTCAGAGGG - Intronic
937064500 2:119006925-119006947 AGCACAGCAGTCACTCCAGATGG - Intergenic
937333266 2:121045152-121045174 AGGGGAGCACTGAGGCCACAGGG + Intergenic
937789098 2:125939401-125939423 CAGGCAGTCCTGACTCCAGAGGG - Intergenic
938382380 2:130843843-130843865 AGGGGGGCCCTGAATCCAGAGGG + Intronic
938590270 2:132729092-132729114 TGGGCAGCACAGACTACAGTGGG - Intronic
941703468 2:168631944-168631966 AGGGCAGCACTAACTGCTGGTGG + Intronic
942229297 2:173844804-173844826 AGGGCAGGACAGATTCCACAAGG + Intergenic
943179573 2:184525237-184525259 ATGGCAGCAGCGACTTCAGATGG + Intergenic
944022892 2:195126454-195126476 ATGGCAGCAGTTGCTCCAGATGG + Intergenic
944811958 2:203335934-203335956 GGGACAGGACTGACTACAGAGGG - Intronic
947068964 2:226264561-226264583 AGTGATGGACTGACTCCAGATGG - Intergenic
947327465 2:228993314-228993336 ATGGCAGCAACCACTCCAGATGG + Intronic
947989483 2:234475450-234475472 GGGGCAGCACTGAGACCAGCAGG - Intergenic
948010031 2:234645368-234645390 AGGGAAGCAGTGACTACAGAAGG - Intergenic
948262611 2:236615220-236615242 AGGCCACCTCTGACTCCAGGAGG + Intergenic
1170870513 20:20201793-20201815 GTGTCAGCACTGACTGCAGAAGG - Intronic
1171387651 20:24780946-24780968 AAAGCAGCACTGCCCCCAGAGGG + Intergenic
1171438801 20:25145153-25145175 AGAGCAACACTTACTCCAAAAGG + Intergenic
1173925554 20:46778662-46778684 AGGCCAGAGCTGACTCCAGGAGG + Intergenic
1173925568 20:46778726-46778748 AGGCCAGAGCTGACTCCAGGAGG + Intergenic
1173927227 20:46789822-46789844 AGGGCAGCAGTGGCTGCAGCAGG - Intergenic
1174310284 20:49647869-49647891 AAGGCAGCACAGAGTACAGAAGG - Intronic
1174988838 20:55487009-55487031 AGGGCAGCACTGACAACAACAGG + Intergenic
1175308148 20:57992126-57992148 AGGGCAGTACTGACCACAGCAGG + Intergenic
1175996081 20:62812920-62812942 AGGGCTGCACTGCCTCCCCAGGG - Exonic
1176365335 21:6029489-6029511 AGGACAGCACTCCCTCCAGGAGG - Intergenic
1179758183 21:43509056-43509078 AGGACAGCACTCCCTCCAGGAGG + Intergenic
1180948110 22:19707922-19707944 GGGGCAGGACTCACTCAAGACGG + Intergenic
1181383365 22:22524868-22524890 TTGGCAGCACTGTCTCCAGATGG - Intergenic
1183219162 22:36501203-36501225 AAGGCAGAACTGTCCCCAGACGG - Intronic
1184449051 22:44572067-44572089 AGAGCAGAACTGACTCCCGCTGG - Intergenic
1184912607 22:47546459-47546481 ATGGCAGCGATGACTCCATATGG + Intergenic
949560443 3:5196703-5196725 AGAGCAGCAATAACTTCAGAAGG - Intronic
953766230 3:45746183-45746205 ATGGCAGCAGCCACTCCAGACGG - Intergenic
954220115 3:49148281-49148303 AGGACATCACTGAATGCAGATGG + Intergenic
954783288 3:53075627-53075649 AGGGCAGCACACATTCCTGAAGG - Intronic
955397222 3:58566070-58566092 AGGGCAGGGCAGACTGCAGATGG - Exonic
955446618 3:59017875-59017897 AGGACAGAGCTGACACCAGATGG - Intronic
955932160 3:64067962-64067984 GAGGCAGCAGTCACTCCAGATGG + Intergenic
956765211 3:72478962-72478984 AGGGCAGCTCTGGCTTCAGGTGG - Intergenic
958164507 3:89862387-89862409 AGGGCAGCCTTGTCTCAAGAGGG + Intergenic
958675728 3:97265810-97265832 ATGGCAGCAGCGGCTCCAGATGG + Intronic
959312262 3:104754194-104754216 AGAGCAACACTGACTTCAGGAGG + Intergenic
961548531 3:127652855-127652877 TGGACAGCTCTGATTCCAGAGGG - Intronic
962105428 3:132383781-132383803 ATGGCAGCAGCCACTCCAGATGG + Intergenic
962847020 3:139281923-139281945 TGTGCAGCATCGACTCCAGATGG + Intronic
964290761 3:155177927-155177949 ATGGAACCACTGACTCCAGCTGG - Intronic
964400601 3:156293829-156293851 AGAGCAGCACTGTGTCCACAAGG - Intronic
964661273 3:159123248-159123270 AGGGCAGAACTGACTTTAGGTGG - Intronic
965660391 3:171036044-171036066 AGTGAAACACTGACTCCAGGTGG - Intergenic
967054014 3:185812195-185812217 AGGGCTGCTCTGCCTCAAGAAGG + Intronic
967938475 3:194748072-194748094 AAAGCAGCCCTGACTTCAGAGGG + Intergenic
968705887 4:2077306-2077328 ACAGCAGCTCAGACTCCAGAAGG - Intronic
969222455 4:5770114-5770136 AGGGCAGCACTTACTCCCCCTGG + Intronic
969610107 4:8223017-8223039 AGGGCAGCAGGGGCTGCAGAAGG - Intronic
970959491 4:21856412-21856434 ATGGCAGCAGCCACTCCAGATGG - Intronic
972158990 4:36199158-36199180 ATGGCAGCAGCGGCTCCAGATGG + Intronic
973717193 4:53688627-53688649 AGGGCCGCACTGATTTCAGAGGG - Intronic
974683693 4:65195992-65196014 ATGGCAGCAGCCACTCCAGATGG + Intergenic
975209340 4:71680665-71680687 AGGGCAGAACTGATTCTTGAGGG + Intergenic
975743439 4:77452939-77452961 ACGGCAGCTCTGGCTACAGAGGG - Intergenic
975749691 4:77510149-77510171 AGAGCAGCAAAAACTCCAGAAGG + Intergenic
976684256 4:87794022-87794044 AAGGCAGCAGTGACTGAAGAAGG - Intergenic
978285965 4:107076943-107076965 ACTGCAGCACTGAGTTCAGAAGG - Intronic
980738094 4:136917363-136917385 ATGGCAGCAGCCACTCCAGATGG - Intergenic
981113274 4:140959657-140959679 AGGGAAGCAATGGCTCCACATGG + Intronic
981568906 4:146131281-146131303 AGGGCAGCAGTGAAGCCAGGGGG - Intergenic
985952952 5:3237292-3237314 GGGGCTGCACTTGCTCCAGACGG - Intergenic
986347303 5:6846789-6846811 AGGGAAGCCCTGAATCCAAAAGG - Intergenic
986606577 5:9529068-9529090 ATGGTAGCACTGTATCCAGATGG + Intronic
987136188 5:14901653-14901675 AGGGCAGCCTTGCCTGCAGATGG - Intergenic
988727963 5:33942496-33942518 AGGGGGGCACAGATTCCAGAAGG - Intergenic
990183969 5:53192777-53192799 AGGGCTGCACTCCCTCTAGAGGG - Intergenic
990923621 5:60994531-60994553 ATGGCAGCAACCACTCCAGATGG + Intronic
991133417 5:63153137-63153159 AGGAAAGCAATGAGTCCAGATGG - Intergenic
991957180 5:72006731-72006753 TGGGAAACACTGACTCCAAAGGG - Intergenic
992865298 5:80951792-80951814 AGGGCAGGACTGTGGCCAGAAGG + Intergenic
994742906 5:103643462-103643484 AGGGCTGCACTGTCTCTAGGGGG - Intergenic
995521501 5:113011155-113011177 AGGGGTGCACTGACTTTAGAAGG + Intronic
996519764 5:124413769-124413791 ATAGCAGCACTGACTCCATAGGG + Intergenic
996606096 5:125324659-125324681 AGGGCAGCACTTACCCCAAAGGG + Intergenic
997706478 5:135958406-135958428 AGGACGGCACTGGCTTCAGAGGG - Intergenic
998404190 5:141864436-141864458 ATGCCAGCACTGAGTCCAGTGGG - Exonic
1001690600 5:173629854-173629876 AGAGCATCTCTGACTCCAGTAGG - Intergenic
1002182477 5:177437973-177437995 AGGGCAGGACTGGCTCCAGTGGG - Intronic
1002787744 6:417305-417327 AGGGAAGCAATGCCTGCAGAAGG - Intergenic
1003216702 6:4119833-4119855 AGGGAGGGACTGACTACAGAAGG - Intronic
1004390776 6:15207825-15207847 AGGGCTGCTCTGTCTACAGAGGG + Intergenic
1006369390 6:33634570-33634592 AGGGGAGCACGGATTCCGGAGGG - Intronic
1007517972 6:42428739-42428761 AGGTCAGCCCTGACTCCGAAAGG + Intronic
1007649808 6:43412527-43412549 ATGGCAGCGGTGGCTCCAGATGG + Intergenic
1007930632 6:45687439-45687461 AGGGCATGACTGACTCCACCTGG + Intergenic
1008344135 6:50405291-50405313 AGGGGAACCCTGACTCCACAGGG - Intergenic
1014196519 6:118566184-118566206 AGGGAATCATTGACACCAGATGG - Exonic
1017701091 6:157072921-157072943 AAGACAGCACTGACTAGAGAAGG - Intronic
1018004108 6:159604371-159604393 AGGGAAATACTGACTCAAGAGGG - Intergenic
1018096280 6:160389861-160389883 TGGTCAGCACTGGCTCCAGCAGG + Intronic
1019319485 7:409163-409185 AAGGCAGCCCTGCCCCCAGAAGG + Intergenic
1019355969 7:579143-579165 AGGGCAGCACTGACTCCAGAGGG + Intronic
1019438262 7:1032695-1032717 AGGGCACCACTGTCACCTGAGGG - Intronic
1020224198 7:6267005-6267027 AGGGCAGCACTGAGCCATGAGGG - Intronic
1022038017 7:26552283-26552305 AGGAGAGGACTGACTTCAGAAGG + Intergenic
1022495664 7:30851629-30851651 AGGGCAGCCCTGAGAACAGATGG + Intronic
1023522652 7:41064390-41064412 AGGGCAAAACTGAGTCCTGACGG - Intergenic
1023822952 7:43990253-43990275 AGCGCAGCACAGACTACAGACGG - Intergenic
1023947520 7:44815152-44815174 AGGACAGCAGTGCCTCCAGGAGG - Intronic
1027173517 7:75889112-75889134 AGGGCAGCAGTGGCTCCTGCTGG - Intergenic
1028527533 7:91801917-91801939 ATGGCAGCAGCCACTCCAGATGG + Intronic
1031531083 7:122877948-122877970 AGGAAAGCACTGGCTTCAGAGGG - Intronic
1035309111 7:157953524-157953546 AGGGCAGCACAGACAGCAGCCGG - Intronic
1037772110 8:21808313-21808335 AGAGCAGCACTGAATAGAGATGG + Intronic
1037974026 8:23196811-23196833 ATGGCACCACTGACTTCAGTGGG - Intronic
1038061897 8:23923164-23923186 AGGACAGTACTGACTGCAGAAGG - Intergenic
1039568247 8:38566040-38566062 AGGGCTGAACCGACTCCAGAGGG - Intergenic
1040351090 8:46569187-46569209 AGGGCAGCACTGTTTCCTGGGGG - Intergenic
1045815234 8:106270569-106270591 AGGGCAGAACTAGCTCCAGCGGG + Intronic
1046459828 8:114518558-114518580 ACGGCAGCAGTCACTCCAGATGG - Intergenic
1046504129 8:115115166-115115188 ATGGCAGCAGCCACTCCAGAAGG + Intergenic
1047541838 8:125775214-125775236 AGGGCATCTGTGGCTCCAGAAGG - Intergenic
1048430661 8:134367611-134367633 GGGGCAGCAGTGACATCAGAGGG + Intergenic
1048857767 8:138698615-138698637 AGGGCAGCACTCACTGCATGAGG - Intronic
1048860322 8:138720047-138720069 AGGGCAGCAGTCACTCCTGGAGG + Intronic
1049195984 8:141315850-141315872 AGACCAGAACTGACTCCACAGGG - Intergenic
1049296189 8:141840871-141840893 AGGGCAGGGCTGACCCCAGAGGG - Intergenic
1049526579 8:143129881-143129903 TGGGCGGCACAGGCTCCAGAAGG + Intergenic
1049573058 8:143378553-143378575 TGGGCAGCCGTGACTCCCGAAGG - Intronic
1050775414 9:9253876-9253898 AGGGCTGCACTTCCTGCAGAGGG + Intronic
1052759252 9:32572952-32572974 GGGGCAGCACCGGCTCCCGAGGG + Exonic
1053160667 9:35811338-35811360 GGGGCAGTGCTGACTCCAGGAGG + Exonic
1054709068 9:68492696-68492718 AAGGCAGCAGTTACTCCATATGG - Intronic
1057867962 9:98696355-98696377 TGGGCAGGGCAGACTCCAGAGGG + Intronic
1058567625 9:106303513-106303535 AGCCCAGCACTGACAGCAGAAGG - Intergenic
1059453979 9:114388164-114388186 TGGGCAGCGCTGACTGCGGAGGG - Intronic
1060879293 9:127106723-127106745 AGGGCAGCATTGTTTTCAGATGG - Intronic
1061442564 9:130616245-130616267 AGGGCTGCCCTGACTCCCGCAGG + Intronic
1061753825 9:132799005-132799027 TGGGCAGCACTGACTCCTCCCGG + Intronic
1062173521 9:135148374-135148396 AGAGCAGCTCTGAGTCCAGCAGG + Intergenic
1062588640 9:137263253-137263275 AGGGCAGCACTACCTTCAGGAGG - Intronic
1185688107 X:1947270-1947292 AGGGCAGCTCCAAGTCCAGATGG - Intergenic
1188207619 X:27380211-27380233 ATGGCAGCAGCCACTCCAGATGG - Intergenic
1188474232 X:30573420-30573442 AAGTCAGCACTCACCCCAGAGGG + Intronic
1191646578 X:63488173-63488195 AGGGCAGCACTGAGTTCCAATGG - Intergenic
1192267076 X:69546449-69546471 ATGGCAGCAACCACTCCAGATGG - Intergenic
1193108695 X:77705452-77705474 ATGGCAGCAGCCACTCCAGACGG + Intronic
1194436501 X:93873998-93874020 AGGGGAGTACTAACTGCAGATGG + Intergenic
1195175578 X:102312305-102312327 AGGGCAGCCCCGGCTCCAGTGGG - Intronic
1195183286 X:102374788-102374810 AGGGCAGCCCCGGCTCCAGTGGG + Intronic
1196683824 X:118494922-118494944 AGGTCAGCACTGACTGCACCAGG - Intergenic
1196683842 X:118494993-118495015 AGGTCAGCACTGACTGCACCAGG - Intergenic
1199996194 X:153028260-153028282 AGGGCACCTCTGGCTACAGAAGG + Intergenic
1200145471 X:153924155-153924177 AGGGCAGGGCAGGCTCCAGAGGG - Intronic