ID: 1019355970

View in Genome Browser
Species Human (GRCh38)
Location 7:579146-579168
Sequence GCAGCACTGACTCCAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 274}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019355955_1019355970 17 Left 1019355955 7:579106-579128 CCCACCCCATGGAGGCCCCGGAC 0: 1
1: 0
2: 1
3: 19
4: 153
Right 1019355970 7:579146-579168 GCAGCACTGACTCCAGAGGGAGG 0: 1
1: 0
2: 2
3: 28
4: 274
1019355956_1019355970 16 Left 1019355956 7:579107-579129 CCACCCCATGGAGGCCCCGGACG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1019355970 7:579146-579168 GCAGCACTGACTCCAGAGGGAGG 0: 1
1: 0
2: 2
3: 28
4: 274
1019355963_1019355970 2 Left 1019355963 7:579121-579143 CCCCGGACGGGCGTGCGGTCACA 0: 1
1: 0
2: 0
3: 4
4: 23
Right 1019355970 7:579146-579168 GCAGCACTGACTCCAGAGGGAGG 0: 1
1: 0
2: 2
3: 28
4: 274
1019355965_1019355970 0 Left 1019355965 7:579123-579145 CCGGACGGGCGTGCGGTCACAGG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1019355970 7:579146-579168 GCAGCACTGACTCCAGAGGGAGG 0: 1
1: 0
2: 2
3: 28
4: 274
1019355961_1019355970 11 Left 1019355961 7:579112-579134 CCATGGAGGCCCCGGACGGGCGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1019355970 7:579146-579168 GCAGCACTGACTCCAGAGGGAGG 0: 1
1: 0
2: 2
3: 28
4: 274
1019355960_1019355970 12 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355970 7:579146-579168 GCAGCACTGACTCCAGAGGGAGG 0: 1
1: 0
2: 2
3: 28
4: 274
1019355953_1019355970 20 Left 1019355953 7:579103-579125 CCACCCACCCCATGGAGGCCCCG 0: 1
1: 0
2: 3
3: 60
4: 464
Right 1019355970 7:579146-579168 GCAGCACTGACTCCAGAGGGAGG 0: 1
1: 0
2: 2
3: 28
4: 274
1019355959_1019355970 13 Left 1019355959 7:579110-579132 CCCCATGGAGGCCCCGGACGGGC 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1019355970 7:579146-579168 GCAGCACTGACTCCAGAGGGAGG 0: 1
1: 0
2: 2
3: 28
4: 274
1019355951_1019355970 27 Left 1019355951 7:579096-579118 CCACAGACCACCCACCCCATGGA 0: 1
1: 0
2: 1
3: 238
4: 724
Right 1019355970 7:579146-579168 GCAGCACTGACTCCAGAGGGAGG 0: 1
1: 0
2: 2
3: 28
4: 274
1019355964_1019355970 1 Left 1019355964 7:579122-579144 CCCGGACGGGCGTGCGGTCACAG 0: 1
1: 0
2: 1
3: 3
4: 58
Right 1019355970 7:579146-579168 GCAGCACTGACTCCAGAGGGAGG 0: 1
1: 0
2: 2
3: 28
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019355970 Original CRISPR GCAGCACTGACTCCAGAGGG AGG Intronic
900101564 1:964270-964292 GCAGCCCCGACTCCAGGGTGGGG - Intronic
900386410 1:2412903-2412925 GCAGCGCTGTCCCCAGTGGGAGG - Intronic
900771014 1:4544354-4544376 GAAGCACTTCCTCCTGAGGGGGG - Intergenic
901295555 1:8158448-8158470 GCAACACTGCTTCCAGAGTGAGG - Intergenic
901421483 1:9154201-9154223 CCAGCACTGCCACCAGAGGGAGG + Intergenic
901671446 1:10858432-10858454 TCAGCCCTGAATCCACAGGGAGG + Intergenic
902147454 1:14415533-14415555 GCAGCACAGACTTCAGTGGGTGG - Intergenic
904425713 1:30421617-30421639 GCAGAACTGACACCAGAGGCTGG + Intergenic
904501579 1:30915763-30915785 GCAGCACTGACTCCAAAGAGAGG + Intergenic
904863869 1:33561219-33561241 GCAACCCTGACTCCAGTGGAGGG + Intronic
905440987 1:37996546-37996568 GCAGGACGAGCTCCAGAGGGAGG + Intergenic
906113524 1:43339967-43339989 TCAGCTCTGACAGCAGAGGGTGG + Exonic
906127367 1:43435349-43435371 GCAGCACTGCCTTGTGAGGGAGG - Intronic
906172246 1:43736349-43736371 GCTACACTTACTCCAGTGGGAGG + Exonic
906202108 1:43966917-43966939 GCAGCTCTGTCTGCAGAGGATGG - Exonic
906678826 1:47711302-47711324 GGAGCACTGAGTCCAGCGCGGGG + Intergenic
907667940 1:56449784-56449806 AGAGCACAGACTCCAGAGCGAGG - Intergenic
908108867 1:60874911-60874933 GCAGCTGTGAGGCCAGAGGGAGG - Intronic
908240084 1:62181702-62181724 GCAGCACTGCCTGCTGAGGCGGG + Intergenic
908871360 1:68616633-68616655 GCAGTAATTACTCCAGGGGGTGG - Intergenic
914313991 1:146491602-146491624 ACAGAGCTGACTTCAGAGGGAGG - Intergenic
914500356 1:148241778-148241800 ACAGAGCTGACTTCAGAGGGAGG + Intergenic
914769151 1:150668058-150668080 GCAGAACCTAATCCAGAGGGTGG - Intronic
915300463 1:154948465-154948487 TCAGCCCTGACCCCAGAGAGGGG + Intronic
915333558 1:155127994-155128016 GCAGCACAGACCCAAGAGAGGGG - Exonic
918041614 1:180917137-180917159 GCAGGAGGGAATCCAGAGGGAGG + Intronic
919854208 1:201694538-201694560 CCAGCCCTGGCTGCAGAGGGAGG + Intronic
922972481 1:229754623-229754645 GTAGCACTGACTCTCGAGGTTGG + Intergenic
1063018378 10:2101288-2101310 GCAGGACCAACTCCAGAGGTGGG + Intergenic
1064096335 10:12427228-12427250 GAGGGACTGATTCCAGAGGGTGG + Intronic
1064147101 10:12834271-12834293 GCAGGACTGACTTCACAGTGGGG - Exonic
1066347045 10:34597812-34597834 GCATCACTGTCTCCAGAAGCAGG + Intronic
1066662945 10:37754326-37754348 GCAGCACTGTCTTCAGACAGTGG - Intergenic
1068611460 10:59065043-59065065 GCTGCAAAGAATCCAGAGGGAGG - Intergenic
1069062451 10:63908341-63908363 GCAGCACTGGCTTCAAAGTGGGG - Intergenic
1071047449 10:81399345-81399367 CCAGCACATACTCCAGAGGAAGG + Intergenic
1071163538 10:82779106-82779128 GCAGCACGGACCACAGGGGGTGG + Intronic
1072554253 10:96502663-96502685 CCAGCCCTGACTCCACAGGGAGG + Intronic
1072614141 10:97038283-97038305 GTGGCACTGGCTGCAGAGGGAGG - Intronic
1073862605 10:107764741-107764763 CCAGTACTGACTCCAGTGGGGGG + Intergenic
1074178837 10:111038892-111038914 GCAGGACTGACCCCAGACTGTGG - Intergenic
1074368170 10:112876908-112876930 TCAGCAGTGGCTCCACAGGGTGG - Intergenic
1074527787 10:114276931-114276953 GCAGCACTGCCTGCAGACCGTGG + Intronic
1075341228 10:121648240-121648262 GCACCAGTGACTGCAGAGGAGGG - Intergenic
1076263352 10:129089795-129089817 GCAGCAGTGACTGGAGAGCGTGG - Intergenic
1077055457 11:590211-590233 GCACCCCAGACTCCAGAGGTGGG + Intronic
1077061227 11:618736-618758 ACAGCACAGACCCCAGAGGCAGG - Exonic
1078339890 11:10491151-10491173 GCAGCAGTAGCTCCAGAGTGTGG + Intronic
1078653463 11:13216750-13216772 AGATCACTGACTCCAGAGAGGGG + Intergenic
1082243618 11:49894538-49894560 GCTGCACTGTCTGCAGAAGGTGG + Intergenic
1082620772 11:55418894-55418916 GCTGCACTGTCCCCAGAAGGTGG - Intergenic
1082640794 11:55658107-55658129 ACAGCCCTGACTGGAGAGGGTGG + Intergenic
1085472496 11:76767252-76767274 GCAGAACTGACCCCAGCGGTTGG + Intergenic
1085808810 11:79661534-79661556 GCAGCACAGACTCCAGAGCTGGG - Intergenic
1085919874 11:80940335-80940357 GTGGCACTGACTTCAGAGAGGGG - Intergenic
1087775568 11:102253664-102253686 GCAGCTCTCACTCAAGAGGAAGG + Intergenic
1087946284 11:104164206-104164228 GCAGCACAGGCTGCAGGGGGCGG + Intronic
1088561538 11:111120644-111120666 GCAGCACTGAGTCTTGAGGTAGG - Intergenic
1089695184 11:120212142-120212164 GCAGCACTTCTCCCAGAGGGAGG - Intronic
1089980331 11:122766849-122766871 GCACAACTGAGTCCAGAGGTAGG - Intronic
1090406545 11:126479181-126479203 CCAGCACTGACTACAGTGGAGGG + Intronic
1091112326 11:132981364-132981386 GCAGCACTGGGTCCTGAAGGCGG + Intronic
1091673020 12:2466745-2466767 GCAGGACAAAGTCCAGAGGGAGG - Intronic
1096154602 12:49334990-49335012 GCTGCACAGGCTGCAGAGGGAGG - Intronic
1096877287 12:54639781-54639803 GAAGCAGAGACTCCAAAGGGAGG + Intergenic
1098981648 12:76962818-76962840 GCAACACTCACTCGAGAGGATGG - Intergenic
1099503669 12:83446439-83446461 TCAGCTGTGACTTCAGAGGGTGG + Intergenic
1100140446 12:91612479-91612501 GCAGCACTAAATTCAGAGAGAGG + Intergenic
1101986141 12:109448808-109448830 ACAGCACACGCTCCAGAGGGCGG + Exonic
1102079469 12:110086317-110086339 TCAGCACTTACTCAAGATGGAGG + Intergenic
1102116042 12:110403657-110403679 GCAGCACTGACTCGAAAAGCCGG + Exonic
1103242922 12:119429777-119429799 GCCCCACTGACTGCAGGGGGTGG + Intronic
1103704920 12:122866183-122866205 ACAGCACGGACACCCGAGGGGGG + Exonic
1103721159 12:122976289-122976311 CCACCACTGACTCCAGGGGAAGG - Exonic
1104825774 12:131708609-131708631 GCAGGACTGAGTCCAGTAGGAGG - Intergenic
1105988263 13:25590911-25590933 GAAGCACTCACGCCAGAGGGTGG - Intronic
1107391606 13:39970574-39970596 GAGGCACTGACTACAAAGGGCGG + Intergenic
1107964101 13:45584340-45584362 GGACCTATGACTCCAGAGGGTGG - Intronic
1110220954 13:73072698-73072720 GGAGCACATACTCCAGAGCGAGG - Intronic
1113735304 13:112674188-112674210 GCAGCACTGAGTCTACAGGGTGG + Intronic
1113822604 13:113225715-113225737 GCAGCTCTGACTCCAGGAGCTGG - Intronic
1117781582 14:59238494-59238516 CCAGGACTGTCTCCAGAGGGTGG - Intronic
1118964513 14:70567427-70567449 GCAGCACTGATTGCTGAAGGAGG + Intergenic
1122060455 14:99133631-99133653 GGAGCGCTGAGTGCAGAGGGTGG - Intergenic
1122829935 14:104390939-104390961 GAAGAAGCGACTCCAGAGGGAGG + Intergenic
1122941244 14:104982324-104982346 GCATCCCTGCCTGCAGAGGGTGG - Intergenic
1202902208 14_GL000194v1_random:50458-50480 ACAGCTCTGACTCCAGGGTGTGG + Intergenic
1124496854 15:30192378-30192400 GCAGTACGGACTGCAGAAGGGGG - Intergenic
1124746722 15:32346269-32346291 GCAGTACGGACTGCAGAAGGGGG + Intergenic
1125672697 15:41485342-41485364 GAAACCCTGACTCCAGATGGAGG + Intergenic
1125722516 15:41852075-41852097 CCAGCACTGGCTCCAGGGTGTGG + Intronic
1125766074 15:42137421-42137443 GAAGCGCTGAGGCCAGAGGGAGG + Intergenic
1125769666 15:42156629-42156651 GCAGCACTGAGTTGGGAGGGTGG + Exonic
1126683669 15:51228230-51228252 GCAGCTCTGACTCCAGTAGTGGG - Intronic
1126797178 15:52268956-52268978 GCAGCACTGACTTCCTAGGGTGG + Intronic
1127207720 15:56737648-56737670 GAAGTGTTGACTCCAGAGGGTGG - Intronic
1127640966 15:60915373-60915395 GCAGCACTGATTCCACTGGGGGG + Intronic
1127739866 15:61892370-61892392 GCAGTACTGTCTCCAGTGGTGGG - Intronic
1129672024 15:77612846-77612868 GCAGCACTGGCTGGAGAAGGGGG - Intergenic
1130257919 15:82334313-82334335 GCAGCACTGGGTGCAGACGGTGG - Intergenic
1130496760 15:84473592-84473614 GGAGCACTGGCTGCAGGGGGGGG - Intergenic
1133099539 16:3470722-3470744 GAACCCCTGACTCTAGAGGGAGG + Intronic
1134061675 16:11202993-11203015 GCAGTGCTGAACCCAGAGGGAGG + Intergenic
1134514259 16:14874031-14874053 GCTACAGTGACCCCAGAGGGGGG - Intronic
1134514278 16:14874107-14874129 GCTGCAGTGACCCCAGAGGGGGG - Intronic
1134701899 16:16272529-16272551 GCTACAGTGACCCCAGAGGGGGG - Intronic
1134701955 16:16272755-16272777 GCTGCAGTGATCCCAGAGGGGGG - Intronic
1134969876 16:18521895-18521917 GCTGCAGTGATCCCAGAGGGGGG + Intronic
1134969932 16:18522121-18522143 GCTACAGTGACCCCAGAGGGGGG + Intronic
1135060435 16:19266901-19266923 GCAGCAATGACTTCATCGGGAGG + Exonic
1135094660 16:19555283-19555305 GCAGAAAGGACTCCAGAAGGCGG - Intronic
1135464511 16:22673669-22673691 ACAGCAGTGACTGCAGAGGGAGG - Intergenic
1139664858 16:68448342-68448364 GCAGCACTGACCTCTGACGGCGG + Exonic
1140350369 16:74256815-74256837 GCAGCACTCAGCCCAGAGGAGGG - Intergenic
1140507261 16:75481679-75481701 GCAGCATGGGCTCCAGAGGGAGG + Intronic
1140514349 16:75531438-75531460 GCAGCATGGGCTCCAGAAGGAGG + Exonic
1140833794 16:78775033-78775055 ACAGCCCTCACTCCTGAGGGTGG + Intronic
1141893824 16:86945657-86945679 GAAGCACGGAGTCCAGAGGAAGG + Intergenic
1142212802 16:88816424-88816446 CCACCACTGAGTCCAGAGGCGGG + Intronic
1142286360 16:89173112-89173134 CCACCACTGTCTCCAGATGGGGG - Intronic
1142620619 17:1163466-1163488 ACAGCACTGAATCCAGACGCAGG + Intronic
1142620637 17:1163567-1163589 ACAGCACTGAATCCAGACGCAGG + Intronic
1142620654 17:1163668-1163690 ACAGCACTGAATCCAGACGCAGG + Intronic
1142620670 17:1163769-1163791 ACAGCACTGAATCCAGACGCAGG + Intronic
1142620687 17:1163870-1163892 ACAGCACTGAATCCAGACGCAGG + Intronic
1142620703 17:1163971-1163993 ACAGCACTGAATCCAGACGCAGG + Intronic
1142620720 17:1164072-1164094 ACAGCACTGAATCCAGACGCAGG + Intronic
1142620737 17:1164173-1164195 ACAGCACTGAATCCAGACGCAGG + Intronic
1142620755 17:1164278-1164300 ACAGCACTGAATCCAGACGCAGG + Intronic
1142620771 17:1164379-1164401 ACAGCACTGAATCCAGACGCAGG + Intronic
1142673632 17:1499721-1499743 GCAGCTCTGACTCCTGGAGGTGG + Intronic
1143125039 17:4636551-4636573 CCAGCACTGACCCCAGGAGGAGG - Intronic
1143403472 17:6660606-6660628 CCAGCACTGACCCCAGGAGGAGG + Intergenic
1143575223 17:7788354-7788376 GGAGCAGAGACTCCAGGGGGAGG + Intronic
1144172331 17:12670133-12670155 GCAGCAGAGGCTCCAGAGGTTGG + Intronic
1144701943 17:17346096-17346118 CCATCACTGCGTCCAGAGGGTGG + Intronic
1145019084 17:19415996-19416018 GCTGCACTGGCTGCAGAGGCTGG + Exonic
1145241269 17:21242154-21242176 TTAGCACTGACACAAGAGGGCGG + Exonic
1146496837 17:33330156-33330178 GCAGCACTGACTTCAGCAGCAGG - Intronic
1147967312 17:44200105-44200127 GCAGCATTTGCTCCAGGGGGCGG + Intronic
1148582949 17:48756067-48756089 GAAGCAAAGACTCCAGAGTGGGG - Intergenic
1151880703 17:76892903-76892925 GAAGCACAGACTCCTGGGGGTGG + Intronic
1152385355 17:79970897-79970919 GCATCTCTGTTTCCAGAGGGTGG - Intronic
1152525266 17:80884781-80884803 GCAGCTCAGACTGCAGAGGCGGG - Intronic
1152735328 17:81994467-81994489 GCAGCACTGGCTCCGGAATGCGG - Intronic
1152946586 17:83200980-83201002 CCAGCACAGACTCCCCAGGGAGG - Intergenic
1153949399 18:10045513-10045535 GCCGCACTGACTCTCCAGGGGGG + Intergenic
1154311923 18:13273629-13273651 GCAGGACTCACTCCAGCTGGTGG - Intronic
1156070503 18:33201562-33201584 GGAGCACAGACTTCAGAGGCGGG + Intronic
1157033545 18:43943240-43943262 TCAGCACTGACACCACAGAGAGG + Intergenic
1157669614 18:49517313-49517335 CCAGCTCTGACCCCAGAGTGAGG + Intergenic
1161039693 19:2103631-2103653 GCAGCACTGACAGGAGAGGCTGG + Intronic
1161578114 19:5065964-5065986 TCAGCACCGAGACCAGAGGGTGG - Intronic
1161800413 19:6414399-6414421 GCTGCCCTGTCTCCGGAGGGCGG + Intronic
1162874109 19:13608129-13608151 ACTGCACTGACTGCAGAGGAGGG - Intronic
1163550634 19:17964727-17964749 GCAGGACTGACTCAGGTGGGAGG + Intronic
1164520188 19:28973183-28973205 GGAACAGTGACACCAGAGGGAGG + Intergenic
1164926095 19:32131217-32131239 ACAGCGCTGACTCCAGACTGTGG + Intergenic
1164976017 19:32573295-32573317 GCAGAACAGACTCCAGAGTCGGG + Intergenic
1165733922 19:38163952-38163974 GCTGCACTGGCCCCAGGGGGAGG + Intronic
1166725229 19:45023027-45023049 GCAGCACGCACTTCAGAGGTAGG + Intronic
1167697557 19:51024267-51024289 GCAGCACAACCTCCAGAAGGAGG - Exonic
1168642609 19:58040158-58040180 GCAGCACTGACTAACTAGGGAGG - Intronic
926633995 2:15161658-15161680 GCAGCTCTGCATCCAGATGGGGG + Intergenic
927193845 2:20534486-20534508 GGAGCTCTGACTCCAGGGTGGGG + Intergenic
929483556 2:42335688-42335710 GCTGCACGGACTCCGGAGGCGGG - Intronic
929704471 2:44195799-44195821 GCAGAAGTGACTTCTGAGGGTGG + Intronic
930035023 2:47079956-47079978 GCAGCTCTGACCCCTGAGGTGGG + Intronic
933713733 2:85345370-85345392 GGAGCCCTGACCCCAGAGGGTGG - Intronic
933839066 2:86271714-86271736 GCAGCACTGACTCCTTAGCAGGG + Intronic
935221044 2:101013092-101013114 GCAGCAATTAATCCAGGGGGTGG + Intronic
936508138 2:113124443-113124465 CCTGCTCTGACTCCAAAGGGGGG - Intronic
937288521 2:120767965-120767987 GCAGCACTGACTGTGGTGGGGGG - Intronic
940688981 2:156890895-156890917 GGAGCACTCAATCCACAGGGTGG + Intergenic
943063207 2:183060422-183060444 GTGGCACTGACTGCAGAGGGTGG + Intergenic
944507864 2:200432229-200432251 GCAGCATAGAATACAGAGGGAGG + Intronic
944526869 2:200628447-200628469 GCAGCAATGACAGCAGAGTGTGG - Intronic
945422458 2:209656172-209656194 TATGCACTGACACCAGAGGGTGG + Intronic
946245934 2:218387403-218387425 ATAGCACAGACTTCAGAGGGTGG + Intronic
948216994 2:236239456-236239478 GCAGAACTGGGACCAGAGGGCGG - Intronic
948217010 2:236239535-236239557 GCAGAACTGGGACCAGAGGGCGG - Intronic
948675911 2:239596612-239596634 GCAGGACTGACTCCAAAGATGGG - Intergenic
948810426 2:240472488-240472510 GCAGGACTGACCCCAGACTGTGG - Intergenic
948879192 2:240847546-240847568 GGAGCACAGACTCCAAAGAGTGG + Intergenic
1168827753 20:825243-825265 AAAACACTGTCTCCAGAGGGTGG - Intergenic
1169224691 20:3848643-3848665 ACAGCACTGCCTCCTGAGAGAGG + Intronic
1169288405 20:4328528-4328550 GCAGCAGTGACTACAGAGCCGGG - Intergenic
1169358028 20:4924292-4924314 GAAACTCTGACTCCAGAGGGAGG - Intronic
1170945210 20:20885290-20885312 GCATCCCTGGCTCCAGAAGGAGG - Intergenic
1171498770 20:25577207-25577229 CCAGCAGGGACTCCAGAGGGCGG - Intronic
1172194867 20:33084913-33084935 GCCGCACGGACACCCGAGGGAGG - Exonic
1173572030 20:44083520-44083542 GCAGCACAGGCCCCAGAAGGCGG - Intergenic
1173810472 20:45952292-45952314 GCAGCAGTGGCTGCAGATGGCGG + Exonic
1175079142 20:56403675-56403697 GCAGCGATGACTTCAGAGCGCGG + Exonic
1175416639 20:58805469-58805491 CCAGGTCTGACTCCAGAGGCAGG - Intergenic
1175620922 20:60446916-60446938 GCAGCACTGGCTTCAGAGCCAGG + Intergenic
1175938529 20:62526432-62526454 CCAGCGCTGACCCCACAGGGAGG + Intergenic
1176428721 21:6563653-6563675 GCCCCACTGACTGCAGAAGGGGG - Intergenic
1176621576 21:9065225-9065247 ACAGCTCTGACTCCAGGGTGTGG + Intergenic
1179704211 21:43171969-43171991 GCCCCACTGACTGCAGAAGGGGG - Intronic
1179904295 21:44414228-44414250 GCAGCAGTGACCACAGAGAGTGG - Intronic
1180793810 22:18592154-18592176 GCCGCAGGGACTCCAGGGGGAGG - Intergenic
1181106003 22:20575890-20575912 ACAGCACAGACTCCAGAACGTGG + Intronic
1181227930 22:21403166-21403188 GCCGCAGGGACTCCAGGGGGAGG + Intergenic
1181250723 22:21531673-21531695 GCCGCAGGGACTCCAGGGGGAGG - Intergenic
1181286039 22:21753409-21753431 CCAGATCTGACTCCAGAGGATGG - Intergenic
1181871114 22:25900020-25900042 GCTGCACAAACTCCAGAGGCTGG - Intronic
1182491843 22:30677791-30677813 GCAGCACTGCCTGCTGAGGCGGG + Intergenic
1183048987 22:35245761-35245783 CCACCATTGACACCAGAGGGGGG + Intergenic
1183929947 22:41230126-41230148 ACAGCAATGACTGAAGAGGGAGG - Exonic
1185071974 22:48661589-48661611 GCTGCACTGTCCCCATAGGGCGG - Intronic
1185238481 22:49728001-49728023 GGAGCGCTGACTCCAGAGCCGGG - Intergenic
949982256 3:9509068-9509090 GCAGCGCTGGCTCCTGCGGGCGG + Intronic
950698894 3:14726408-14726430 GCAGCATCCACTGCAGAGGGAGG + Intronic
951195934 3:19823354-19823376 GCAGCTCTGACTCCAGAGGTGGG + Intergenic
954690115 3:52391298-52391320 GCAGCACTGGCTCCAGGGCTGGG - Exonic
956238250 3:67099375-67099397 GCAGCAATGGCACAAGAGGGAGG + Intergenic
957589670 3:82179793-82179815 GCAGCACTGAGTCAAGCAGGTGG - Intergenic
961548530 3:127652852-127652874 ACAGCTCTGATTCCAGAGGGAGG - Intronic
966564287 3:181359068-181359090 GCAGCAATGTCTCCAAAGGAGGG - Intergenic
967528567 3:190522557-190522579 GCAGCACTGAATGAAGAGGAAGG - Intronic
968486740 4:866592-866614 GCAGGCCTGACTCCAGAGCTGGG - Intronic
968487281 4:868737-868759 GCAACACTGACCCCAGAGCTGGG + Intronic
972352670 4:38251478-38251500 GAAGCACAGACTTCAGAGGAAGG - Intergenic
975209341 4:71680668-71680690 GCAGAACTGATTCTTGAGGGTGG + Intergenic
978371786 4:108036493-108036515 GCAGCACTTGTTCAAGAGGGAGG + Intergenic
980384243 4:132065534-132065556 GGAGCACAAACTCCAGATGGAGG - Intergenic
981642418 4:146959856-146959878 GCAGCAATGACTCCAGGGGTGGG - Intergenic
982220821 4:153123797-153123819 GCAGTCCTGAGTCCAGAGGCTGG - Intergenic
984742058 4:183174324-183174346 GCACCACAGACTTCAGACGGAGG - Intronic
984756334 4:183328794-183328816 GCAGCTCCCAGTCCAGAGGGTGG + Intergenic
984862775 4:184254973-184254995 GCGCCACGGAGTCCAGAGGGTGG + Intergenic
984927198 4:184817488-184817510 GAAGGACTGTCTCCAGAGTGGGG - Intronic
985952951 5:3237289-3237311 GCTGCACTTGCTCCAGACGGTGG - Intergenic
987923357 5:24311206-24311228 GCAGCACTGCCTGCTGAGGAGGG + Intergenic
989119092 5:37985673-37985695 GCAGCACTGACCTCAGAAGATGG - Intergenic
989167822 5:38448055-38448077 GCAGCGCTGAGGCCAGAGGCAGG + Intronic
992135057 5:73736305-73736327 GCAGCACTGACCACAGTGGCAGG + Intronic
992979392 5:82152376-82152398 GCAGCACTGACTCTGAAGCGTGG + Intronic
996152998 5:120062971-120062993 ACAGCAATGACTCCTGAGGCTGG + Intergenic
997359018 5:133282570-133282592 GCAGCAGTGGCTCCTGTGGGTGG + Intronic
997599657 5:135130639-135130661 GCAACCCTTGCTCCAGAGGGAGG - Intronic
999233676 5:150077978-150078000 ACAGCTCAGACTCCAGAGAGGGG - Intronic
999264321 5:150256593-150256615 GCTGCACTGCCACCAGATGGGGG - Exonic
999478103 5:151920336-151920358 GCAGAGCTGACTCTAGAGGCAGG + Intronic
1000266218 5:159640849-159640871 GCAGCACTGACTCTAGACTTTGG + Intergenic
1000286043 5:159826913-159826935 GAAGCACTGTCTCCCCAGGGTGG + Intergenic
1001804723 5:174573610-174573632 GCTGCTCCCACTCCAGAGGGCGG + Intergenic
1003907883 6:10719441-10719463 GTAGCACTGACTGCAGAGGTTGG - Intergenic
1004141081 6:13018267-13018289 GCAGCCCTGACACCAAATGGTGG - Intronic
1006921971 6:37633251-37633273 ACAGCACTGACTCGATAGAGAGG + Exonic
1007744376 6:44034496-44034518 GCACCTCTGACCCCAGAGGGTGG - Intergenic
1012971334 6:105734742-105734764 CCAGCAGTTACTGCAGAGGGAGG - Intergenic
1019355970 7:579146-579168 GCAGCACTGACTCCAGAGGGAGG + Intronic
1022494408 7:30844088-30844110 GCAGCACCCAGTCCAGGGGGTGG - Intronic
1022827670 7:34032851-34032873 GCAGGACTGATTCTAGAGAGTGG + Intronic
1023822949 7:43990250-43990272 GCAGCACAGACTACAGACGGGGG - Intergenic
1024581578 7:50805130-50805152 ACAGCACCTACTCCATAGGGTGG + Intergenic
1026527150 7:71164075-71164097 GCAGCACTGTCTCCCAAGGTTGG - Intronic
1031076913 7:117221832-117221854 GTGGCACTGACTCCAGAGCTTGG - Intronic
1033085868 7:138341314-138341336 GCAGCACTGCCTGCTGAGGTGGG - Intergenic
1033358624 7:140621942-140621964 GCAACACTGGCTCCATAAGGAGG + Intronic
1034274484 7:149818053-149818075 GCAGCCCTGACCACTGAGGGTGG - Intergenic
1036643429 8:10598037-10598059 ACAGCACCGAACCCAGAGGGTGG - Intergenic
1037952631 8:23028807-23028829 GCAGCTCTGACCCCAGAGCAGGG - Intronic
1037974697 8:23200965-23200987 GCAGCTCTGACCCCAGAGCAGGG - Intronic
1038055838 8:23856697-23856719 GCAGCACTGGCTGGAGATGGGGG + Intergenic
1038307701 8:26419814-26419836 GCAGCAGTGGCTGCAGAGTGAGG - Intronic
1038947442 8:32376630-32376652 GCAGGCCTGTCTCCAGTGGGAGG + Intronic
1039421618 8:37448194-37448216 GCAGCACTGGCTCCGGAGTGTGG - Intergenic
1041028933 8:53716654-53716676 GCAGCACTCACTCCACAGATGGG + Intronic
1042937128 8:74070697-74070719 GGAGAACTGATTCCAGAGGCAGG - Intergenic
1043290038 8:78587365-78587387 GCAGTACTGACGTCAGAGAGGGG - Intronic
1048415611 8:134224848-134224870 ACAGCTCTTACTTCAGAGGGTGG - Intergenic
1049023550 8:139973638-139973660 GCGCCAGTGACTCCAGAGGCCGG - Intronic
1049053480 8:140217178-140217200 GCAGCGCTGACTGCAGAGGCTGG - Intronic
1049438670 8:142599286-142599308 ACAGCAGTGACAGCAGAGGGTGG + Intergenic
1049586709 8:143435752-143435774 GCAGCAGTGACTTCAGAGTGTGG - Intergenic
1050055578 9:1650137-1650159 GCATCACTGACTCCAGGTGCTGG + Intergenic
1054768276 9:69060940-69060962 GCAGCTCTGAATGCAGAGGCAGG + Intronic
1055509440 9:76981040-76981062 GCAGCCATGCCTCCAGTGGGTGG - Intergenic
1057454705 9:95197700-95197722 GCAGAGCTGACTCCTGAGGAAGG + Intronic
1057459042 9:95242818-95242840 CCAGCACTCACTCCAGGGGCTGG + Intronic
1058762020 9:108143182-108143204 GCAGCCCTGGCCCCAGAGAGAGG - Intergenic
1060113060 9:120920199-120920221 GCAGGACTGACTCCAGGGATAGG + Intronic
1060821741 9:126665291-126665313 CCAGCCCTGGCTCCAGGGGGAGG - Intronic
1060968279 9:127723685-127723707 GCAGGAGTGACTCCAGGGGGCGG + Intronic
1061010921 9:127954206-127954228 GCAGCACTGGGTACAGAGGGAGG - Intronic
1061909620 9:133715802-133715824 GGAGCACTGACTCGGCAGGGTGG - Intronic
1062609641 9:137368234-137368256 GCAGCAGGGACTCAAGGGGGTGG + Intronic
1062702732 9:137916510-137916532 GCTGCACTGACCCTACAGGGCGG - Intronic
1203794015 EBV:166602-166624 CCAGCGCTGGCTCCAGGGGGTGG + Intergenic
1186883083 X:13885729-13885751 GCAGCAGTGACTTAAGATGGAGG - Intronic
1188968902 X:36588907-36588929 GCAGCATTGCCTCCAGGGGAAGG + Intergenic
1190288446 X:48975946-48975968 GCAGCACAGAATGGAGAGGGAGG + Intronic
1193042430 X:77017630-77017652 TCAACAGTGACTCCAGAAGGTGG - Intergenic
1193346699 X:80412149-80412171 CGAGCTGTGACTCCAGAGGGTGG - Intronic
1195060292 X:101187730-101187752 GCAGCACTGCCTGCTGAGGCGGG + Intergenic
1195168592 X:102244789-102244811 GCATCACTGACACCAGAGATGGG - Intergenic
1195190265 X:102442298-102442320 GCATCACTGACACCAGAGATGGG + Intronic
1196664135 X:118298592-118298614 GCAGCACTGCCTGCTGAGGCAGG + Intergenic
1199879018 X:151958232-151958254 CCAGCCCTGCCTCCAGAGAGAGG - Intronic
1199975428 X:152892431-152892453 GCAGGTCTGACTCCAAAGGTCGG + Intergenic
1201158100 Y:11150678-11150700 ACAGCTCTGACTCCAGGGTGTGG + Intergenic
1201590028 Y:15604475-15604497 GCAGGACTGACACCACATGGAGG + Intergenic