ID: 1019355972

View in Genome Browser
Species Human (GRCh38)
Location 7:579152-579174
Sequence CTGACTCCAGAGGGAGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 339}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019355961_1019355972 17 Left 1019355961 7:579112-579134 CCATGGAGGCCCCGGACGGGCGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1019355972 7:579152-579174 CTGACTCCAGAGGGAGGGTGAGG 0: 1
1: 0
2: 4
3: 45
4: 339
1019355963_1019355972 8 Left 1019355963 7:579121-579143 CCCCGGACGGGCGTGCGGTCACA 0: 1
1: 0
2: 0
3: 4
4: 23
Right 1019355972 7:579152-579174 CTGACTCCAGAGGGAGGGTGAGG 0: 1
1: 0
2: 4
3: 45
4: 339
1019355955_1019355972 23 Left 1019355955 7:579106-579128 CCCACCCCATGGAGGCCCCGGAC 0: 1
1: 0
2: 1
3: 19
4: 153
Right 1019355972 7:579152-579174 CTGACTCCAGAGGGAGGGTGAGG 0: 1
1: 0
2: 4
3: 45
4: 339
1019355953_1019355972 26 Left 1019355953 7:579103-579125 CCACCCACCCCATGGAGGCCCCG 0: 1
1: 0
2: 3
3: 60
4: 464
Right 1019355972 7:579152-579174 CTGACTCCAGAGGGAGGGTGAGG 0: 1
1: 0
2: 4
3: 45
4: 339
1019355964_1019355972 7 Left 1019355964 7:579122-579144 CCCGGACGGGCGTGCGGTCACAG 0: 1
1: 0
2: 1
3: 3
4: 58
Right 1019355972 7:579152-579174 CTGACTCCAGAGGGAGGGTGAGG 0: 1
1: 0
2: 4
3: 45
4: 339
1019355959_1019355972 19 Left 1019355959 7:579110-579132 CCCCATGGAGGCCCCGGACGGGC 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1019355972 7:579152-579174 CTGACTCCAGAGGGAGGGTGAGG 0: 1
1: 0
2: 4
3: 45
4: 339
1019355965_1019355972 6 Left 1019355965 7:579123-579145 CCGGACGGGCGTGCGGTCACAGG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1019355972 7:579152-579174 CTGACTCCAGAGGGAGGGTGAGG 0: 1
1: 0
2: 4
3: 45
4: 339
1019355960_1019355972 18 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355972 7:579152-579174 CTGACTCCAGAGGGAGGGTGAGG 0: 1
1: 0
2: 4
3: 45
4: 339
1019355956_1019355972 22 Left 1019355956 7:579107-579129 CCACCCCATGGAGGCCCCGGACG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1019355972 7:579152-579174 CTGACTCCAGAGGGAGGGTGAGG 0: 1
1: 0
2: 4
3: 45
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019355972 Original CRISPR CTGACTCCAGAGGGAGGGTG AGG Intronic
900155180 1:1201040-1201062 CCGACCCCAGCGGGAGGTTGGGG + Intergenic
900602825 1:3510288-3510310 CTCAGGCCAGAGGGAGGGAGGGG + Intronic
900795927 1:4708390-4708412 CTGCCTCCAGAGGAGGTGTGGGG + Intronic
902714214 1:18261328-18261350 TTGACTTCAGAGGCAGGGTTCGG + Intronic
903145568 1:21369903-21369925 CTGACTCCTGAGGGAGAGCTGGG + Intergenic
903179176 1:21596956-21596978 CTGAGTCCAGAGGGATGCTCAGG + Intronic
903350850 1:22715768-22715790 CTGACTTCACAGGCAGTGTGTGG + Intronic
903779378 1:25811581-25811603 CTCATTGCAGAGGGAGGGCGGGG - Intronic
904360850 1:29970939-29970961 CCCACTCCAGAGAGAGGGCGAGG - Intergenic
904880104 1:33690026-33690048 CTGCCTCCAGAGTGTGGCTGGGG - Intronic
905178621 1:36153403-36153425 ATGAGTCCACAGGGAGTGTGCGG - Intronic
905825296 1:41022026-41022048 CTGACTAAAGAGGGAGGTGGAGG - Exonic
905865179 1:41372534-41372556 CTGCCTGCAGAGGGAGGGAGGGG + Intronic
906150609 1:43585356-43585378 ATGTCTACAGAGGAAGGGTGGGG - Intronic
907275295 1:53313599-53313621 GTGACTCCAGAGGTCAGGTGAGG + Intronic
907774104 1:57496222-57496244 GTGAGTGCAGAGGCAGGGTGGGG - Intronic
908108863 1:60874905-60874927 GTGAGGCCAGAGGGAGGGGGCGG - Intronic
910161792 1:84279983-84280005 GTGACACTAGAGGGATGGTGAGG + Intergenic
912863517 1:113236514-113236536 ATGCCTCTAGAAGGAGGGTGTGG + Intergenic
913159479 1:116132380-116132402 ATGGCTCAGGAGGGAGGGTGTGG + Intronic
913349008 1:117837531-117837553 CTAACTCCAGAGAAAGGGTCTGG + Intergenic
915912440 1:159923343-159923365 GTAACTCCAGGGTGAGGGTGAGG - Intronic
916562221 1:165942823-165942845 CTGACTCCAGAAGGATGGCTGGG + Intergenic
917077534 1:171220765-171220787 CTGATGCCAGAAGGAGAGTGTGG + Intergenic
918113380 1:181477262-181477284 CTGCCTCCAGTGGGAGGGGATGG + Intronic
919978161 1:202626239-202626261 GCCACTGCAGAGGGAGGGTGGGG - Intronic
920235044 1:204497255-204497277 CTGAATCAAGAGAGAGGGAGGGG - Intergenic
920340596 1:205272962-205272984 CTGGCTTCAGAGAGAGGATGGGG - Exonic
920826672 1:209429343-209429365 ATGACTCCTGAGGAAAGGTGGGG - Intergenic
921569464 1:216761052-216761074 CTGTCCCCAGGGGGAGGTTGAGG - Intronic
922366102 1:224865194-224865216 CTGACTCCAAAGGGAATTTGAGG - Intergenic
922517111 1:226215592-226215614 CTGGCTCCACAGGGAGGGACTGG + Intergenic
922553762 1:226517608-226517630 CTGACTCCACAGGGAAGGTGGGG - Intergenic
922743819 1:228031870-228031892 CTGGCTCCAGAGCCAGGATGGGG + Intronic
922876821 1:228946234-228946256 CTTTCTCCAGAGAGAGGGTGAGG - Intergenic
923378426 1:233390169-233390191 CTGACACCAGATGGAGCTTGGGG - Intergenic
924618936 1:245642806-245642828 CTGATTACAGAGAGAGGGTCTGG + Intronic
1063145701 10:3293611-3293633 GTGACTCCGGAGGGTGGGAGAGG + Intergenic
1063520456 10:6736249-6736271 CTGGCTCCAGGGGGAGTGGGTGG + Intergenic
1064096338 10:12427234-12427256 CTGATTCCAGAGGGTGGGTAGGG + Intronic
1067667481 10:48290615-48290637 CTGAATCCAGTGGCAGGGGGTGG - Intergenic
1067672779 10:48340383-48340405 GTGACTCCAAAAGGAGGCTGAGG + Intronic
1069541073 10:69294323-69294345 CTGAATGGATAGGGAGGGTGTGG - Intronic
1070668116 10:78359603-78359625 CTCCGCCCAGAGGGAGGGTGAGG - Intergenic
1070981725 10:80653802-80653824 CTCACTCCATAGGGAGAGTGGGG - Intergenic
1072785914 10:98282200-98282222 CTGACCCCACAGGAAGGGGGTGG + Intergenic
1074291034 10:112138175-112138197 GTGGCTGCAGAGTGAGGGTGAGG - Intergenic
1074561395 10:114538664-114538686 CTGACCACAGAGGGAGAGGGCGG - Intronic
1075595938 10:123729101-123729123 ATGACTGCAGTGGGAGGGTGGGG - Intronic
1075817051 10:125272468-125272490 CTAACACCAGAAGCAGGGTGTGG + Intergenic
1075818118 10:125282087-125282109 CTAACACCAGAAGCAGGGTGTGG - Intergenic
1076140676 10:128076772-128076794 CAGAACCCAGAGGGAGGGCGTGG - Intronic
1076566984 10:131405482-131405504 GTGATTCCAGAGGGAGAGTGAGG - Intergenic
1076700366 10:132269782-132269804 CTGACTCCAGCGGCACAGTGGGG + Intronic
1076911528 10:133392439-133392461 CTGGCTACAGAGGGAGGCTGGGG - Intronic
1077369022 11:2172905-2172927 CTGACCCCAGAGGGATGGGGAGG - Intergenic
1078550767 11:12279176-12279198 GTGTCTCAAGAGGGAGGGTTTGG + Intronic
1078771544 11:14357301-14357323 CTGATGGCTGAGGGAGGGTGGGG - Intronic
1078908356 11:15708242-15708264 CTGACTCCAGGGGGAGGTGCTGG - Intergenic
1079078430 11:17397549-17397571 CTGATGCCAGAGGGACAGTGCGG - Intronic
1081661197 11:44889445-44889467 CTGCCTCCAGAGAGAGCCTGGGG - Intronic
1081873161 11:46392226-46392248 CTGACCCCAGCGGGAGGCTGCGG + Intergenic
1082640798 11:55658113-55658135 CTGACTGGAGAGGGTGGGTGTGG + Intergenic
1082965048 11:58958721-58958743 AACACTCCACAGGGAGGGTGGGG + Intronic
1083002565 11:59308503-59308525 CTGAATACAGAGGGAGGTGGGGG + Intergenic
1083408127 11:62472564-62472586 TTGACTTCATAGGGATGGTGAGG - Intronic
1083680601 11:64350007-64350029 CGGGCTCCACACGGAGGGTGGGG + Intronic
1083988870 11:66234298-66234320 CTGGCTGCAGAAGGAGGCTGAGG + Intronic
1084119440 11:67060221-67060243 CTGGCTCAAGAGGGAGTGTCGGG - Intronic
1084296718 11:68216846-68216868 CTGAAACCGGAGGGAGAGTGGGG + Intergenic
1084640606 11:70423704-70423726 CTAGCTGCAGAGGGAGGGTGGGG + Intronic
1084863577 11:72038638-72038660 CAGATTTCAGGGGGAGGGTGGGG - Intronic
1084941453 11:72615449-72615471 CTGACTCCAGACTCTGGGTGAGG - Intronic
1085202635 11:74710967-74710989 CGGAGTCCAGAGGGAGTGTGAGG + Exonic
1085524517 11:77156641-77156663 CCCACTGCAGAGGGAGGGAGTGG - Exonic
1085525422 11:77160919-77160941 CTGTCCCCCGGGGGAGGGTGTGG + Intronic
1088826101 11:113495894-113495916 CAGTCTCCACATGGAGGGTGGGG + Intergenic
1089203076 11:116736893-116736915 CTGACACCAGAGGGAGAGGCAGG - Intergenic
1089742237 11:120592643-120592665 CTGCGCTCAGAGGGAGGGTGTGG - Intronic
1090653960 11:128828458-128828480 CTGACTCCAGAGGTCGGCAGAGG - Intergenic
1091014767 11:132040038-132040060 GCTACTCCAGAGGGAGGCTGAGG - Intronic
1091666805 12:2424747-2424769 CTGTGTCCTGTGGGAGGGTGAGG + Intronic
1092514267 12:9192199-9192221 CTGACTCCACAGGCAGAGTGTGG + Exonic
1093156604 12:15693471-15693493 CTGACTCAACAGTGAGAGTGAGG - Intronic
1094359353 12:29613293-29613315 ATGACTTCAGTGGGAGGCTGTGG + Intronic
1095279733 12:40336056-40336078 ATCACTCCAGAGGCTGGGTGAGG - Intronic
1095730372 12:45500170-45500192 CTGACTCCACAGGGAACATGAGG - Intergenic
1096154599 12:49334984-49335006 CAGGCTGCAGAGGGAGGTTGGGG - Intronic
1100431723 12:94536741-94536763 CTGCCTCCAGAGAGAGGCTCTGG - Intergenic
1101419162 12:104535159-104535181 CAGACTCCAAAGGGCAGGTGAGG - Intronic
1102440824 12:112962947-112962969 CTGACTCCAGGGTGACAGTGGGG - Intronic
1103098144 12:118148393-118148415 CTCACTCCAGTGGCAGGGTGGGG - Intergenic
1103721156 12:122976283-122976305 CTGACTCCAGGGGAAGGAGGAGG - Exonic
1103747422 12:123134874-123134896 CTGACTACAGAGGGTTGTTGTGG + Intronic
1103816043 12:123657367-123657389 CGGACTGAAGAGGGAGAGTGTGG - Intronic
1103927994 12:124434225-124434247 CTGACTCCCCAGTGGGGGTGAGG + Intronic
1104644994 12:130490890-130490912 CAGAGTTCAGTGGGAGGGTGGGG + Intronic
1105813412 13:24013084-24013106 CTGAGCCCAGAGCCAGGGTGGGG + Intronic
1105859258 13:24394941-24394963 CTGGCTCCTGAGTGAGGCTGGGG + Intergenic
1106487743 13:30187475-30187497 CTGACTCCAGAGGGTAGATATGG - Intergenic
1106719358 13:32422750-32422772 CAGCCTCCAGAGAGAGGGTAAGG + Intronic
1107942223 13:45385096-45385118 TTCACTCCAGATGGAGGCTGTGG - Intergenic
1108039780 13:46329419-46329441 CTGAGTCCAGGGGGAGGGTAGGG + Intergenic
1108647821 13:52448369-52448391 CTGACTCCTGGGGGAAGGTGCGG - Intronic
1108701455 13:52947801-52947823 CTGACTCCAGGGGCAGGGGCGGG - Intergenic
1109060387 13:57610733-57610755 CTGATTCCAAAGGGAGCTTGTGG + Intergenic
1113649581 13:112026444-112026466 CTGCCTGAAGAAGGAGGGTGAGG + Intergenic
1113889785 13:113729960-113729982 CTGTCTCCAGATGGAGGGGCGGG - Intronic
1114250415 14:20955392-20955414 CAGAGCCCAGAGGGAGGGTCTGG - Intergenic
1114349673 14:21836116-21836138 CTGCCCACAGAGGGAGGTTGAGG + Intergenic
1115307741 14:31949852-31949874 CTGCCTCCACTGAGAGGGTGTGG + Intronic
1118819857 14:69338169-69338191 CTGGGTCAAGAGGGAGGTTGGGG + Intronic
1119216940 14:72876398-72876420 GAGGCTCCAGGGGGAGGGTGGGG - Intronic
1121263035 14:92580465-92580487 CTCACTTCAGATGGAGGGAGGGG + Intronic
1121452968 14:94021135-94021157 CTGCCTCCAGTGGGAGCTTGGGG + Intergenic
1122060451 14:99133625-99133647 CTGAGTGCAGAGGGTGGGTGGGG - Intergenic
1124346136 15:28922731-28922753 ATGTCTCCTGAGAGAGGGTGTGG - Intronic
1124870472 15:33536543-33536565 CTGGCTCCAGAGTGTGGGAGAGG + Intronic
1125426649 15:39555773-39555795 CTGACTCCACAGGGAGCTAGTGG - Intergenic
1125534660 15:40436306-40436328 CTTTCTCCAGAGGGAGAGCGTGG - Intergenic
1126062661 15:44798915-44798937 CTGTCTCCTGAGGGGGGGTAAGG - Intergenic
1126096201 15:45092496-45092518 CTGGCTGAAGAGGTAGGGTGGGG + Intergenic
1127954627 15:63842567-63842589 TTGACTGCAGGGGTAGGGTGTGG - Intergenic
1128356488 15:66931055-66931077 CTGTCTCCTGATGGAGGGTGAGG - Intergenic
1128469080 15:67936990-67937012 CTGATACCACAGGGAGGCTGAGG + Intergenic
1128733281 15:70035022-70035044 GAGGCTCCTGAGGGAGGGTGAGG - Intergenic
1128797207 15:70474649-70474671 GTGACTTGAGAGGGAGGGAGGGG + Intergenic
1129682337 15:77664809-77664831 CTGACTCCAGTGGGAGGGGAAGG + Intronic
1130102683 15:80905853-80905875 CCGACACCAGAGGAAGGGTGGGG + Intronic
1132558427 16:582813-582835 CCGTCTGCAGAGAGAGGGTGGGG - Intronic
1132665635 16:1080243-1080265 CTGGGGCCAGATGGAGGGTGAGG - Intergenic
1132713488 16:1279372-1279394 CTGCCTGGAGAGGAAGGGTGAGG + Intergenic
1133269211 16:4602418-4602440 CTCACTGCAGTGGGAGGGGGTGG - Intergenic
1134058224 16:11183228-11183250 CTGACTCTAGCCGGAGGGCGGGG + Intergenic
1134061679 16:11202999-11203021 CTGAACCCAGAGGGAGGGGGTGG + Intergenic
1134526453 16:14947785-14947807 CTGACTCTGGAGGGAGGCTAAGG - Intronic
1135567374 16:23522072-23522094 CTGACACCTGGGAGAGGGTGAGG + Exonic
1136631928 16:31493876-31493898 CTGACACCAGAGGGAGCATCAGG + Exonic
1138080456 16:54085813-54085835 CTGAAGCCAGAGAGAGGGTGCGG - Intronic
1139041770 16:63006447-63006469 CTGTCTCCACTGGGAAGGTGTGG - Intergenic
1139511854 16:67432234-67432256 CTGTCACCAGAGGGAGGGAAGGG + Intronic
1139633784 16:68245879-68245901 CCCACTCCTGAGGGATGGTGGGG + Intronic
1139959462 16:70709463-70709485 GTGGCTCCAGCGGGAGAGTGGGG - Intronic
1141764058 16:86047087-86047109 CTGACTCCACAGGAGGTGTGAGG + Intergenic
1142146886 16:88496474-88496496 CTGACTCCAGGGGCAAAGTGGGG + Intronic
1142162536 16:88565938-88565960 TTGACTCCAGAGGCAGGGCTTGG + Intergenic
1142248965 16:88982533-88982555 CTGACTCCAGGGGGCGGCGGTGG - Intergenic
1203142913 16_KI270728v1_random:1780603-1780625 CTGACCCCAGAGTCAGGGTTTGG + Intergenic
1143092532 17:4457579-4457601 CTGACCTCACAGGGAGGCTGGGG + Intronic
1143268301 17:5657250-5657272 CAGACTCTGGAGAGAGGGTGGGG + Intergenic
1144002976 17:11072897-11072919 GGGACTCCAGAGGTAGGGAGGGG - Intergenic
1144777258 17:17791186-17791208 CTGACTCCAGAGAGCAGGAGAGG + Intronic
1146935446 17:36809982-36810004 CTCACTGCAGTGGGAAGGTGCGG + Intergenic
1147383568 17:40069586-40069608 CTGGCTGCTGGGGGAGGGTGGGG + Intronic
1147986809 17:44311725-44311747 GTGACTGCAGAGGGAGCCTGAGG + Intronic
1148220556 17:45858741-45858763 GTGGCTGGAGAGGGAGGGTGAGG + Intergenic
1148494070 17:48041965-48041987 CTGGCTCCATAGGGGAGGTGGGG + Intergenic
1148582945 17:48756061-48756083 AAGACTCCAGAGTGGGGGTGGGG - Intergenic
1149866963 17:60156482-60156504 CTGACTTCAGTGGGGTGGTGGGG + Intronic
1149868393 17:60162899-60162921 CTGTGTCCAGGGGCAGGGTGGGG + Intronic
1149884505 17:60327497-60327519 CTGGCTCCTGAGGTGGGGTGGGG - Intronic
1151359785 17:73581902-73581924 CTGACCCCTGAGGGATAGTGTGG - Intronic
1151968947 17:77447434-77447456 CTGGCTCAAAAGGGAGAGTGAGG - Intronic
1152388208 17:79987685-79987707 CTGCCCGCAGAGGGAGGCTGTGG - Intronic
1152943145 17:83182987-83183009 CTGGGCCCTGAGGGAGGGTGTGG + Intergenic
1153496455 18:5704646-5704668 CTGACTCCAGAGGTCTGGAGTGG + Intergenic
1153766362 18:8378677-8378699 CTGCCTTCAGAGGGAAGGAGTGG - Intronic
1156278266 18:35606099-35606121 TTGGTTCCAGAGGGAGGGTGAGG - Intronic
1156722940 18:40092615-40092637 CTGTATCCAGAGAGAGGCTGTGG + Intergenic
1156786685 18:40923620-40923642 TTTCCTCCAGAGGCAGGGTGGGG - Intergenic
1157116066 18:44863940-44863962 CTGACACAAAAGGCAGGGTGTGG - Intronic
1157314423 18:46576009-46576031 CTGCCTGCAGAGGGATGTTGAGG - Intronic
1157450989 18:47789044-47789066 CTGACTTCAGAGGCAGGCAGAGG - Intergenic
1158928810 18:62300405-62300427 TAGACTTCAGAGGAAGGGTGGGG - Intronic
1160358428 18:78248332-78248354 CTGACTTGAGAGGTAGGGTCTGG + Intergenic
1160515251 18:79476005-79476027 CTGGCTCCAGAAGGGGGGTGGGG + Intronic
1160558652 18:79742211-79742233 CTGGCACCAGAGGAAGCGTGAGG + Intronic
1161003573 19:1923431-1923453 CAGACTCCAGAGGGAAGCAGGGG + Intronic
1161043875 19:2124153-2124175 CAGACTCCAGAGGGAAGCAGGGG - Intronic
1161295644 19:3518959-3518981 CTCACTCCAGTGGGTGGGTGGGG + Intronic
1161571608 19:5033710-5033732 CTGCTTCCAGGGAGAGGGTGGGG - Intronic
1162453224 19:10767046-10767068 CTGTCTGCAGAGGGTGGCTGTGG + Intronic
1164633147 19:29774624-29774646 CTGTTTCCAGAAGGACGGTGGGG + Intergenic
1165310659 19:35027723-35027745 CTGGTTCCAGAGGGAGTATGTGG + Intergenic
1165333616 19:35154728-35154750 CTGCGTCCAGGCGGAGGGTGTGG - Intronic
1165810700 19:38610046-38610068 CCGTATCCAGAGGGATGGTGTGG + Intronic
1165876385 19:39010495-39010517 TTGACTCCAGAGGCAGGGCTCGG + Intronic
1166352551 19:42206922-42206944 CTGACTCACCAGGCAGGGTGGGG - Intronic
1166493709 19:43282901-43282923 CTGACTCCAGCCGGGGGGTGGGG - Intergenic
1166502456 19:43352383-43352405 GTGACTGCAGAGGGACGTTGTGG - Intergenic
1166838404 19:45681665-45681687 CTGCCGCCAGAGGGCGGGGGCGG - Intronic
1167439742 19:49501109-49501131 TGGACTCCAGAGGGAGGGGACGG + Intergenic
1167634856 19:50648691-50648713 GTGCCTCCAGAGGGAGGGGGAGG - Intronic
925299549 2:2800826-2800848 CTCAGTTCAGCGGGAGGGTGGGG + Intergenic
925334138 2:3080593-3080615 TTGACTCCAGTGGGGTGGTGAGG - Intergenic
925646280 2:6040275-6040297 CTGATTCCAGAGCGAGGTAGAGG - Intergenic
926844982 2:17126495-17126517 CTGACTACAGAAGGAGGGAAAGG - Intergenic
927036221 2:19179550-19179572 GGGACTCCAGAGAAAGGGTGGGG - Intergenic
930011231 2:46940211-46940233 AAGACTCCAGAGGGAGGACGTGG + Intronic
932139859 2:69265618-69265640 TTGACTCCAGAGGTGGGGTTTGG - Intergenic
932598296 2:73107747-73107769 CTGGCTGCAGAGGAAGGGTGTGG - Intronic
932803522 2:74764006-74764028 CTGATACCAGGGAGAGGGTGAGG - Intergenic
933707489 2:85302863-85302885 CTGGCTCCATAGGCAGTGTGTGG + Intronic
933713729 2:85345364-85345386 CTGACCCCAGAGGGTGGGCCCGG - Intronic
934893030 2:98087270-98087292 CTGACCCGAGAGGGCGGGCGAGG - Exonic
935678846 2:105618889-105618911 AAGACTCTAGAGGGAGGTTGGGG + Intergenic
936074621 2:109393981-109394003 CTGACTCCGGTGGGGAGGTGCGG - Intronic
936169087 2:110152490-110152512 CTGAGTCCAGAAGGAGCATGGGG + Intronic
936175282 2:110214369-110214391 CTGACACCAGAGTTGGGGTGAGG + Intergenic
936428286 2:112437082-112437104 CTGGGGCCACAGGGAGGGTGGGG + Intergenic
936500183 2:113060646-113060668 CAGACTCCAGTGGGAGACTGTGG + Intronic
937346299 2:121127916-121127938 CTGAGAACAGAGGGAGGGCGAGG - Intergenic
937368662 2:121283342-121283364 CTGACTCTAGAGGGAGGGTCTGG - Intronic
937418889 2:121738541-121738563 CTGAGTGGAGAGGAAGGGTGGGG + Intronic
937876645 2:126831000-126831022 CTGACTCCACAGAGAGGAAGTGG + Intergenic
939499596 2:142966350-142966372 CTGAATCCAGACAGAGGCTGTGG - Intronic
941131072 2:161651105-161651127 CTGAGTCCGGAGGCGGGGTGGGG - Intronic
945230527 2:207584517-207584539 CTGACTACTCAGGGAGGCTGAGG - Intronic
948335128 2:237201623-237201645 CTGACTCCACAGGGACCCTGAGG + Intergenic
948502334 2:238404870-238404892 CTGACTCCTGGGGGAGGGGCAGG - Intergenic
949034947 2:241812054-241812076 CTGACCCCAGAGGGTGTGCGCGG + Intronic
1169130943 20:3166182-3166204 ATGACTCCAGCGGGTGGGAGTGG - Exonic
1169358025 20:4924286-4924308 CTGACTCCAGAGGGAGGACGGGG - Intronic
1170603560 20:17859673-17859695 CAGGCTCCTGAGGGAGGGCGTGG + Intergenic
1170969281 20:21102898-21102920 CCGAGTCCAGAGGGAGAGAGAGG - Intergenic
1172166464 20:32902753-32902775 CTGACTCCAGAGGCAGAGGTTGG - Intronic
1172196552 20:33095713-33095735 CTCACTTCAGAGGGTGGCTGTGG + Intronic
1172882537 20:38211322-38211344 CTGGCTCCAGAAAGAGGCTGTGG - Exonic
1175308476 20:57994405-57994427 CTGGCCACAGAGGGAGGGGGAGG - Intergenic
1175628500 20:60510686-60510708 CTGGCTTCAGAGGGAAGCTGCGG + Intergenic
1176373966 21:6078129-6078151 CTGGGGCCACAGGGAGGGTGGGG - Intergenic
1176518057 21:7801099-7801121 TTGACTCCAAAGGCAGGGCGCGG - Intergenic
1178264282 21:31127935-31127957 CAGACTCCAGGGGTAGGCTGGGG - Intronic
1178296893 21:31417720-31417742 CTGACTGCACAGGTAGAGTGTGG - Intronic
1178652085 21:34431112-34431134 TTGACTCCAAAGGCAGGGCGCGG - Intergenic
1179024912 21:37671783-37671805 ATGACTCCAGAGGGCTGTTGGGG - Intronic
1179421602 21:41240858-41240880 GTGATTCCAGAGGGAGTGAGAGG - Intronic
1179749511 21:43460114-43460136 CTGGGGCCACAGGGAGGGTGGGG + Intergenic
1179883858 21:44305150-44305172 GAGATCCCAGAGGGAGGGTGAGG - Intronic
1182098981 22:27644817-27644839 CTGCCTGGAGTGGGAGGGTGGGG + Intergenic
1182119089 22:27775318-27775340 CAGACTCCAGAGGGTGGGAGTGG + Intronic
1183745066 22:39687281-39687303 CAGCCTGCAGAGGAAGGGTGCGG + Exonic
1184834598 22:47013872-47013894 CTGACTGCAGAGGGAGGCCTAGG - Intronic
1184915248 22:47564368-47564390 CTGCCTTCATAGTGAGGGTGAGG + Intergenic
1185376943 22:50487047-50487069 CTGAGTCCACAGGGAGCCTGGGG - Intronic
949618916 3:5788034-5788056 ATAACTGCAGAGGGAGGGAGGGG - Intergenic
951195935 3:19823360-19823382 CTGACTCCAGAGGTGGGAAGCGG + Intergenic
951235131 3:20226207-20226229 CTAACTCCTGGGGCAGGGTGGGG - Intergenic
951738850 3:25898084-25898106 CTGAATCCAGCAAGAGGGTGGGG - Intergenic
952026340 3:29087386-29087408 CTGAATCAGGATGGAGGGTGTGG + Intergenic
952387419 3:32852279-32852301 CTCTGACCAGAGGGAGGGTGGGG + Intronic
952848976 3:37712310-37712332 CAGACACCAAAGGGTGGGTGGGG - Intronic
953042502 3:39267675-39267697 CTGATTCAAGATGGAGGATGGGG + Intronic
954107677 3:48418134-48418156 CTGCCCTTAGAGGGAGGGTGTGG - Intronic
954117529 3:48475506-48475528 CTGACACCAGGGTGGGGGTGCGG - Intronic
954409815 3:50365555-50365577 ACGACTCCATGGGGAGGGTGGGG - Intronic
954535221 3:51354812-51354834 CTGACTCCAGGGTGGAGGTGGGG + Intronic
956072310 3:65466582-65466604 CTGACTCCACAGGGAGAGGGTGG + Intronic
956340164 3:68213539-68213561 CTGACTCCACAGGGAGCTTGGGG - Intronic
959407711 3:105980659-105980681 CTCACTCCAGAGGCAGTGGGTGG - Intergenic
959926396 3:111926302-111926324 CTGGCTCCAAAGGAAGGATGGGG - Intronic
961063600 3:123854594-123854616 GTGACTCCAAAAGGAGGGGGAGG + Intronic
961167790 3:124775665-124775687 GTGACTGGAGAGGCAGGGTGGGG + Intronic
961346401 3:126266420-126266442 CTGTGTCCAGAGGGAGGTGGTGG + Intergenic
962556180 3:136554228-136554250 CAGACACAAGAGGGAGGGTAAGG + Intronic
962874323 3:139524319-139524341 CTGACTTCAGAGGGAGGTCATGG - Intronic
964334843 3:155644310-155644332 CTGATTCCAGAGGCCGAGTGTGG + Intronic
966283129 3:178258436-178258458 CTGACACCTAAGGAAGGGTGGGG - Intergenic
966845813 3:184128903-184128925 TTGAATCCAGAGGGAGGATGGGG - Intergenic
968502475 4:957332-957354 CTCCCTCCACAGGGAGGCTGTGG - Intronic
968575202 4:1362790-1362812 CGGAGCCCAAAGGGAGGGTGAGG - Intronic
969289065 4:6227146-6227168 CTGACACCACTGGGAGTGTGGGG + Intergenic
969869193 4:10094283-10094305 CACACTCCAGAGGGGGCGTGTGG + Intronic
970564264 4:17316075-17316097 CTGATGACAGAGGGAGGGTTTGG - Intergenic
973946080 4:55957276-55957298 CTGACTTCAGAGGGAGGAACCGG - Exonic
980782338 4:137507823-137507845 CTGACTCCAGAAAGTGGGTTTGG + Intergenic
980851502 4:138388265-138388287 CTCACCCCACAGGGATGGTGTGG + Intergenic
981172617 4:141642453-141642475 CAGAAGCCAAAGGGAGGGTGTGG - Intronic
982068260 4:151673241-151673263 CTGACTCCACATGGCGGGGGGGG + Intronic
982157471 4:152536079-152536101 CTCACTCCAGAGAGAGGGGCGGG + Exonic
986098677 5:4585290-4585312 CAGACTCCAGAGTGAGGGACAGG + Intergenic
986231135 5:5865788-5865810 CAGCCTTCAGAGGGAGTGTGTGG - Intergenic
987226969 5:15852364-15852386 CACACTCCAGAGGGAGGGGCTGG - Intronic
988502838 5:31798064-31798086 CAGAATTCAGAGGGAGTGTGAGG + Intronic
988799700 5:34684758-34684780 CTGACTTGAGAGGATGGGTGGGG - Exonic
989186546 5:38631814-38631836 CTCATCCCAGAGGGAGGGTGTGG + Intergenic
989547435 5:42690774-42690796 CTGACACCACAGAGAGGTTGGGG + Intronic
993032648 5:82723207-82723229 CTGATCCCTGAGGGAGGATGTGG + Intergenic
993126758 5:83844727-83844749 ATGACTTCAGAGGGAAGGTGGGG + Intergenic
995453961 5:112332537-112332559 CTGACTCCAGAGAGAGTCTGGGG - Intronic
996083002 5:119275894-119275916 CTGACTACAGAGGAAGGCAGAGG - Intronic
997070532 5:130617416-130617438 TTGACTCCAGAGGCAGGGCTTGG + Intergenic
997211275 5:132078432-132078454 CTGACACAAGGTGGAGGGTGGGG + Intergenic
997362353 5:133303198-133303220 CTCAACCCAGAGTGAGGGTGTGG + Intronic
997607053 5:135182696-135182718 CTGGCTCAAGGGGGAAGGTGAGG + Intronic
997654045 5:135542400-135542422 CTCACTGCTGAGGAAGGGTGGGG - Intergenic
998538769 5:142959542-142959564 CTGCCTCCAGAGGCTGGGAGGGG - Intronic
999195410 5:149778396-149778418 GAGACTCCAGAGGCAGGGAGAGG + Intronic
999397937 5:151242369-151242391 CTCACTCCACAGGGTGGGAGGGG + Intronic
999729704 5:154467658-154467680 CTAACTCCTGAGGGACGCTGGGG - Intergenic
1001210168 5:169803664-169803686 CAGATTCCAGAGATAGGGTGTGG + Intronic
1001660607 5:173389694-173389716 CTGACTCCAGAGTGAAGGCAGGG - Intergenic
1001943370 5:175756746-175756768 TTGACTCCACCTGGAGGGTGTGG - Intergenic
1001961683 5:175883615-175883637 CTGACCGCACAGGGAGGCTGGGG + Exonic
1001980635 5:176035259-176035281 CTGCCACCAGAGGCAGGTTGTGG - Intergenic
1002236826 5:177808806-177808828 CTGCCACCAGAGGCAGGTTGTGG + Intergenic
1002312096 5:178320910-178320932 CGCACTCCAGAGGTGGGGTGTGG + Intronic
1002611809 5:180424463-180424485 CAGCCTCCCGAGGGAGGCTGAGG - Intergenic
1002635090 5:180603324-180603346 CTGACTCCCAAGGGAGGCGGCGG - Exonic
1002775508 6:324705-324727 ATGATCCCAGAGGGAGGATGTGG + Intronic
1003075088 6:2976601-2976623 CTGGGTCCGGAGAGAGGGTGAGG - Intergenic
1005621490 6:27624477-27624499 CTCTCTCCAGAAGGAAGGTGAGG - Intergenic
1006182696 6:32163709-32163731 CTGGCTCCCCAAGGAGGGTGGGG + Intronic
1006456848 6:34136912-34136934 CTGAGAGCAGAGGCAGGGTGTGG + Intronic
1007069467 6:39025335-39025357 CTCAGTCCAGAGGGAGTGTGGGG - Intronic
1007682809 6:43645805-43645827 CAGACGCCAGAGGGAGAGGGTGG + Intronic
1009526676 6:64755736-64755758 CTCACAACAGTGGGAGGGTGAGG + Intronic
1011255340 6:85414886-85414908 CTGACTCCAGGGATACGGTGTGG - Intergenic
1013163403 6:107567923-107567945 CTGGCTCCAGAGTGGGTGTGTGG + Intronic
1017250393 6:152273935-152273957 CTGCCTCTAGCGGTAGGGTGGGG + Intronic
1017957733 6:159192839-159192861 CGGTCTCTAGAGGGAGGGAGGGG + Intronic
1019355972 7:579152-579174 CTGACTCCAGAGGGAGGGTGAGG + Intronic
1022264157 7:28736971-28736993 CTGACCCCAGATGGAGGGCCAGG + Intronic
1023879381 7:44309591-44309613 CTGACCCCAGGGTGCGGGTGTGG + Intronic
1023942806 7:44780949-44780971 CTGAGGCCAGAGGGAATGTGGGG - Intergenic
1024993352 7:55253366-55253388 CAAACACCAGAGGGATGGTGTGG + Intronic
1026525066 7:71146328-71146350 CTGAATCCAGAAGGAGTGAGAGG - Intronic
1026843808 7:73685800-73685822 ATGACTCCAGAGGCCGGGCGCGG + Intronic
1027150460 7:75730009-75730031 CTGACACCAGAGAGAAGGTGGGG + Intronic
1027209000 7:76128763-76128785 CAGACTCCAGTGGGAGGAAGAGG - Intergenic
1029202460 7:98848183-98848205 CTGACCCCAGAGGGTGGCTCCGG + Exonic
1029225804 7:99027791-99027813 CTGGCTGCAGATGGCGGGTGGGG + Exonic
1029324032 7:99790503-99790525 CTGACTCCTGAAGGATGGTTAGG - Intergenic
1029403719 7:100360596-100360618 CTGATCCCAGAGGCAGCGTGAGG + Intronic
1029539520 7:101174387-101174409 CAGCCTCCAGAGGAAGGCTGGGG + Intronic
1029546478 7:101212882-101212904 TGGACTCCTGAGGGAGGCTGTGG - Exonic
1029681806 7:102116768-102116790 CTTACTTCAGAGGGCAGGTGGGG - Intronic
1032383216 7:131504708-131504730 CTGCCACCAGGGTGAGGGTGAGG - Intronic
1032452380 7:132044334-132044356 CTGGCTCAACAGGTAGGGTGGGG - Intergenic
1033155264 7:138951229-138951251 GTTCCTCCAGAGGGAGGATGCGG - Intronic
1033229961 7:139588895-139588917 CTGGCTCCCGAGGGGAGGTGAGG + Intronic
1033545946 7:142400309-142400331 CAGACTCCAGAGTGAGGGGGAGG - Intergenic
1034822133 7:154225851-154225873 CTGACTCCACAGAGAGAGGGTGG - Intronic
1034970025 7:155413085-155413107 CTTACTCCAGCAGCAGGGTGAGG + Intergenic
1036619747 8:10416635-10416657 CTGACTTCAAAAGGAGGGTGAGG + Intronic
1037251919 8:16905485-16905507 CTGACTCCAGAGCAAGGGGCTGG + Intergenic
1038822627 8:30966636-30966658 CTAACTACAAAGGGAGGTTGGGG + Intergenic
1042092355 8:65172598-65172620 CGGATTCAAGAGGGAGGGGGAGG + Intergenic
1042370814 8:67988665-67988687 AAGACTCCACAGGTAGGGTGGGG - Intronic
1043035076 8:75186748-75186770 CTGATTCCAGAGCCAGTGTGGGG - Intergenic
1044729566 8:95219179-95219201 CTGACTCCTGAGGGCAGGAGGGG - Intergenic
1046266686 8:111839469-111839491 CTGAATTCAGAGGGGTGGTGTGG + Intergenic
1046980843 8:120335070-120335092 CTGACCCAAGAGGGAGGGAATGG + Intronic
1047274236 8:123393540-123393562 CTGACTGTTGAGGGAAGGTGGGG + Intronic
1047655423 8:126971804-126971826 TTGATTCCAGTGGGAGGGTCTGG + Intergenic
1047932895 8:129748644-129748666 CCCACTCCAGAGTGAGGGTTTGG - Exonic
1049410264 8:142470847-142470869 CAGCCTCCAGAGTGAGTGTGGGG - Intronic
1049656331 8:143800040-143800062 CTGACTCCAGAGCATGGGTGGGG - Intronic
1049665345 8:143840474-143840496 CTGAGTCCAGAGGCATGGGGAGG + Intronic
1050324974 9:4490238-4490260 CAGACTCCAGTGGAAGGCTGTGG + Intergenic
1050480527 9:6082783-6082805 CTGACCAAAGAGGGAGGTTGGGG - Intergenic
1053144479 9:35703259-35703281 TGCACTCCAGAAGGAGGGTGTGG + Intronic
1054934960 9:70677065-70677087 TTGACTCCAGAGGCAGGGCTCGG + Intronic
1056800159 9:89685557-89685579 CTGACTCCAGAGCATGGGAGTGG + Intergenic
1057016933 9:91660019-91660041 CCGACTCCAGAGGGAGTGTGCGG + Intronic
1057020986 9:91697522-91697544 GTGAGTCCTGAGGGAGGGTGTGG - Intronic
1057146025 9:92760118-92760140 CTGACTCCACAGGGGGAGTCTGG - Intronic
1057230217 9:93317354-93317376 CTGACACCAGAATGATGGTGTGG - Intronic
1057955974 9:99408314-99408336 CTGACTCCAAAGGAATGATGTGG + Intergenic
1058868646 9:109183834-109183856 GTGGCTCCAATGGGAGGGTGAGG + Intronic
1060165403 9:121409846-121409868 CTGATTCCAGAGGATGGGTATGG - Intergenic
1060376619 9:123120339-123120361 GTGCCTCCTGAGAGAGGGTGGGG - Intronic
1060504423 9:124187471-124187493 CTCACTCTAGTTGGAGGGTGGGG - Intergenic
1060740299 9:126093401-126093423 CTGGCTGCAGAGGGAGAGTGAGG + Intergenic
1060970734 9:127736169-127736191 CTTACTCCAGTGGGTGGGGGAGG - Intergenic
1061584702 9:131558260-131558282 CTGAGTCCAGAGAAAGGGTCTGG - Intergenic
1062274309 9:135723602-135723624 CTGCCTCCAGAGGGACCCTGGGG + Intronic
1062388558 9:136324981-136325003 CTGACTCCCAAAGGGGGGTGAGG - Intergenic
1062468259 9:136691050-136691072 CTGACTCCCTAGGGAGAGTGTGG - Intergenic
1185762504 X:2699584-2699606 CTCACGCCTGAGGGAGGCTGAGG - Intronic
1186826277 X:13343213-13343235 CTGGATCCAGAGGGAGAGAGTGG + Intergenic
1190076561 X:47321546-47321568 CTGACTCTCGGGGGAGGGAGAGG - Intergenic
1195957347 X:110345570-110345592 GACACTGCAGAGGGAGGGTGTGG + Intronic
1198807996 X:140508144-140508166 CTGGCTCCAGTCGGAGGGAGCGG - Intergenic
1198934880 X:141895246-141895268 CTGACAGCAGAGGCAGCGTGGGG - Intronic
1199606617 X:149584102-149584124 CTGACACAAGGGGCAGGGTGGGG + Intronic
1199632506 X:149785266-149785288 CTGACACAAGGGGCAGGGTGGGG - Intronic
1201754377 Y:17470159-17470181 CTGTCTCAAGAGGGAGGCTGAGG + Intergenic
1201847175 Y:18435826-18435848 CTGTCTCAAGAGGGAGGCTGAGG - Intergenic