ID: 1019355973

View in Genome Browser
Species Human (GRCh38)
Location 7:579155-579177
Sequence ACTCCAGAGGGAGGGTGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 693
Summary {0: 1, 1: 0, 2: 7, 3: 59, 4: 626}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019355959_1019355973 22 Left 1019355959 7:579110-579132 CCCCATGGAGGCCCCGGACGGGC 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1019355973 7:579155-579177 ACTCCAGAGGGAGGGTGAGGCGG 0: 1
1: 0
2: 7
3: 59
4: 626
1019355953_1019355973 29 Left 1019355953 7:579103-579125 CCACCCACCCCATGGAGGCCCCG 0: 1
1: 0
2: 3
3: 60
4: 464
Right 1019355973 7:579155-579177 ACTCCAGAGGGAGGGTGAGGCGG 0: 1
1: 0
2: 7
3: 59
4: 626
1019355964_1019355973 10 Left 1019355964 7:579122-579144 CCCGGACGGGCGTGCGGTCACAG 0: 1
1: 0
2: 1
3: 3
4: 58
Right 1019355973 7:579155-579177 ACTCCAGAGGGAGGGTGAGGCGG 0: 1
1: 0
2: 7
3: 59
4: 626
1019355961_1019355973 20 Left 1019355961 7:579112-579134 CCATGGAGGCCCCGGACGGGCGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1019355973 7:579155-579177 ACTCCAGAGGGAGGGTGAGGCGG 0: 1
1: 0
2: 7
3: 59
4: 626
1019355956_1019355973 25 Left 1019355956 7:579107-579129 CCACCCCATGGAGGCCCCGGACG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1019355973 7:579155-579177 ACTCCAGAGGGAGGGTGAGGCGG 0: 1
1: 0
2: 7
3: 59
4: 626
1019355960_1019355973 21 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355973 7:579155-579177 ACTCCAGAGGGAGGGTGAGGCGG 0: 1
1: 0
2: 7
3: 59
4: 626
1019355963_1019355973 11 Left 1019355963 7:579121-579143 CCCCGGACGGGCGTGCGGTCACA 0: 1
1: 0
2: 0
3: 4
4: 23
Right 1019355973 7:579155-579177 ACTCCAGAGGGAGGGTGAGGCGG 0: 1
1: 0
2: 7
3: 59
4: 626
1019355955_1019355973 26 Left 1019355955 7:579106-579128 CCCACCCCATGGAGGCCCCGGAC 0: 1
1: 0
2: 1
3: 19
4: 153
Right 1019355973 7:579155-579177 ACTCCAGAGGGAGGGTGAGGCGG 0: 1
1: 0
2: 7
3: 59
4: 626
1019355965_1019355973 9 Left 1019355965 7:579123-579145 CCGGACGGGCGTGCGGTCACAGG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1019355973 7:579155-579177 ACTCCAGAGGGAGGGTGAGGCGG 0: 1
1: 0
2: 7
3: 59
4: 626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019355973 Original CRISPR ACTCCAGAGGGAGGGTGAGG CGG Intronic
900091290 1:921898-921920 CCTCCAGGGGCTGGGTGAGGAGG - Intergenic
900155181 1:1201043-1201065 ACCCCAGCGGGAGGTTGGGGCGG + Intergenic
900197372 1:1383382-1383404 CAGCAAGAGGGAGGGTGAGGAGG + Intergenic
901105187 1:6749942-6749964 ACTCAGGAGGAAGGTTGAGGTGG - Intergenic
901212296 1:7533477-7533499 ACTCCGAAGGGAGGTAGAGGTGG + Intronic
901578479 1:10220260-10220282 ACTCCAGAGGCTGAGGGAGGAGG + Intronic
901736712 1:11317213-11317235 ACTCAGGAGAGAGGCTGAGGCGG - Intergenic
902530723 1:17089163-17089185 CCTCCCAAGGGAGGATGAGGTGG - Intronic
902830465 1:19009190-19009212 AGGCCAGTGGGAGGGTGGGGGGG - Intergenic
903027743 1:20441777-20441799 ACTCTACAGGCATGGTGAGGAGG + Intergenic
903811335 1:26036529-26036551 ACTCCAGAGGGTGAGGGTGGTGG + Intergenic
903981094 1:27188828-27188850 AATCCTGTGGGAGGCTGAGGAGG - Intergenic
904360848 1:29970936-29970958 ACTCCAGAGAGAGGGCGAGGTGG - Intergenic
904742459 1:32688866-32688888 ACTCCAGAGGCCGGGTGCAGTGG - Intronic
905178620 1:36153400-36153422 AGTCCACAGGGAGTGTGCGGAGG - Intronic
905407728 1:37747261-37747283 ACTTCAGAGGTTGGGTGGGGTGG + Intronic
905914933 1:41678248-41678270 GCTCCAGAGAGAGGCTGAGTTGG + Intronic
906049155 1:42856467-42856489 AATCCAGAGAGAGGGTGGGGAGG - Intergenic
906580890 1:46934509-46934531 ACTACAGAAGGAGGGGGAGCTGG - Exonic
906602833 1:47144385-47144407 ACTACAGAAGGAGGGGGAGCTGG + Exonic
907253441 1:53159533-53159555 ACTCCAGGCAGAAGGTGAGGGGG - Intergenic
907774103 1:57496219-57496241 AGTGCAGAGGCAGGGTGGGGAGG - Intronic
907794501 1:57701538-57701560 ACACCAGGGGTAGGGGGAGGAGG + Intronic
908542721 1:65136917-65136939 ACTCCAGAGGGTGGGGGCCGGGG + Intergenic
909392798 1:75135541-75135563 CTTCCAGAGGGAGGGAGAAGGGG + Intronic
909479195 1:76113334-76113356 ACGGGAGAGGGAGGGGGAGGGGG + Intronic
909593274 1:77376293-77376315 AATCCAGAGGGAGGGCAAGTAGG + Intronic
910356269 1:86359769-86359791 AATCCACTGGGAGGCTGAGGTGG - Intronic
911611952 1:99967871-99967893 ACTCATGAGGGAGGCTGAGGTGG - Intergenic
912554916 1:110508808-110508830 ACACCAGAGGGAGGGCAAAGAGG + Intergenic
912780751 1:112545228-112545250 ACTCCAGAAGGTAGGAGAGGGGG - Intronic
912975325 1:114324306-114324328 ACCACAGTGGGAAGGTGAGGAGG - Intergenic
912987860 1:114453002-114453024 AGTCCAGAGCGAGGAAGAGGGGG + Intronic
912989028 1:114465518-114465540 ACTCTAAAAGAAGGGTGAGGTGG + Intronic
913532065 1:119740532-119740554 CTTGCAGAGGGAGGGGGAGGAGG + Intronic
914430596 1:147617706-147617728 ATTCCAGAGAGTAGGTGAGGAGG + Intronic
914832654 1:151181846-151181868 AATCCAGAGGGAGGGCATGGCGG - Intronic
914876492 1:151516238-151516260 ACTCCATGGGGAGGTTGAGTTGG + Intronic
915132743 1:153707045-153707067 ACTCCAAATGGAGGGGTAGGAGG - Intergenic
915393166 1:155562479-155562501 CCTCCAGAGGGAGGGAGCGAAGG + Exonic
915513919 1:156401841-156401863 AGCCCAGAGGGAAGGGGAGGAGG + Intergenic
915549890 1:156625649-156625671 CCGCCGGGGGGAGGGTGAGGCGG + Exonic
917539273 1:175897722-175897744 ATCCCTGAGGGAGTGTGAGGGGG + Intergenic
917817570 1:178725725-178725747 ACCCAAGAGGGAGAGCGAGGCGG - Intronic
918009258 1:180571472-180571494 ATTCCAGAGGCAGGTTGAGAAGG + Intergenic
918072567 1:181143693-181143715 ACTTCAGAGGCAGGCTGGGGAGG - Intergenic
918582383 1:186146196-186146218 ACTCCAGACTGAAGGTAAGGTGG + Intronic
919515041 1:198511763-198511785 CCTCCGGAGGGATGGTGAGGGGG + Intergenic
920175990 1:204102300-204102322 ACCCCAGAGGGAGAGGAAGGTGG - Intronic
920960021 1:210655809-210655831 ACTGCAGAAGCAGGGAGAGGAGG - Intronic
921219784 1:212965166-212965188 ACCCCATTGGGAGGCTGAGGTGG - Intronic
921569463 1:216761049-216761071 TCCCCAGGGGGAGGTTGAGGTGG - Intronic
922239768 1:223748072-223748094 ACTGCAGATGGAGGGGAAGGTGG - Intronic
922282412 1:224138825-224138847 ACTCCAGCTGGAGGCTGAGGTGG - Intronic
922345404 1:224692191-224692213 ACTCAGGAGGGAGGGTGAGGTGG + Intronic
922876820 1:228946231-228946253 TCTCCAGAGAGAGGGTGAGGAGG - Intergenic
923033621 1:230268751-230268773 CCTCCTGAGGGCAGGTGAGGAGG - Intronic
923341089 1:233007785-233007807 ACTGCTCAGGGAGGCTGAGGTGG - Intronic
924022268 1:239796846-239796868 ACTCCAAAGGGTGGGAGAGTGGG - Intronic
924023462 1:239809305-239809327 ACTTCAGAGGCCGGGTGCGGTGG - Intronic
924099580 1:240589721-240589743 ACTCAGGAGGGAAGGTGATGTGG + Intronic
924145933 1:241074692-241074714 CCTCTGGAGTGAGGGTGAGGAGG - Intronic
924553332 1:245098372-245098394 CCTAAAGAGGGAGGGTGAGTAGG + Intronic
1063238368 10:4142520-4142542 ACTGCACAGGGTGGGTAAGGTGG - Intergenic
1063744085 10:8859736-8859758 ACTTCACAGGGAGGCTGAGAAGG - Intergenic
1065004463 10:21366656-21366678 ATTTCAGTGGGAGGGTGGGGAGG + Intergenic
1065875566 10:29994579-29994601 GCTCCAGGGGGAGGGTGCAGTGG - Intergenic
1066470813 10:35695987-35696009 TGTCCAGAGGCAGGGTGCGGTGG - Intergenic
1067672782 10:48340386-48340408 ACTCCAAAAGGAGGCTGAGGGGG + Intronic
1068294543 10:55052601-55052623 ACTCACTAGGGAGGCTGAGGTGG + Intronic
1069079340 10:64071054-64071076 ACTCCAAAAGGAGGGAGAGGAGG - Intergenic
1069620959 10:69836955-69836977 AGGCCGGAGGGAGGGTGGGGCGG + Intronic
1069772392 10:70907988-70908010 AGTCCAGAGGCAGAGAGAGGAGG - Intergenic
1070051965 10:72898176-72898198 ACTTCAGAGGCTGGGTGGGGAGG + Intronic
1070521431 10:77256998-77257020 ACTCCAGAGGGTGAGTCAGGAGG + Intronic
1070799945 10:79239451-79239473 CGCTCAGAGGGAGGGTGAGGTGG - Intronic
1070808954 10:79287940-79287962 ATTCCAGTGCCAGGGTGAGGGGG + Intronic
1071440862 10:85692552-85692574 ACACAGGAGGGAGGCTGAGGTGG + Intronic
1072116424 10:92374473-92374495 ACTCCAAAAGGAGGGAGGGGAGG - Intergenic
1072583148 10:96757720-96757742 ATCCCAGCGGGAGGCTGAGGCGG + Intergenic
1072680595 10:97503422-97503444 ACTCCAGGGAGAGGTAGAGGTGG + Intronic
1073301324 10:102472826-102472848 ACCCGACAGGGATGGTGAGGAGG - Intronic
1073458927 10:103654351-103654373 ACTCCTGAGGGTCTGTGAGGTGG - Intronic
1074144206 10:110702072-110702094 ATTTCAGAGGGAAGGTGAGGAGG - Intronic
1074550107 10:114434851-114434873 ACCACAGAGGAAGGATGAGGTGG - Intronic
1076256623 10:129031662-129031684 ACTCAGGAAGGAGGCTGAGGTGG + Intergenic
1076522064 10:131087676-131087698 CCCCCACAGGGAGGATGAGGGGG - Intergenic
1076533344 10:131160061-131160083 ACCATAGAGGGAGGGAGAGGTGG - Intronic
1076664435 10:132078097-132078119 ACACAAGAGGCTGGGTGAGGTGG - Intergenic
1076773407 10:132679472-132679494 ACCCCAGCGGGAGGAGGAGGTGG + Intronic
1077046992 11:551109-551131 CCTGCAGGGGGAGGGGGAGGGGG - Exonic
1077332155 11:1988495-1988517 ACTGCATTGGGAGGGTGAGGAGG + Intergenic
1077351531 11:2095307-2095329 GCTGGAGAGGGAGGTTGAGGTGG - Intergenic
1077537011 11:3129273-3129295 ACTTCTGAGGCAGGGTGAGGAGG + Intronic
1078040334 11:7855759-7855781 ACTCTAGGAGGAGGGTGATGAGG + Intergenic
1079204785 11:18405035-18405057 TCTCAAGTGGGAGCGTGAGGGGG - Intronic
1079346058 11:19653358-19653380 GCTTCAGAGGGAGAGTAAGGAGG + Intronic
1079799705 11:24853970-24853992 CCTCCAGAGGGAGGAACAGGCGG - Intronic
1079846905 11:25483853-25483875 ACTCAGGAGGAAGGGTGAAGTGG + Intergenic
1079932744 11:26585469-26585491 GCAACAGAGGGATGGTGAGGAGG - Intronic
1080080631 11:28214279-28214301 AGTCCTGTGGGAGGCTGAGGTGG - Intronic
1080311930 11:30904570-30904592 ACTCCAGATGGTGAATGAGGTGG + Intronic
1081164014 11:39786179-39786201 AGTCCAGAGGAGGGCTGAGGTGG + Intergenic
1082095447 11:48126009-48126031 ATTCCAGAGGGTGGGTTAGTTGG + Intronic
1083027080 11:59559999-59560021 ACCCAAGAGGGAGGGTCAGCAGG + Intergenic
1083263977 11:61537695-61537717 AGGCAAGAGGGAGGTTGAGGGGG + Intronic
1083538697 11:63495577-63495599 ACTGCAAAGGGAGGAAGAGGTGG + Intergenic
1083680602 11:64350010-64350032 GCTCCACACGGAGGGTGGGGTGG + Intronic
1083757109 11:64797531-64797553 ACTCCTGTGGGAGGGAGATGAGG + Exonic
1083802169 11:65053133-65053155 ACTGCAGTGTGAGGGAGAGGAGG + Intronic
1083864396 11:65445808-65445830 ACTCCTGTGGGAGCGGGAGGGGG + Intergenic
1083950039 11:65949093-65949115 ACTCCAGAGGCTGAGTCAGGAGG + Intronic
1083992842 11:66257633-66257655 GCTCCAGCGGGAGGGGGACGGGG - Intronic
1084224315 11:67706138-67706160 AGTTCTGAGGGAGGCTGAGGTGG - Intergenic
1084667115 11:70582435-70582457 ACTCCACAGGGAAGCTGAGTGGG - Intronic
1084781695 11:71413963-71413985 CCTGCAGAGGGAGTGGGAGGTGG + Intergenic
1084863576 11:72038635-72038657 ATTTCAGGGGGAGGGTGGGGAGG - Intronic
1086041869 11:82488885-82488907 ACTCAGGAGGAAGGGTGAGAGGG - Intergenic
1087093755 11:94300715-94300737 ACTCGGGAGGGAGGCTGAGGTGG + Intergenic
1087327280 11:96739033-96739055 ACTGAAGAGGGAGGCTGAAGAGG - Intergenic
1087773325 11:102234979-102235001 CTTCCAGAGGGAGGGGGAGGGGG + Intergenic
1088244163 11:107800688-107800710 ACTCCAGAGAGAGACTGAAGTGG - Intronic
1088781061 11:113134717-113134739 ATTCCAGTGTGAGGGTGATGGGG - Intronic
1088851678 11:113708445-113708467 ACTGCAGAGTTGGGGTGAGGGGG - Intergenic
1089203075 11:116736890-116736912 ACACCAGAGGGAGAGGCAGGAGG - Intergenic
1090945250 11:131424020-131424042 ACTCAGAAGGGAGGGTGAAGTGG - Intronic
1091119013 11:133041436-133041458 ACTGCAGAGGGTGGGAGAGGTGG - Intronic
1202815136 11_KI270721v1_random:43671-43693 ACTGCATTGGGAGGGTGAGGAGG + Intergenic
1091666806 12:2424750-2424772 TGTCCTGTGGGAGGGTGAGGAGG + Intronic
1091760265 12:3082633-3082655 ACTTGTGAGGGATGGTGAGGAGG + Intronic
1091891159 12:4055609-4055631 ATGCCAGAGGGAAGGAGAGGAGG - Intergenic
1091913151 12:4248120-4248142 ATTGCAGAGGCTGGGTGAGGGGG + Intergenic
1092016475 12:5163136-5163158 ACTCCAGGAGGAAGGTGGGGTGG + Intergenic
1092124486 12:6065795-6065817 AGCCCAGAGGCAGGATGAGGTGG + Intronic
1092143436 12:6199607-6199629 ACGCAGGAGGGAGGGTGGGGTGG + Intergenic
1092230794 12:6774244-6774266 TGCCCAGAGGGAGGGGGAGGGGG + Intronic
1092522663 12:9290168-9290190 AGGCAAGAGGGAGGGAGAGGAGG - Intergenic
1092544622 12:9441729-9441751 AGGCAAGAGGGAGGGAGAGGAGG + Intergenic
1094508328 12:31080341-31080363 AGGCAAGAGGGAGGGGGAGGAGG - Intronic
1094607947 12:31965469-31965491 ACTCCACAGGGTGGGAGCGGGGG - Intronic
1095099706 12:38167582-38167604 ACTTCAGAGGCTGGGTGTGGTGG - Intergenic
1095426435 12:42079479-42079501 ACTCCAGAGGCTGGGGCAGGAGG - Intergenic
1096189876 12:49609572-49609594 TCTACACAGGGAGGGTGGGGTGG - Intronic
1096240944 12:49960084-49960106 AGTCCAGCGGGAGGGTGCAGAGG - Intergenic
1096497339 12:52046058-52046080 ACCCCAGGGGAAGGGTGTGGAGG + Intronic
1096614061 12:52821809-52821831 ACAGCAGAGGTGGGGTGAGGAGG + Exonic
1096758316 12:53818438-53818460 ACTCCAGGGGGATGGAAAGGAGG - Intergenic
1097813471 12:64044982-64045004 ACATCAGAGGTTGGGTGAGGTGG - Intronic
1098189739 12:67935452-67935474 AGTACTTAGGGAGGGTGAGGTGG + Intergenic
1099056824 12:77852424-77852446 ACTTGAAAGGGAGGCTGAGGTGG + Intronic
1099972279 12:89512645-89512667 ACTCCAGAGGCTGAGGGAGGCGG + Intronic
1100471380 12:94896417-94896439 AAACCAGAGGGAGGGTAAGAGGG - Intergenic
1100612792 12:96205584-96205606 ATTACAGAGGGAGGCTGAGGTGG - Intronic
1101439416 12:104692267-104692289 ACTTCAGAGTGAGGATGAGCTGG - Intronic
1101652194 12:106687434-106687456 ATTCCAGCTGGAGGCTGAGGCGG + Intronic
1102294882 12:111728796-111728818 ACTCAAGAGGGAGAGGCAGGAGG - Intronic
1103512381 12:121484202-121484224 AGTCCATAAGGAGGGTGAGGCGG + Intronic
1103516076 12:121509347-121509369 GCTGCAGAGGGTGGGTGGGGTGG - Intronic
1103721155 12:122976280-122976302 ACTCCAGGGGAAGGAGGAGGAGG - Exonic
1103778873 12:123386288-123386310 ACAGGAGAGGGAGGGTGAAGCGG - Intronic
1103958927 12:124595357-124595379 CCTCCATTGGGAGGCTGAGGTGG + Intergenic
1104404190 12:128504044-128504066 ACGTGAGAGGGAGGGAGAGGGGG - Intronic
1104504544 12:129318991-129319013 TCTCCAGGCGGAGGGTGAGATGG + Intronic
1104687823 12:130800411-130800433 ACTCCTCTGGGAGGCTGAGGTGG - Intronic
1104732658 12:131116571-131116593 GCTCCAGAGGAAGGAGGAGGAGG - Intronic
1106319285 13:28623336-28623358 AATCCAGAGGGAGGGAGGAGAGG - Intergenic
1107267969 13:38579949-38579971 ACTCCAGAGGCAGAGGTAGGAGG + Intergenic
1107719150 13:43229743-43229765 ACTCCAAAGGGAGAGCCAGGGGG + Intronic
1108024254 13:46162269-46162291 ACGGGAGAGGGAGGGGGAGGGGG - Intronic
1108039783 13:46329422-46329444 AGTCCAGGGGGAGGGTAGGGGGG + Intergenic
1108249557 13:48551038-48551060 GCTCCAGAGGGAGGATGAGGGGG + Intergenic
1108287624 13:48924459-48924481 ACTCGGGAGGGAGGCTGAGGTGG - Intergenic
1108868595 13:54952962-54952984 ACTTGGGAGGGAGGCTGAGGTGG + Intergenic
1109646414 13:65264271-65264293 TCTGCACAGGAAGGGTGAGGTGG - Intergenic
1110226476 13:73124804-73124826 ACCCAATAGGGAGGCTGAGGTGG - Intergenic
1110876335 13:80515289-80515311 ACTCAAGGCGGAGGGTGAGAAGG - Intergenic
1111360409 13:87168296-87168318 GCACGGGAGGGAGGGTGAGGTGG - Intergenic
1111459449 13:88520164-88520186 ACTCGGGAGGGAGGCTGAGGCGG + Intergenic
1112104090 13:96221511-96221533 ACTGCAGTGGGATGGGGAGGAGG + Intronic
1113360362 13:109625346-109625368 ACTCTGGAAGGAGGCTGAGGTGG - Intergenic
1113804069 13:113103515-113103537 ACTCAAGAGTGACTGTGAGGCGG + Intergenic
1113920430 13:113905166-113905188 AGTGAAGAGGGAAGGTGAGGAGG - Intergenic
1113946514 13:114047647-114047669 AATCCAGAGGGTGGATGAGGCGG + Intronic
1114082839 14:19216424-19216446 ACTTGGGAGGGAGGCTGAGGTGG + Intergenic
1114349677 14:21836119-21836141 CCCACAGAGGGAGGTTGAGGGGG + Intergenic
1114358104 14:21937260-21937282 ACTCCAAAAGGAGGGAGAGATGG - Intergenic
1115321007 14:32078211-32078233 GCTGAAGAGGGAGGGTGAGAGGG - Intronic
1116781346 14:49240888-49240910 TCTGCAGAGGAAGGGTGGGGTGG + Intergenic
1117068082 14:52030740-52030762 ACTCCAGAGGGTGAGGCAGGAGG + Intronic
1117552504 14:56850448-56850470 ACTCCAGAGGCAGAGGCAGGAGG - Intergenic
1118139259 14:63062281-63062303 AATGCAGAGGGTGTGTGAGGAGG - Intronic
1118781194 14:69009034-69009056 AGTCCAGAGGCCGGGTGCGGTGG + Intergenic
1119216939 14:72876395-72876417 GCTCCAGGGGGAGGGTGGGGTGG - Intronic
1120699768 14:87686093-87686115 CCACCTAAGGGAGGGTGAGGTGG - Intergenic
1120825383 14:88950262-88950284 ATTCCTGAGGGTGGGTGTGGTGG + Intergenic
1120830609 14:88994520-88994542 TCTCCAGAGGCTGGGTGCGGTGG + Intergenic
1120860821 14:89253713-89253735 ACTAGAGAGGGAGGAGGAGGAGG - Intronic
1120907122 14:89630439-89630461 AGGCCAGAGGGATGGAGAGGAGG - Intronic
1120922327 14:89766220-89766242 GCTCCAGAGCGGGGGTGAGGTGG - Intergenic
1121373175 14:93379699-93379721 ACTGCAGGGGGAGGGTGGGAGGG + Intronic
1121536436 14:94694362-94694384 AGTCTTGAGGGAGGGTGGGGAGG - Intergenic
1121894526 14:97634183-97634205 ACCCCAGGGGGAGAGTGAAGTGG - Intergenic
1122060450 14:99133622-99133644 AGTGCAGAGGGTGGGTGGGGAGG - Intergenic
1122303979 14:100749819-100749841 ACTCCTGGTGGAAGGTGAGGAGG + Intergenic
1122571983 14:102710205-102710227 ATTCCAGAGGCAGTGCGAGGTGG + Intronic
1122802286 14:104237739-104237761 ATTCCAGAGAGAGGGTCCGGAGG - Intergenic
1123049624 14:105534729-105534751 ACACCAGAGGGAGGCAGACGGGG + Intergenic
1123217738 14:106827734-106827756 ACTCCAGAGGGAGGTTCACATGG - Intergenic
1202840212 14_GL000009v2_random:114427-114449 GCACAGGAGGGAGGGTGAGGTGG + Intergenic
1123801799 15:23829413-23829435 AGTTCAGTGGGAGGATGAGGAGG - Intergenic
1124391224 15:29259643-29259665 AATCAGGAGGGAGGGTGAGCAGG - Intronic
1124549288 15:30663377-30663399 ACTCCAGTGAGAGAGAGAGGGGG - Intronic
1124607718 15:31183960-31183982 AGACAAGAGGGAGGGGGAGGGGG - Intergenic
1125024839 15:35019610-35019632 ACTCCAGTTGGAGGAGGAGGAGG - Intergenic
1125534659 15:40436303-40436325 TCTCCAGAGGGAGAGCGTGGAGG - Intergenic
1126837893 15:52685976-52685998 ATCCCAGGGGGAGGCTGAGGTGG - Intronic
1126858573 15:52862168-52862190 ACTTCAGAGGGAGGGAGGGAGGG - Intergenic
1127248184 15:57201569-57201591 ACTCCAGAGGTAGATTGAGTGGG + Intronic
1128625066 15:69193076-69193098 AATTCAGGGGGAGGGGGAGGGGG - Intronic
1128647295 15:69387104-69387126 CCTCCAGGGGCTGGGTGAGGTGG - Intronic
1128743892 15:70100530-70100552 AGTCCAGAGGGAGACTGAGAGGG - Intergenic
1128797208 15:70474652-70474674 ACTTGAGAGGGAGGGAGGGGTGG + Intergenic
1128965232 15:72051753-72051775 ACACTAGAGGGAGGCTGAGGGGG + Intronic
1129411096 15:75350725-75350747 ACTCCCCAGGAAGGCTGAGGTGG - Intronic
1129455287 15:75673458-75673480 ACTCCCCAGGGAGGGTGACCAGG - Intergenic
1129467680 15:75733002-75733024 ACTGCAGAGGGTGGGTCTGGAGG + Intergenic
1130060295 15:80564675-80564697 ACTAGAGAGGGAGGGTGGGAGGG - Intronic
1130111849 15:80971835-80971857 ACTTGGGAGGGAGGCTGAGGTGG + Intronic
1130320165 15:82835011-82835033 TCACCAGAGTGAGGGTGATGAGG - Exonic
1130730242 15:86484294-86484316 ACTTTGGAGGGAGTGTGAGGTGG + Intronic
1130996857 15:88908894-88908916 CCTCCAGAAGGAGGGGGCGGGGG - Intronic
1131240973 15:90743106-90743128 ACTACTCAGGGAGGCTGAGGTGG - Intronic
1131833020 15:96366274-96366296 ACTCCAGGGGGCGGGGGACGAGG + Intergenic
1132665634 16:1080240-1080262 GGGCCAGATGGAGGGTGAGGCGG - Intergenic
1133483680 16:6197194-6197216 CCACCAGAGGGAGGGTGCAGAGG - Intronic
1133592962 16:7263785-7263807 GCTCAAGAGGTAGGCTGAGGCGG + Intronic
1133807723 16:9138315-9138337 ACTGCAGATGTTGGGTGAGGGGG - Intergenic
1133978069 16:10614305-10614327 CCTCCTGCGGGAGGCTGAGGTGG + Intergenic
1134274747 16:12766143-12766165 ACCCCAAAGGGAGGCAGAGGCGG + Intronic
1134587443 16:15424282-15424304 CCTCCATTGGGAGGCTGAGGTGG - Intronic
1135269923 16:21060397-21060419 AGCCCAGAGGGAGGGAGAGTGGG + Intronic
1135548911 16:23383624-23383646 GCTACTGAGGGAGGCTGAGGTGG - Intergenic
1136054848 16:27680691-27680713 TTTGCAGAGGGAGGGTGGGGCGG + Intronic
1136244991 16:28969856-28969878 ACTCAGGAAGGAGGCTGAGGTGG + Intergenic
1136631929 16:31493879-31493901 ACACCAGAGGGAGCATCAGGAGG + Exonic
1138027366 16:53532683-53532705 AGTCTAGAGGGAAGGGGAGGTGG - Intergenic
1139351648 16:66340156-66340178 ACTCCATAGGCTGGGTGCGGTGG - Intergenic
1139420308 16:66845489-66845511 AGACCAGAGGGAGGGTGCTGTGG + Intronic
1139851161 16:69952178-69952200 ACCCCAGAGGGCGGCTCAGGAGG + Intronic
1139880139 16:70175090-70175112 ACCCCAGAGGGCGGCTCAGGAGG + Intronic
1140372370 16:74420427-74420449 ACCCCAGAGGGCGGCTCAGGAGG - Intronic
1140885027 16:79235451-79235473 ACACTGGAGGGAGGCTGAGGTGG + Intergenic
1140891374 16:79288096-79288118 AGGGCAGAGGGAGGGTGAAGGGG + Intergenic
1141543036 16:84741550-84741572 ACTCCAGAGGCTGGGGGAGCTGG - Intronic
1141893430 16:86943226-86943248 CCTGCAGAGGCTGGGTGAGGAGG - Intergenic
1142028183 16:87825401-87825423 CCCCCAGAGAGAGGATGAGGGGG - Intergenic
1142103570 16:88289686-88289708 ACTACAGAGAGAGGGTGCGTAGG + Intergenic
1142205797 16:88782549-88782571 ACTGGAGAGGGAGGGCGTGGGGG + Intronic
1142263371 16:89052649-89052671 ACTCCGGAGGCACGGGGAGGAGG - Intergenic
1142721246 17:1777329-1777351 AGTCCAGCGGGAAGGTGAGGTGG - Exonic
1142737980 17:1913648-1913670 ACTCAGGAGGGAGGCTGGGGAGG + Intergenic
1143199597 17:5103087-5103109 AGTCTAGAGGGAGGGTGGGCTGG + Intergenic
1143627254 17:8117708-8117730 CCTCAATAGGGAAGGTGAGGAGG + Intronic
1143655755 17:8292658-8292680 ACCCTAGAGGAAGTGTGAGGGGG - Intronic
1144666718 17:17107161-17107183 ACTCTAAAGGGAGGGGCAGGGGG - Intronic
1144709562 17:17392463-17392485 TCTCCAGAGTGTGGGTGTGGTGG + Intergenic
1144777259 17:17791189-17791211 ACTCCAGAGAGCAGGAGAGGTGG + Intronic
1145109305 17:20147927-20147949 ACTTGGGAGGGAGGCTGAGGTGG + Intronic
1145721425 17:27076520-27076542 CTTCCTGAGGGAGGGTGAAGTGG + Intergenic
1146058854 17:29594069-29594091 CCTCCCGAGTGAGGGTGCGGAGG + Intronic
1146182646 17:30707840-30707862 ACCCCAGAGAGGGGGTGCGGGGG + Intergenic
1146830182 17:36062138-36062160 TCTCTAGAGGGAAGGTGAAGTGG + Intergenic
1147905145 17:43817899-43817921 ACTCCAGAGGAAGGAGGGGGTGG - Intronic
1148321452 17:46757744-46757766 ATCCGAGAGGGAGGCTGAGGTGG + Intergenic
1148624605 17:49059430-49059452 ATCCCAGCGGGAGGCTGAGGTGG + Intergenic
1150739871 17:67770690-67770712 ACACCATAGGGAGAGTGAAGGGG + Intergenic
1150820587 17:68431234-68431256 ACCACAGAGGAAGGGAGAGGCGG + Intronic
1151092802 17:71461966-71461988 AAGCCAGAAGGGGGGTGAGGGGG - Intergenic
1151611269 17:75177072-75177094 ACTCCAGCCGGAGGTTGAGGGGG + Intergenic
1152242368 17:79167320-79167342 ACCCCAGAGGGAGGGGAAGAAGG - Intronic
1152376134 17:79919900-79919922 ACTCACGGGGGTGGGTGAGGTGG + Intergenic
1152510063 17:80780761-80780783 CCCCCGGGGGGAGGGTGAGGGGG - Intronic
1152784984 17:82243056-82243078 AGTACAGAGGGAGGTTGGGGTGG - Exonic
1153513169 18:5877681-5877703 ACTCCACAGTGTGGGTAAGGAGG + Intergenic
1154305357 18:13226869-13226891 CCTAAAGAGGGAGGATGAGGAGG - Intronic
1155315005 18:24562811-24562833 ACTGCAGAGTGGGGGTGAGGAGG + Intergenic
1155369055 18:25078871-25078893 AGTGCAGAGGGCGGGGGAGGTGG + Intronic
1156149611 18:34225364-34225386 ACTCAAGAGGGATGGAGAGAGGG - Intergenic
1157692889 18:49698283-49698305 GCTTCAGAGGGAGGGAGAGCAGG - Intergenic
1159022375 18:63154352-63154374 ACTCCAGAGGGAAGCTGAATGGG - Intronic
1159493086 18:69163484-69163506 ATTCCATAGGGAGGCCGAGGCGG - Intergenic
1160367056 18:78335440-78335462 AGGCCAGAGGGAGGAGGAGGAGG + Intergenic
1160977476 19:1800461-1800483 ACGCGACAGGGTGGGTGAGGGGG + Intronic
1161406625 19:4094711-4094733 CCCCCAGCGGGAGGGTGAGAGGG + Intronic
1161437620 19:4273161-4273183 ACATCAGAGGGATGGGGAGGAGG + Intergenic
1162306407 19:9876940-9876962 ACTTCAGAGGCTGGGTGCGGTGG + Intronic
1162600036 19:11661862-11661884 ACCCCAGAGGGAGGCTGAGGCGG - Intergenic
1162670889 19:12256953-12256975 ACACCTGTGGGAGGCTGAGGTGG - Intronic
1162794038 19:13077577-13077599 ACTGCAGAGGGAAGGGGCGGGGG - Intronic
1162818800 19:13210714-13210736 AGGCAAGAGGGAGAGTGAGGAGG + Intronic
1162912174 19:13853947-13853969 ATTCCAGAGGCTGGGCGAGGTGG - Intergenic
1162976175 19:14207966-14207988 ACCCCAGAGAGGGGGTGCGGGGG - Intergenic
1163554455 19:17984297-17984319 GCTCCAGAGGGAAGGAGATGGGG - Intronic
1163610627 19:18299546-18299568 AAGCCAGTGGGAGGGTGAGGAGG + Intergenic
1163786171 19:19275967-19275989 GCTGCAGAGGGAGGTTGGGGAGG - Intergenic
1164620706 19:29694645-29694667 TCCCCAGGGGGAGGGTGCGGAGG - Intergenic
1164861243 19:31563884-31563906 ACTCAGGAGGGAGGGTTTGGGGG + Intergenic
1165825724 19:38704772-38704794 TCTCCTGAGGGAGGTGGAGGAGG + Intronic
1165827298 19:38712661-38712683 ACTCCCGCGGGAGGGTGGGCAGG + Intronic
1166959507 19:46489206-46489228 ACTCTAGAGGGAGGCTGAAGTGG + Intronic
1167075537 19:47246453-47246475 ATTCAGGAGGGAGGCTGAGGTGG - Intergenic
1167657415 19:50774172-50774194 ACTCCTGTGGGAGGCTGAGCGGG + Intergenic
1167913850 19:52724799-52724821 TCACCAGAGTGAGGGAGAGGAGG - Intronic
1167921354 19:52785795-52785817 TCACCAGAGTGAGGGAGAGGAGG - Intronic
1168505360 19:56929249-56929271 AGTCCCAAGGGAGGCTGAGGCGG + Intergenic
1202653042 1_KI270707v1_random:23919-23941 GCACAAGAGGGAGGTTGAGGTGG + Intergenic
925184485 2:1837641-1837663 GCTCAATGGGGAGGGTGAGGCGG + Intronic
925246018 2:2383851-2383873 ACTCTAGGGGGAAGGTGAAGTGG - Intergenic
925291516 2:2751421-2751443 ATGCGAGAGGGAGGATGAGGCGG - Intergenic
925609159 2:5690388-5690410 CCACCGGAGGGAGGGTGGGGTGG - Intergenic
925646279 2:6040272-6040294 ATTCCAGAGCGAGGTAGAGGAGG - Intergenic
925948906 2:8893047-8893069 GCACCAGAGGCAGGGGGAGGGGG + Intronic
926826469 2:16910595-16910617 ACTCCAAAGGGTGGGAGAGTGGG - Intergenic
927667897 2:25044812-25044834 AGGGCAGAGGCAGGGTGAGGAGG - Intronic
927926947 2:27020137-27020159 ATTCCAGACAGAGGGTGAGTAGG + Intronic
928545603 2:32326631-32326653 ACTGGGGAGGGAGGGTAAGGGGG + Intergenic
928720480 2:34115136-34115158 ATTGCAGAGGGAAGGGGAGGGGG + Intergenic
928997303 2:37306694-37306716 GCTACTTAGGGAGGGTGAGGTGG + Intronic
930316811 2:49806732-49806754 ACTCCAAAAGCAGGGAGAGGTGG + Intergenic
930396863 2:50832542-50832564 ACTCCAGAGGGTGAGGCAGGGGG + Intronic
930597239 2:53403517-53403539 ACTCCAGATGGAGGCTCTGGGGG + Intergenic
930810121 2:55531480-55531502 AGTCCAGAGGAAGGGAGAGAAGG + Intronic
931489620 2:62730304-62730326 AATTCAGTGGGAGGGAGAGGGGG - Intronic
931715440 2:65025120-65025142 ACTCCAGAGGTTGGGGTAGGAGG + Intergenic
932621447 2:73266723-73266745 CCTCCAGAGGGTGGGTGGGCAGG - Intronic
933247651 2:79994014-79994036 ACTCCAGAGAGAGGATAAGGCGG - Intronic
933986342 2:87595239-87595261 AATCCAGAGGGAGGGCCAAGAGG + Intergenic
936307494 2:111355562-111355584 AATCCAGAGGGAGGGCCAAGAGG - Intergenic
936315726 2:111422712-111422734 ACTCCAGGGGGATGGAGCGGGGG - Intergenic
936491711 2:112978100-112978122 GCTCCAGAGGGAGGGAGAAGAGG - Intronic
936582603 2:113716482-113716504 ACTACACAGGGATGATGAGGAGG + Intronic
937077809 2:119119697-119119719 AGCCCAGAGTGAGGGTGAGTTGG - Intergenic
937485860 2:122314190-122314212 ACTTGGGAGGGAGGCTGAGGTGG + Intergenic
938422964 2:131158492-131158514 ACTACAGATGGAGGCTGAGGTGG + Intronic
938493737 2:131780195-131780217 ACTTGGGAGGGAGGCTGAGGTGG - Intergenic
939065116 2:137473911-137473933 ACTCCTGAAAGTGGGTGAGGAGG + Intronic
940293343 2:152098730-152098752 AGACCCGAAGGAGGGTGAGGAGG + Intronic
941827175 2:169912891-169912913 ACTTGGGAGGGAGGCTGAGGTGG - Intronic
942346582 2:175009299-175009321 ACTCCAGAGGCTGGGGTAGGAGG - Intergenic
942381821 2:175399561-175399583 ACCACAGAGGTGGGGTGAGGTGG + Intergenic
945798172 2:214390642-214390664 ACTCCATTGGGAGTGTGGGGAGG - Intronic
945893715 2:215458534-215458556 ACTCTGGTGGGTGGGTGAGGGGG + Intergenic
946007497 2:216538192-216538214 ACTCCAGTGGCTGGGTGCGGTGG - Intronic
946197509 2:218043919-218043941 AGTCCAGAAGGGGGCTGAGGAGG + Intronic
946371829 2:219285819-219285841 ACCCCAGAGGGAGGCCTAGGAGG + Exonic
946373836 2:219296645-219296667 ACTCCAGGGGGTTGGTGGGGTGG + Intronic
946693237 2:222325758-222325780 GCTACAAAGGGAGGCTGAGGAGG + Intergenic
948033094 2:234835857-234835879 ACTGCAGAGGGAGGCTGACAGGG - Intergenic
948033219 2:234836744-234836766 ACCCCAGAGGGAGAGGGAAGGGG + Intergenic
948111488 2:235459874-235459896 CCTCCAGAAGTAGGGTGAGTTGG + Intergenic
948460226 2:238125496-238125518 ACTGGGGAGGGAGGGTGATGGGG - Intronic
1168849366 20:966042-966064 AACCCAGAGGGAGCGTTAGGTGG + Intronic
1168948634 20:1781638-1781660 ACTAAAGAGGGAGGGTAAGAAGG + Intergenic
1169358024 20:4924283-4924305 ACTCCAGAGGGAGGACGGGGAGG - Intronic
1169515509 20:6312106-6312128 TCTTCACAGGAAGGGTGAGGTGG - Intergenic
1170001893 20:11623963-11623985 CCTACAGAGGGAGGAGGAGGGGG + Intergenic
1170141004 20:13124842-13124864 ACTAATGAAGGAGGGTGAGGAGG + Intronic
1170361871 20:15555134-15555156 ATCCCAGTGGGTGGGTGAGGAGG + Intronic
1170493728 20:16904161-16904183 GCTGGAGAGAGAGGGTGAGGTGG + Intergenic
1170773210 20:19352064-19352086 GCTGCACAGGGAGGATGAGGGGG + Intronic
1171499127 20:25579570-25579592 TCTCCAGAGGCAGGGTGGCGTGG - Intronic
1171849698 20:30299688-30299710 AATCCAGAGCCAGGCTGAGGTGG - Intergenic
1172114065 20:32563275-32563297 ACTCGGGAGGGAGAGTGGGGAGG + Intronic
1172271531 20:33658109-33658131 GCTCCAGAGGCAGTGTGAGAAGG - Intronic
1172279105 20:33698243-33698265 ACACCATGGGGAGGCTGAGGTGG - Intergenic
1172537488 20:35685264-35685286 ACTCAGGAAGGAGGCTGAGGTGG + Intronic
1172567149 20:35939357-35939379 GGTGCAGAGGGAGGGAGAGGTGG + Intronic
1172666561 20:36604622-36604644 TGTCCAGAGGCCGGGTGAGGTGG + Intronic
1172834016 20:37861230-37861252 ACTCCATGGGGTGGGTGAGGAGG - Intronic
1173184452 20:40829913-40829935 TCCCCAGAGCAAGGGTGAGGAGG - Intergenic
1174300771 20:49580470-49580492 ACTGTAGGGGGAGGGTGGGGAGG - Intergenic
1174347851 20:49944314-49944336 AATCCTGAGGGAGGCTGAGGTGG - Intronic
1174544063 20:51312064-51312086 ATTCCAAAGGGAGGGGGAGGAGG + Intergenic
1174920992 20:54701940-54701962 AGACCAGAGAGATGGTGAGGTGG + Intergenic
1175120015 20:56710187-56710209 ACACCTGTGGGAGGTTGAGGTGG - Intergenic
1175287544 20:57847201-57847223 ACTCATGATGGAGGGTGAAGGGG + Intergenic
1175566798 20:59986161-59986183 ATTCTAGAGGGAAGGTGAGCAGG + Intronic
1175813543 20:61872012-61872034 GCTGCAGAGGGAGGGCGAGGTGG + Intronic
1175920373 20:62447879-62447901 ACACCAGAGGGAGGGTGCGAAGG + Intergenic
1176599111 21:8775732-8775754 GCACAAGAGGGAGGTTGAGGTGG - Intergenic
1176614169 21:9014181-9014203 ACTTGGGAGGGAGGCTGAGGTGG + Intergenic
1176905619 21:14497031-14497053 AGCCCAGATGGAGAGTGAGGAGG - Intronic
1176943474 21:14951925-14951947 GCACCAGAGAGAGGATGAGGTGG + Intergenic
1177110983 21:17027816-17027838 ACTCAAGAGGGAGTCTGAGGTGG + Intergenic
1177557213 21:22707322-22707344 ACTCCAAAAGGAGGGGGAGATGG + Intergenic
1177862827 21:26474657-26474679 ACTTGAGAGGCAGGGTTAGGTGG - Intronic
1178123611 21:29494434-29494456 ACTCCTTTGGGAGGCTGAGGCGG + Intronic
1178541325 21:33453513-33453535 ATCCCAGAGGGAGGGTGCAGTGG + Intronic
1178947325 21:36959310-36959332 AGTCTAGAGGGGGGCTGAGGTGG - Intronic
1178976384 21:37224696-37224718 ACTACAGAGGCTGGGTGTGGTGG + Exonic
1179088404 21:38241307-38241329 ACTGCAGAGGGAGGGTGGCTTGG - Intronic
1179598824 21:42461905-42461927 CCATCAGAGGCAGGGTGAGGAGG + Intergenic
1179718768 21:43303706-43303728 ATTCCAGAGCGAGCGGGAGGTGG + Intergenic
1179732024 21:43373364-43373386 ACTGAAGAGGGTGAGTGAGGAGG - Intergenic
1179978506 21:44884477-44884499 ACCCCAGTGGGAGGCAGAGGGGG + Intergenic
1180085607 21:45506771-45506793 GCTCCAGAGGGAAGGTGGGAGGG - Intronic
1180154577 21:45971758-45971780 ACCCCAAAGAGAGGGTGCGGTGG - Intergenic
1180419319 22:12799169-12799191 GCACAAGAGGGAGGTTGAGGTGG + Intergenic
1180497940 22:15906245-15906267 ACTTGGGAGGGAGGCTGAGGTGG - Intergenic
1180622795 22:17172810-17172832 ACTGGAGAGGCAGGCTGAGGCGG + Intergenic
1180662190 22:17477569-17477591 ACTCCTGAGGGAGGGAGAGAGGG - Exonic
1181024739 22:20121651-20121673 ACTCAAGAGGCAGAGGGAGGAGG - Intronic
1181182598 22:21078371-21078393 AGGCCCAAGGGAGGGTGAGGAGG - Intergenic
1182245596 22:28955147-28955169 ACTCCAGAGGGTGAGGCAGGAGG - Intronic
1182567060 22:31208045-31208067 ACCCGGGAGGGAGGCTGAGGTGG + Intergenic
1183618238 22:38957823-38957845 GGTCCAGAGAGAGGGTCAGGAGG - Intronic
1183623507 22:38988182-38988204 GGTCCAGAGAGAGGGTCAGGAGG - Intronic
1184195121 22:42922490-42922512 ACTGCAGAGGTAGGCAGAGGTGG + Intronic
1184293841 22:43511729-43511751 GCTCCAGAGGGAGGGACATGGGG + Intergenic
1184394511 22:44225158-44225180 ATCCCAGCGGGAGGTTGAGGCGG - Intergenic
1185268814 22:49918942-49918964 ACCCCGGATGCAGGGTGAGGGGG - Intronic
950040404 3:9916152-9916174 AGTTCTGAAGGAGGGTGAGGCGG + Exonic
950230073 3:11268740-11268762 ACTCCATAGGCAGTGTGTGGTGG + Intergenic
950440629 3:13008211-13008233 ACCCCAGACGGAGGGTGACAAGG - Intronic
950713594 3:14831608-14831630 ACACCAGAGGGAGGGTAGGAGGG + Intronic
950977934 3:17269645-17269667 ACTCCAGAAGGAGGGAGGGAGGG - Intronic
950980102 3:17294326-17294348 ACTCCAGAGGCTGGGGCAGGAGG - Intronic
951957298 3:28271345-28271367 ACTCAATTGGGAGGCTGAGGTGG - Intronic
952367738 3:32689704-32689726 ACACCTGTGGGAGGCTGAGGTGG + Intronic
952736060 3:36692597-36692619 ACTCCAGAGGCTGAGTGGGGTGG + Intergenic
953222412 3:40984876-40984898 ACTCCAGGGAGAAGGTGTGGTGG + Intergenic
953246208 3:41196112-41196134 ACTGCAGAGCGAGGGAGGGGCGG - Intronic
953258566 3:41314359-41314381 ACTCCAAAAGGAGGGTGGGTGGG - Intronic
953398714 3:42593163-42593185 ATTACAGTGGGAGGCTGAGGCGG + Intronic
954624496 3:52015243-52015265 AGTCTAGAGGGAGGCTGATGTGG - Intergenic
954656269 3:52196082-52196104 ACTCCAGATGGAGGAAGAGGAGG - Intergenic
955070715 3:55570497-55570519 AGTGCAGAGGGAGGGCCAGGGGG + Intronic
955373852 3:58377529-58377551 ACTCGAGAGGCAGGCTGAGGTGG + Intronic
956715741 3:72078394-72078416 TTTTCAGAGGGAGGATGAGGAGG - Intergenic
956897401 3:73677323-73677345 ACTCTATTGGGAGGCTGAGGAGG - Intergenic
956970911 3:74524288-74524310 ATTCTAGAGGGAGGTGGAGGTGG + Intergenic
957422608 3:79991118-79991140 ACTCCACAGGGTGGGAGCGGTGG + Intergenic
958156433 3:89761543-89761565 TCTGCACAGGAAGGGTGAGGTGG + Intergenic
958930619 3:100204077-100204099 TCTCGAGAGGGAGGCTGAGGAGG + Intergenic
960497682 3:118394815-118394837 CCTGCAGAGGTGGGGTGAGGGGG + Intergenic
960638025 3:119803043-119803065 ACCCCAGAGGCCGGGTGTGGTGG + Intronic
960714243 3:120559902-120559924 AGTCCAGAGGCAGGGTGGGAGGG + Intergenic
961465762 3:127080589-127080611 GCTCCAGAGGAAGGGAAAGGAGG - Intergenic
962602904 3:137008322-137008344 ACTCAATAGGGAGGGGGATGGGG + Intronic
963116441 3:141734002-141734024 AATCCAGAAGCAGGGTGATGAGG + Intergenic
963836993 3:150067887-150067909 AATCCAGAGGGCGGCAGAGGTGG + Intergenic
963839648 3:150092611-150092633 ACTCCAGAGGCTGAGTCAGGAGG - Intergenic
966660759 3:182411991-182412013 ATTCCACAAGGAGGGTGATGCGG + Intergenic
967037658 3:185660039-185660061 ACTTTAAAGGGAGGCTGAGGCGG - Intronic
967491501 3:190096473-190096495 ATTCCACAGGAAGCGTGAGGAGG - Intronic
968085278 3:195871349-195871371 ACTGCAGAGGGAACGTTAGGTGG - Intronic
968575702 4:1365027-1365049 AGGCCAGAGGGAAGGTGAGGCGG + Intronic
969038252 4:4273495-4273517 ACTTCAGAGGCAGGGGCAGGAGG - Intronic
969113695 4:4858854-4858876 AGTTCAGAGCGAGGGTGGGGGGG + Intergenic
969325839 4:6443375-6443397 GCTCCAGAGGCAGGGTGCTGCGG + Intronic
969342218 4:6549379-6549401 ACTCCAGATGGAGGGTGGTCCGG + Intronic
969447217 4:7252239-7252261 CTTCCAGAGAGAGGGTGAGCAGG + Intronic
970637188 4:18021996-18022018 ACTCCAGCGGGAGGGGGAGGAGG - Intergenic
971153631 4:24059757-24059779 ACTCCATAGGGGAGGTTAGGAGG - Intergenic
971693748 4:29871513-29871535 ACTCAGGAGGAAGGGTGAGAGGG - Intergenic
973281692 4:48364866-48364888 ACGGGAGAGGGAGGGGGAGGGGG + Intronic
973324945 4:48850680-48850702 ACTCCAGAGGCTGAGGGAGGAGG - Intronic
973362469 4:49178104-49178126 GCACAAGAGGGAGGTTGAGGTGG - Intergenic
973663949 4:53138862-53138884 AGACGAGAGGGAGGGGGAGGGGG - Intronic
974036516 4:56822504-56822526 ACTTGGGAGGGAGGCTGAGGTGG - Intergenic
974314507 4:60260940-60260962 ACTCCTGTGGGCCGGTGAGGAGG - Intergenic
974421759 4:61685022-61685044 ACTTGGGAGGGAGGCTGAGGGGG - Intronic
974788290 4:66651207-66651229 ACTACTTTGGGAGGGTGAGGCGG + Intergenic
974848487 4:67380198-67380220 GCAACAGAGGGAGGGAGAGGGGG - Intergenic
975326327 4:73062722-73062744 ATTCAGGAGGGAGGCTGAGGTGG + Intronic
975684534 4:76906529-76906551 AAGAGAGAGGGAGGGTGAGGGGG + Intergenic
975860814 4:78674856-78674878 ACTCAGGAGGGATGCTGAGGAGG + Intergenic
975936288 4:79585279-79585301 TCTCAAGGGGGACGGTGAGGGGG - Intergenic
976053193 4:81031719-81031741 AATCCAGAGGGCAGCTGAGGAGG - Intronic
976116837 4:81736734-81736756 AGAGCAGAGGGAGGGTGAGGTGG + Intronic
976230937 4:82842256-82842278 GCTCCAGAGGAAGGGGGAGGAGG + Exonic
976419785 4:84828069-84828091 ACCCCAGAGGGAGGGAGGGAGGG + Intronic
977809751 4:101346179-101346201 CTTCCAGGGGGAGGGGGAGGGGG + Intronic
978560999 4:110033149-110033171 AATACAGAGGCAGGGTGTGGTGG - Intergenic
978564245 4:110065026-110065048 ACTCATGAGGGAGGTTGGGGAGG + Intronic
979570328 4:122215836-122215858 ACTCGAGAGGAAGGATGGGGGGG - Intronic
980505681 4:133717316-133717338 TCTCCATAGGGAGGGAGAGCGGG + Intergenic
981429943 4:144646544-144646566 ACTCCAGAGACAGAGGGAGGTGG - Exonic
981606418 4:146545822-146545844 ACTACAGAGGCAGTGTGAGAGGG + Intergenic
982157472 4:152536082-152536104 ACTCCAGAGAGAGGGGCGGGAGG + Exonic
983324804 4:166239931-166239953 ACTAGAGGGGGAGGGTGGGGGGG + Intergenic
983533887 4:168837114-168837136 ACTGCAGAGCGATGGGGAGGGGG + Intronic
983909942 4:173226717-173226739 ACACCAGAGGCAGGAGGAGGTGG - Intronic
984186342 4:176548144-176548166 ACTGCAGAGGGCAGGTGTGGAGG - Intergenic
984325234 4:178242218-178242240 ACTGCAGAGAGAAAGTGAGGAGG + Intergenic
985532211 5:440708-440730 ACTCGAGGGGGAGGGAGGGGAGG - Intergenic
985865602 5:2511729-2511751 CCTCCACAGGGAGGGTGGGCAGG - Intergenic
985938898 5:3118478-3118500 ACTGCAGAAGGAGGGTGGAGGGG - Intergenic
987059442 5:14228024-14228046 GATTCAGAGGGAGGGTGTGGGGG + Intronic
987607507 5:20156567-20156589 ACTCCAGAAGGTGGGGCAGGGGG + Intronic
988127181 5:27055374-27055396 ACTCAAGAAGGAAGGTGAAGGGG - Intronic
988700470 5:33668769-33668791 CCTCCAGAGGCCGGGTGTGGAGG - Intronic
988776216 5:34480111-34480133 GCTCCCCAGGGAGGGTGGGGAGG + Intergenic
989588184 5:43089141-43089163 AGACGAGAGGGAGGGGGAGGGGG + Intronic
989817532 5:45754300-45754322 ACTACATTGGGAGGCTGAGGTGG - Intergenic
991313911 5:65277979-65278001 ACTCAAGGGGGAGGGTGGGAGGG - Intronic
991719137 5:69479574-69479596 ACTCAAGAGGGCTGCTGAGGTGG - Intergenic
992124499 5:73626496-73626518 GCTCCCGAGGGAGCGGGAGGCGG - Intronic
992157517 5:73969662-73969684 TCTCCAGAGAGAGATTGAGGAGG + Intergenic
993232560 5:85255570-85255592 ACAAAAGAGGGAGGGAGAGGAGG - Intergenic
993595326 5:89847744-89847766 AGTCCAGATGCAGGGAGAGGAGG - Intergenic
993870562 5:93249016-93249038 AGGCCAGAGGAAGGGAGAGGTGG + Intergenic
994714374 5:103304406-103304428 ACTACAGGGGAAGGGGGAGGGGG - Intergenic
995835547 5:116396452-116396474 AATACTGAGGGAGGGAGAGGAGG - Intronic
997195145 5:131974260-131974282 AGTACAGAGGGAGTGGGAGGAGG - Intronic
997545672 5:134705182-134705204 ACTCCAGAGGCAGAGACAGGAGG - Intronic
997630200 5:135361618-135361640 ACTCCTGAGGGAGGGTCTAGTGG + Intronic
998072438 5:139208637-139208659 ACTTTAGAGGGAGGCCGAGGTGG - Intronic
999195411 5:149778399-149778421 ACTCCAGAGGCAGGGAGAGGAGG + Intronic
999266248 5:150268870-150268892 ACTCAAGAGGGAGGCAGAGAAGG - Intronic
999266373 5:150269458-150269480 ACTCAAGAGGGAGACTGAGGAGG - Intronic
1000421860 5:161047060-161047082 AGTCCAGTGGGAAAGTGAGGGGG + Intergenic
1001404008 5:171462814-171462836 ACCCCAGAGGGTGGGTGACACGG - Intergenic
1001548783 5:172587184-172587206 CCTCCAGAGGGTGGGAGATGGGG - Intergenic
1001700990 5:173706327-173706349 ACCCCAGAGGCAGTGGGAGGGGG - Intergenic
1002051310 5:176573172-176573194 GCTGGAGGGGGAGGGTGAGGAGG + Intronic
1002063038 5:176637722-176637744 GCAGCAGAGGGAGGGAGAGGAGG + Intronic
1003092307 6:3114535-3114557 TCCCCAGAGGGAGGGCGAGAAGG + Exonic
1003369553 6:5510950-5510972 CCTGCTGAGGGAGGGAGAGGAGG - Intronic
1003733023 6:8847161-8847183 TTACCAGAGGGAGGGAGAGGTGG - Intergenic
1004470745 6:15926906-15926928 ACTCAAGATGAAGGCTGAGGTGG + Intergenic
1005862276 6:29910967-29910989 CATCCTGAGGGAGGGTGTGGAGG - Intergenic
1006091803 6:31632730-31632752 ACTCCTGGGGGAGGTGGAGGTGG + Exonic
1006313635 6:33278031-33278053 ACCCCAGAGAGAGGCTGAGCAGG + Exonic
1006358596 6:33575028-33575050 ACTCTAGAGGGGGCCTGAGGTGG - Intronic
1006754831 6:36406523-36406545 ACTCAAGAGGTCGGGTGTGGTGG + Intronic
1006803854 6:36776365-36776387 ACTCCAGTGGGTGGGCGAGAAGG - Intronic
1006892749 6:37443600-37443622 ACTCCAGGAGGACGCTGAGGTGG - Intronic
1007249153 6:40483905-40483927 GCTCAAGAGGGAGGATGATGTGG - Intronic
1007260806 6:40561801-40561823 GCTCCAGAGGGCTGGAGAGGCGG + Intronic
1007353708 6:41294604-41294626 GCCACAGAGGGAGGGTGTGGTGG - Intergenic
1007786573 6:44283459-44283481 AAGCCAGCGGGAAGGTGAGGGGG - Intronic
1007838607 6:44697321-44697343 ACTCCAGAGGGAGAGGCAGCTGG + Intergenic
1009526679 6:64755739-64755761 ACAACAGTGGGAGGGTGAGGGGG + Intronic
1010380208 6:75215415-75215437 GCTTCAGAGGGAGGAAGAGGGGG + Intergenic
1010386361 6:75284846-75284868 ACGCCAGAGGGAGGGAGAGAGGG + Exonic
1011229451 6:85143889-85143911 CTTCCAGAGGGAGGGAGAGTTGG - Intergenic
1011304662 6:85912927-85912949 AATCCTGAGGGTGGATGAGGAGG + Intergenic
1013151710 6:107452517-107452539 ACTCAAGAGGTTGGGTGCGGTGG - Intronic
1013978632 6:116104050-116104072 ACTCCTGAGAGACTGTGAGGTGG + Intronic
1014969034 6:127791738-127791760 ACATGGGAGGGAGGGTGAGGTGG - Intronic
1015405992 6:132837234-132837256 AATCAAGAGGGAGGCTGAGGCGG + Intergenic
1016013777 6:139164152-139164174 AGGCCAGAGGGAGGGTGCTGTGG - Intronic
1017270165 6:152494930-152494952 ACTTCAGTGGGAGAGTGAGTAGG - Intronic
1017809961 6:157977485-157977507 TCTTCAGAGGGAGGGAGAGGAGG - Intergenic
1017916883 6:158838026-158838048 TTTCCAGAGGGAGGGGGAAGGGG + Intergenic
1017947664 6:159108873-159108895 ACTCCAGAGGCAGAGACAGGAGG - Intergenic
1017957734 6:159192842-159192864 TCTCTAGAGGGAGGGAGGGGAGG + Intronic
1018361482 6:163074879-163074901 ACTGGAGTGGGAGGCTGAGGTGG + Intronic
1018472455 6:164108857-164108879 TGTTGAGAGGGAGGGTGAGGTGG - Intergenic
1018910975 6:168100922-168100944 ACACCAGGGTGAGGGTGGGGTGG + Intergenic
1019084098 6:169457965-169457987 ACTCCTGACGGAGGAGGAGGAGG + Intronic
1019322234 7:420961-420983 ACTCCACAGTGAAGGTCAGGGGG + Intergenic
1019335645 7:481308-481330 GCTCCAGAGGAAGGCCGAGGTGG + Intergenic
1019355973 7:579155-579177 ACTCCAGAGGGAGGGTGAGGCGG + Intronic
1019487546 7:1296271-1296293 CCTCCTGAAGGAGTGTGAGGTGG + Intergenic
1019582665 7:1774042-1774064 ATCCCAAAGGGAGGCTGAGGTGG - Intergenic
1019614996 7:1955242-1955264 TCTCCAGAGGGAGCGGGAGCAGG + Intronic
1019729473 7:2622421-2622443 ATTCCAGGGGGAGGGGTAGGTGG - Intergenic
1020036696 7:4967987-4968009 ATCCCAGTGGGAGGCTGAGGTGG - Intergenic
1020106656 7:5425240-5425262 GCTGCAGAGAGAGGGTGCGGGGG - Intronic
1020143291 7:5624077-5624099 AATCCAGAAGGAGGCTGAAGAGG - Exonic
1022496484 7:30856100-30856122 ACTCCAATGGGAGGCAGAGGTGG - Intronic
1022886572 7:34652915-34652937 ACTCCAGGGAGAGGCTGTGGAGG + Intergenic
1023223734 7:37947865-37947887 ACTCCCCAGGAAGGGTGAGCAGG + Intronic
1023626678 7:42121724-42121746 ACTCCTGATGGAGGGGGAGGAGG - Intronic
1023724808 7:43131940-43131962 ACTCCACATGGAGGGAAAGGTGG + Intronic
1025985774 7:66450214-66450236 ACTCCAGCGGGAGGAAGAAGAGG - Intergenic
1026002624 7:66573528-66573550 ACTCCAGCGGGAGGAAGAAGAGG - Intergenic
1026029231 7:66775227-66775249 ACTCCAGCGGGAGGAAGAAGAGG + Exonic
1026077527 7:67185935-67185957 ACTCTAGAGGGGTGGGGAGGTGG + Intronic
1026261143 7:68756536-68756558 ACTCCAGAGGCTGAGTGGGGAGG - Intergenic
1026333939 7:69377870-69377892 ATTTCAGAGGCTGGGTGAGGTGG - Intergenic
1026593965 7:71718745-71718767 CCTCCAGAGGGAGGGACAGTGGG - Intergenic
1026699343 7:72626216-72626238 ACTCTAGAGGGGTGGGGAGGTGG - Intronic
1026843809 7:73685803-73685825 ACTCCAGAGGCCGGGCGCGGTGG + Intronic
1027785668 7:82576357-82576379 ACTCAAGAGGGAGACTGAGGCGG - Intergenic
1027869884 7:83693827-83693849 AATCCAGAGGCTGGGTGTGGTGG + Intergenic
1027978402 7:85186630-85186652 ACTCCAGTGGGAGGGTGTGCTGG - Intronic
1028006393 7:85574663-85574685 AATGCAGAGGGAGGAGGAGGAGG + Intergenic
1029666829 7:102000880-102000902 TCTACTCAGGGAGGGTGAGGTGG - Intronic
1030091460 7:105862324-105862346 ACTTGGGAGGGAGGCTGAGGTGG + Intronic
1030185853 7:106761107-106761129 AGTTTAGAGGGAGGGTGAGAGGG - Intergenic
1032084596 7:128877311-128877333 ACTGCAGGGGGAGTGGGAGGCGG + Exonic
1032197192 7:129796286-129796308 AACGCAGAGGGAGGCTGAGGAGG - Intergenic
1032221199 7:129995508-129995530 ACTTGTGAGGGAGGTTGAGGCGG + Intergenic
1032861967 7:135888934-135888956 GCCCCAGTGGGAGGGTGATGAGG + Intergenic
1032992209 7:137406062-137406084 ACTCCAGAGAGAGGGTAGGTGGG + Intronic
1033487706 7:141807570-141807592 ACTTGGGAGGGAGGCTGAGGTGG - Intergenic
1033515281 7:142099153-142099175 ACAACAGAGTGGGGGTGAGGAGG + Intronic
1033662388 7:143411032-143411054 ACTCCAGAGGGTGGGGGGTGGGG + Intergenic
1033735856 7:144221041-144221063 ATTCCTGTGGGAGGCTGAGGTGG - Intergenic
1033747195 7:144329911-144329933 ATTCCTGTGGGAGGCTGAGGTGG + Intergenic
1034878831 7:154748632-154748654 ACTCCAGAGGCAGGCTGTGCAGG - Intronic
1035597318 8:868848-868870 AGCCCAGAGTGAGGGTGAAGTGG + Intergenic
1035770506 8:2143148-2143170 ACTCCAGAGGAAATGTGAGATGG - Intronic
1036520074 8:9483565-9483587 ATTGCAGAGGGAGGGACAGGAGG - Intergenic
1038425603 8:27462138-27462160 GCTCCAGCAGGTGGGTGAGGAGG - Intronic
1038642863 8:29341519-29341541 TATCCTGAGGGAGGGAGAGGAGG - Intronic
1038754529 8:30328251-30328273 ACTGTAGATGGAGAGTGAGGTGG - Intergenic
1038822628 8:30966639-30966661 ACTACAAAGGGAGGTTGGGGAGG + Intergenic
1039114728 8:34080182-34080204 ATGACAAAGGGAGGGTGAGGAGG + Intergenic
1039396207 8:37227426-37227448 ACCACAGAGAGAGGGAGAGGTGG - Intergenic
1039618491 8:38975515-38975537 ACTCCAGAGGCTGGGTTGGGAGG - Intronic
1039997139 8:42543175-42543197 ATTCCAGAGGAAGGCTGTGGTGG + Intronic
1040514875 8:48126472-48126494 ATTCCAGAGGGAGGCTGAACAGG - Intergenic
1040594295 8:48822718-48822740 TCACCAGAGGGTGGGTGAGGCGG - Intergenic
1041778435 8:61550841-61550863 GAGCAAGAGGGAGGGTGAGGGGG + Intronic
1041783829 8:61609041-61609063 GCTCTAGATGGAGGGCGAGGAGG + Intronic
1042561607 8:70076045-70076067 ATGCCAGTGGGAGGCTGAGGTGG + Intergenic
1043398128 8:79858188-79858210 CCTGCTGTGGGAGGGTGAGGGGG - Intergenic
1043644145 8:82496701-82496723 ACTCCAGAGGGTGAGGCAGGAGG + Intergenic
1043675873 8:82952991-82953013 ACAAGAGAGGGAGAGTGAGGAGG - Intergenic
1044125858 8:88457367-88457389 CTTCCAGAGGGAGGGACAGGCGG + Intergenic
1045488978 8:102655268-102655290 ACCCGAGAGGGCTGGTGAGGAGG - Intronic
1045960286 8:107959380-107959402 ACTCCCAGGGGAGGGAGAGGAGG + Intronic
1046096693 8:109570961-109570983 GCAGGAGAGGGAGGGTGAGGGGG + Intergenic
1047523936 8:125616422-125616444 TGACCAGAGGGAGGATGAGGAGG + Intergenic
1048081975 8:131138296-131138318 ACTCGGGAGGGAGGCTGAGGCGG + Intergenic
1049594659 8:143477794-143477816 TCACCATTGGGAGGGTGAGGGGG + Intronic
1049613216 8:143565389-143565411 ACCCCAGATGGGGGCTGAGGCGG - Intergenic
1049656330 8:143800037-143800059 ACTCCAGAGCATGGGTGGGGTGG - Intronic
1049665346 8:143840477-143840499 AGTCCAGAGGCATGGGGAGGTGG + Intronic
1049758726 8:144322304-144322326 ACGGCAGATGGGGGGTGAGGCGG - Intronic
1049837311 8:144745047-144745069 ACTCCATATGGAGGGGGACGGGG + Intronic
1049925373 9:401993-402015 ACTGAAGAGGGAGGGCAAGGAGG - Intronic
1049937108 9:509907-509929 ACTCGGGAGGCAGGCTGAGGCGG - Intronic
1051357527 9:16253552-16253574 AGTCCAGAGGGAGGGTGTTGGGG - Intronic
1053033870 9:34808351-34808373 ACTCCAGAGGCTGAGGGAGGAGG + Intergenic
1053787472 9:41662980-41663002 AATCCAGAGCCAGGCTGAGGTGG - Intergenic
1053901605 9:42800877-42800899 ACACAAGGGGGAGGGGGAGGGGG - Intergenic
1054157653 9:61651787-61651809 AATCCAGAGCCAGGCTGAGGTGG + Intergenic
1054175749 9:61874319-61874341 AATCCAGAGCCAGGCTGAGGTGG - Intergenic
1054477427 9:65582792-65582814 AATCCAGAGCCAGGCTGAGGTGG + Intergenic
1054661790 9:67706491-67706513 AATCCAGAGCCAGGCTGAGGTGG + Intergenic
1055473021 9:76632664-76632686 ACTCCAGAGGCAGAGATAGGAGG - Intronic
1055519350 9:77064701-77064723 ACTCGGGAGGGAGGTTGATGTGG + Intergenic
1056359560 9:85841465-85841487 ACTCAGGAGGAAGGCTGAGGCGG + Intergenic
1056818304 9:89817604-89817626 AATGCAGAGGGAGGGTGATCTGG + Intergenic
1057016408 9:91656531-91656553 ACTCCGGTGGGGTGGTGAGGGGG + Intronic
1057020983 9:91697519-91697541 AGTCCTGAGGGAGGGTGTGGGGG - Intronic
1057843858 9:98506915-98506937 CCTCCAGAGGGAGGGCAGGGAGG + Intronic
1059712233 9:116879127-116879149 ACAGCAGAGGGAGGCTGAGCTGG - Intronic
1059774339 9:117460688-117460710 AGGCCAGAGGAAGTGTGAGGAGG + Intergenic
1060027301 9:120183959-120183981 GCTCCAGAGGGTGGAGGAGGGGG + Intergenic
1060398394 9:123332552-123332574 ACTGCTGGGGGAAGGTGAGGGGG + Intergenic
1060897640 9:127227809-127227831 ACTCCAGAGGCTGAGTCAGGAGG + Intronic
1060970733 9:127736166-127736188 ACTCCAGTGGGTGGGGGAGGTGG - Intergenic
1061429510 9:130522461-130522483 ACTCCAGGGTCAGGGTGTGGGGG - Intergenic
1061728250 9:132593598-132593620 ACTCCAGTGTGAGGGCAAGGAGG - Exonic
1061756742 9:132818733-132818755 ACTTCAGTGGGAGGCCGAGGCGG + Intronic
1062077715 9:134600952-134600974 AAGCCAGAGGGCGGGTGATGGGG - Intergenic
1203691597 Un_GL000214v1:47792-47814 GCACAAGAGGGAGGTTGAGGTGG - Intergenic
1203644698 Un_KI270751v1:56399-56421 GCACAAGAGGGAGGTTGAGGTGG + Intergenic
1203653591 Un_KI270752v1:2249-2271 ACTCCAGAGGCAGAGGCAGGTGG - Intergenic
1185872496 X:3675577-3675599 ACCCCAGTGGGAGGAAGAGGAGG - Intronic
1185907142 X:3945906-3945928 ACTCCAAAGGGTGGGAGAGTGGG - Intergenic
1187884828 X:23879684-23879706 ACTCTAAAGGGTGGGTGAAGGGG + Intronic
1189510491 X:41656840-41656862 ACTGCATAGGGAGGGGCAGGGGG - Intronic
1189667410 X:43371681-43371703 ACTGAAGAGGGTGGGTGAAGAGG + Intergenic
1189943018 X:46146538-46146560 ACTCCAGAGGCAGAGCGGGGAGG - Intergenic
1190049287 X:47137542-47137564 AATCCAGAGGCTGGGTGTGGTGG - Intergenic
1190065504 X:47239197-47239219 ACTCCAGGGCTAGGGTGAGAAGG - Intronic
1190252438 X:48737392-48737414 ACTCCGGGGGTGGGGTGAGGAGG - Intergenic
1191104779 X:56765784-56765806 AGTGCAGGGGGAGGGGGAGGAGG - Intergenic
1192735215 X:73844206-73844228 ACTGCAAATGGAGGGTGAGAAGG + Intergenic
1193253437 X:79319683-79319705 TTTCCAGACGGAGGGTGAGATGG + Intergenic
1193725718 X:85036847-85036869 ACTCCAGGGGAAGGATGAGAGGG - Intronic
1194139071 X:90186198-90186220 ACTGGAGTGGGAGGTTGAGGGGG + Intergenic
1194429049 X:93777902-93777924 ACTCAGGAGGGAAGCTGAGGTGG + Intergenic
1194973825 X:100373252-100373274 AATCCCGAGGGAGGCTGAGGGGG - Intronic
1195262154 X:103143246-103143268 ACTCCAGAGGCTGAGTGGGGAGG - Intergenic
1195776156 X:108408201-108408223 ACTCGGGAGGGAGGCTGAGGTGG + Intronic
1195918148 X:109956117-109956139 ACCCCAGAGGCTGGGTGTGGTGG - Intergenic
1197437157 X:126445278-126445300 ACTTGAGAGGGAAGGTTAGGAGG - Intergenic
1197749995 X:129957609-129957631 CCGCCAGAGGGAGGGAGCGGGGG - Intergenic
1198133274 X:133720880-133720902 ACTCAGGGGGAAGGGTGAGGGGG + Intronic
1198780090 X:140225470-140225492 ACTAGAGTGGGAGGGAGAGGGGG + Intergenic
1199853292 X:151740344-151740366 ACCAAAAAGGGAGGGTGAGGTGG + Intronic
1199944547 X:152654773-152654795 ACTGCATAGGGAGGAAGAGGTGG - Exonic
1200089719 X:153628790-153628812 CCTCCAGAGTGTGGGTGAGAGGG - Intergenic
1200791419 Y:7303125-7303147 ACCCCAGTGGGAGGAAGAGGAGG + Intergenic
1201666348 Y:16460775-16460797 ACTTCATTGGGAGGATGAGGTGG + Intergenic