ID: 1019355976

View in Genome Browser
Species Human (GRCh38)
Location 7:579162-579184
Sequence AGGGAGGGTGAGGCGGGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1920
Summary {0: 1, 1: 1, 2: 15, 3: 212, 4: 1691}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019355961_1019355976 27 Left 1019355961 7:579112-579134 CCATGGAGGCCCCGGACGGGCGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1019355976 7:579162-579184 AGGGAGGGTGAGGCGGGCAGTGG 0: 1
1: 1
2: 15
3: 212
4: 1691
1019355959_1019355976 29 Left 1019355959 7:579110-579132 CCCCATGGAGGCCCCGGACGGGC 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1019355976 7:579162-579184 AGGGAGGGTGAGGCGGGCAGTGG 0: 1
1: 1
2: 15
3: 212
4: 1691
1019355964_1019355976 17 Left 1019355964 7:579122-579144 CCCGGACGGGCGTGCGGTCACAG 0: 1
1: 0
2: 1
3: 3
4: 58
Right 1019355976 7:579162-579184 AGGGAGGGTGAGGCGGGCAGTGG 0: 1
1: 1
2: 15
3: 212
4: 1691
1019355960_1019355976 28 Left 1019355960 7:579111-579133 CCCATGGAGGCCCCGGACGGGCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1019355976 7:579162-579184 AGGGAGGGTGAGGCGGGCAGTGG 0: 1
1: 1
2: 15
3: 212
4: 1691
1019355965_1019355976 16 Left 1019355965 7:579123-579145 CCGGACGGGCGTGCGGTCACAGG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1019355976 7:579162-579184 AGGGAGGGTGAGGCGGGCAGTGG 0: 1
1: 1
2: 15
3: 212
4: 1691
1019355963_1019355976 18 Left 1019355963 7:579121-579143 CCCCGGACGGGCGTGCGGTCACA 0: 1
1: 0
2: 0
3: 4
4: 23
Right 1019355976 7:579162-579184 AGGGAGGGTGAGGCGGGCAGTGG 0: 1
1: 1
2: 15
3: 212
4: 1691

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019355976 Original CRISPR AGGGAGGGTGAGGCGGGCAG TGG Intronic
900113893 1:1020574-1020596 AGGGAGGCGGCGGCGGGCGGAGG - Intronic
900123208 1:1058380-1058402 AGGGCAGGTGAGGAGGCCAGAGG + Intergenic
900178169 1:1299748-1299770 GGGGAGGGTGTGCCGGGCATGGG + Intronic
900227699 1:1540644-1540666 AGGGAGGAGGAGGCAGGGAGGGG - Intergenic
900243987 1:1629383-1629405 AGGGAGCGGCAGGCGGGCGGGGG + Exonic
900244681 1:1631608-1631630 GTGGAGGGGGAGGCGGGGAGGGG - Intergenic
900526519 1:3131858-3131880 AGGGAGGAGGAGGAAGGCAGTGG - Intronic
900556481 1:3283373-3283395 AGGGAGGGAGAGAGGGACAGAGG - Intronic
900643409 1:3697956-3697978 AGGGAGGGGGAGGCAGTCACGGG - Intronic
900784079 1:4636720-4636742 AGGGTGAGTGAGGTGGACAGAGG + Intergenic
900822037 1:4897215-4897237 CAGGAGGGAGAGGCGGGAAGAGG + Intergenic
900949979 1:5853118-5853140 AGGGAGGGTGATTTGGGGAGTGG + Intergenic
901083606 1:6597459-6597481 GGGGAGGGAGAGCCGGGCAAAGG + Intronic
901217692 1:7563938-7563960 AGGGAGGGTAAAGCGAGGAGGGG + Intronic
901229276 1:7633005-7633027 GGAGGGGGTGAGGCAGGCAGAGG - Intronic
901251478 1:7783624-7783646 AGGGAGGGAGAGGCGGGGACTGG - Intergenic
901453936 1:9352738-9352760 AGGGAGGTTGAGGGGGGAAGAGG - Intronic
901483558 1:9542034-9542056 TGGGAGGCCGAGGTGGGCAGAGG - Intronic
901488843 1:9585536-9585558 TGGGAGGGTGAGGCAGGTGGAGG + Intergenic
901635734 1:10669329-10669351 AGCGAGGGTGAGGAGGGGACGGG - Intronic
901667573 1:10835375-10835397 GGGCAAGGGGAGGCGGGCAGGGG + Intergenic
901797839 1:11691144-11691166 AGGGCGGGGGAGGCGGGACGGGG - Intronic
902275859 1:15338752-15338774 GGGGAGGGTGAGGGTGTCAGAGG - Intronic
902373608 1:16019763-16019785 AGAGAGGGTGGGGCGGGGTGGGG + Intronic
902530719 1:17089156-17089178 AGGGAGGATGAGGTGGGACGTGG - Intronic
902617574 1:17632209-17632231 AGGGAGACTGAGGCTGGGAGAGG - Intronic
902681589 1:18047621-18047643 GGGGAGGGTGGGGAAGGCAGAGG + Intergenic
902719044 1:18292031-18292053 AGGGATGGGGAGTGGGGCAGAGG + Intronic
902801503 1:18832899-18832921 AGACAGGGAGAGGCAGGCAGGGG - Intergenic
902833211 1:19030701-19030723 AGGGAGGGAGGGGAGGGGAGGGG + Intergenic
903100171 1:21023245-21023267 AGGGAGGGGGAGGGGGGGAGGGG - Intronic
903186229 1:21630889-21630911 AGGGCTGGTGAGGAGGGAAGAGG - Intronic
903323305 1:22555318-22555340 GGGCAGGGAGAGGCGGGCAAAGG + Intergenic
903323589 1:22556624-22556646 GGGGAGGGAGAGGCGGGGACTGG + Intergenic
903516787 1:23916531-23916553 TGGGAGGCTGAGGCGGGAGGAGG + Intergenic
903523410 1:23972984-23973006 TGGGAGGTCAAGGCGGGCAGGGG - Intronic
903562194 1:24236434-24236456 AGGAAGGGTGAGCCAGGCTGAGG + Intergenic
903772340 1:25771836-25771858 AGCGAGGGTGCTGCGGGCAGCGG + Intronic
903890678 1:26568350-26568372 AGGGATGGTGAGTGGGGGAGGGG - Intronic
903944050 1:26950763-26950785 AGGGAACGTGAGGCAAGCAGTGG + Intronic
903989184 1:27253402-27253424 AGGGAGGAGGAGGAGGGGAGGGG - Intronic
904166155 1:28556915-28556937 TGGGAGGCTGAGGCAGGCAGAGG - Intronic
904321519 1:29700773-29700795 AGGGAGGGTGAGGTAGGTATGGG - Intergenic
904454871 1:30641512-30641534 AGGGAAGGAGAGGCTGGCGGGGG - Intergenic
904612247 1:31732167-31732189 AGGGAGGGGCAGGTGGGCAGAGG + Intronic
904649516 1:31994254-31994276 TGGGAGGTTGAGGCAGCCAGAGG + Intergenic
904661617 1:32089795-32089817 TGGGAGGCTGAGGCGGGTGGAGG + Intronic
904777582 1:32920681-32920703 TGGGAGGCTGAGGCGGGCCTTGG - Intergenic
904822259 1:33253440-33253462 AGGGAGGGTGTTCCAGGCAGAGG + Intergenic
904822544 1:33255569-33255591 GGGGAGGGTGAGGCGGGAGGAGG + Intergenic
904842090 1:33379348-33379370 AGGGGGGATGGGGGGGGCAGGGG - Intronic
904919186 1:33993547-33993569 AGAGAGGGAGAGGCTGGCTGAGG - Intronic
904940430 1:34162241-34162263 AGGGAGGCTGGGGTGGGGAGGGG + Intronic
904955864 1:34283433-34283455 TGGGAGGGTGGGGTGGGTAGTGG - Intergenic
905293851 1:36941913-36941935 AGGCAGGGTGAGGGGGGGATAGG - Intronic
905356722 1:37389946-37389968 ATGGAGGTGGAGGCGGGCAGAGG - Intergenic
905393623 1:37653384-37653406 AGAGAGGGAGAGATGGGCAGAGG + Intergenic
905514681 1:38553679-38553701 ATGGAGGGTCAGGAGGGCAGGGG - Intergenic
905532579 1:38693785-38693807 AGGGAGGGAGAGGGAGGGAGAGG + Intergenic
906232471 1:44176454-44176476 TGGGAGGCTGAGGCAGGTAGAGG + Intergenic
906327959 1:44860082-44860104 TGGGAGGCTGAGGCAGGCAGAGG - Intronic
906645054 1:47468933-47468955 AGGGAGGGTGAGATGGGTGGGGG - Intergenic
906647749 1:47488067-47488089 GGGCAGGGTGAGCCAGGCAGAGG + Intergenic
906653865 1:47533693-47533715 AAGGAGGGGGCGGCGGGCCGCGG + Intergenic
906769648 1:48472304-48472326 AGCGAGGCGGAGTCGGGCAGGGG + Intergenic
906783203 1:48590783-48590805 AGGCAGGGTGTGGGGGGCTGGGG + Intronic
907170164 1:52455641-52455663 AGGAAGGGAGGGGAGGGCAGGGG + Intronic
907170572 1:52459643-52459665 TGGGAGGCCGAGGCGGGCGGAGG + Intronic
907247016 1:53114975-53114997 TGGGAGGGCGAGGGGGTCAGGGG + Intronic
907797185 1:57729395-57729417 AGAGAGGATGTGGCGGGCAGCGG - Intronic
907885378 1:58588083-58588105 TGGGAAGCTGAGGCGGGCAGTGG + Intergenic
907910929 1:58825286-58825308 GGGAAGGGTGAGGCAGGGAGGGG - Intergenic
907933749 1:59023381-59023403 AAGGAGGCAGAGGTGGGCAGAGG + Intergenic
908078992 1:60554490-60554512 TGGGAGGCTGAGGAGGCCAGAGG + Intergenic
908187922 1:61670384-61670406 GGGGAGGGAGAGGAGGGCAAGGG + Intergenic
908212229 1:61912667-61912689 AGGGAGGGAGGGGAGGGGAGGGG + Intronic
908501161 1:64745074-64745096 GGCGAGGGCGAGGCGGGCAGAGG - Exonic
908516449 1:64897464-64897486 AGGGAGGAGGAGGGGGGGAGGGG + Intronic
908544011 1:65147501-65147523 GGGGAGGGGGCGGCGGCCAGCGG + Intergenic
908812300 1:67995308-67995330 TGGGAGGCTGAGGTAGGCAGAGG + Intergenic
909183695 1:72457797-72457819 AGGAAGGGAGAGGAGGGGAGAGG - Intergenic
909452120 1:75809754-75809776 TGGGAGGCTGAGGCAGGCTGAGG - Intronic
909659177 1:78063257-78063279 TGGGAGGCCGAGACGGGCAGGGG + Intronic
909687568 1:78367983-78368005 AGGAAAGGAGAGGAGGGCAGGGG - Intronic
910656216 1:89621510-89621532 AAGGAGGGTGAGGTGAGGAGTGG - Intergenic
911004366 1:93202882-93202904 AGGGTGGGTGAAGGTGGCAGTGG + Intronic
911031731 1:93496227-93496249 AGGAAGGGGGAGGTGGGGAGGGG - Intronic
911602231 1:99857837-99857859 GGGGAGGGGGAGGGGGGAAGAGG + Intronic
912023433 1:105137721-105137743 AGGGGGTGGCAGGCGGGCAGGGG - Intergenic
912335653 1:108859944-108859966 AGGCAGGGGGAGGAGGGCGGAGG - Intronic
912385567 1:109269642-109269664 AAGGAGGGTGAGGCATGCAGGGG - Intronic
912490202 1:110058510-110058532 AGAGTGGGAGAGGCTGGCAGAGG - Intronic
912658464 1:111508082-111508104 AGGGAGGGTGAGGCCTGGAAAGG + Intronic
912688747 1:111787602-111787624 GAGGAGGGTAAGGCAGGCAGGGG + Intronic
912772033 1:112472987-112473009 AGGGAGGGAGGGGAGGGAAGGGG + Intronic
912933440 1:113983439-113983461 AGGGAGACCGGGGCGGGCAGGGG + Intergenic
913179888 1:116311222-116311244 AGGGAGGGTGAGCTGAGCACTGG + Intergenic
913600267 1:120415372-120415394 ACGGAGGGCGAGGCGGGGTGGGG + Intergenic
914086792 1:144461291-144461313 ACGGAGGGCGAGGCGGGGTGGGG - Intronic
914192693 1:145425233-145425255 ACGGAGGGCGAGGCGGGGTGGGG - Intergenic
914196096 1:145448838-145448860 TGGGAGGGTGGTGGGGGCAGGGG - Intergenic
914343273 1:146777482-146777504 AGGGATGGGGTGGGGGGCAGTGG + Intergenic
914487805 1:148126237-148126259 TGGGAGGCTGAGGCGGGCAGAGG - Intronic
914590599 1:149103181-149103203 ACGGAGGGCGAGGCGGGGTGGGG - Intronic
914794172 1:150906053-150906075 TGGGAAGCTGAGGTGGGCAGAGG + Intergenic
914817700 1:151075194-151075216 TGGGAGGCTGAGGCGGGCAGAGG + Intronic
914959603 1:152194681-152194703 AGGGGGGGTGGGGAGGGGAGAGG - Intergenic
915106373 1:153537197-153537219 TGGGAGGGAGAGGAGGGCAGGGG + Exonic
915121148 1:153630164-153630186 GAGGAGGGTGGGGCAGGCAGGGG - Intronic
915310831 1:155005106-155005128 AGGGAGGGTGCGGCGGGCAGCGG + Intronic
915409382 1:155688692-155688714 AGGGAGGGGGAGGAGAGAAGAGG - Intronic
915457987 1:156053436-156053458 AGGCAAGGAGAGGCGGGTAGGGG - Intronic
915549895 1:156625656-156625678 GGGGAGGGTGAGGCGGCCGGGGG + Exonic
915594882 1:156891117-156891139 TGGGAGGCCGAGGCAGGCAGAGG - Intergenic
915673514 1:157510039-157510061 AGGGAGGCTGAGGCCGGGCGTGG + Intergenic
916144746 1:161728208-161728230 TGGGAGGCTGAGGCGGGGGGGGG + Intergenic
916502567 1:165399376-165399398 AGGGAGGCCAAGGCGGGCAGAGG + Intergenic
917105016 1:171483342-171483364 AGGGAGGGAGGGGAGGGGAGGGG + Intergenic
917508419 1:175649674-175649696 GGGGAGTGTGAGGAAGGCAGTGG - Intronic
917725236 1:177821412-177821434 AGGGAGGGTGGGAAGGGAAGTGG + Intergenic
917829096 1:178859811-178859833 GGGGGGGGGGGGGCGGGCAGAGG - Intronic
918985015 1:191614167-191614189 TGGGAGGCTGAGGCGGGGGGGGG - Intergenic
919526058 1:198652291-198652313 AGGGAGGGAGAGGAGGGGAAGGG + Intronic
919738407 1:200968032-200968054 AGCGAGGGTGGGGCGGGGAGTGG + Intergenic
919760411 1:201094665-201094687 AGGGCAGGTGGGACGGGCAGGGG - Intronic
919767609 1:201137252-201137274 GGGGAGGCTGAGGCTGGAAGGGG - Intronic
919799750 1:201346481-201346503 AGGGAGGTTGAGGCTGGGTGGGG - Intergenic
919813973 1:201426321-201426343 AGGGATGGTGAGATGGGCATCGG + Intronic
919925002 1:202187596-202187618 AGTGAGGGTGAAGCTGCCAGAGG - Intergenic
919944151 1:202307640-202307662 AGGGGGGATGAGGAGGGCTGAGG - Intronic
919977997 1:202625459-202625481 GGGGAGGGGGAAGGGGGCAGGGG + Intronic
920070680 1:203300977-203300999 AGGTTGAGTGAGGCAGGCAGTGG - Intergenic
920310937 1:205047897-205047919 TGGGAGAGTGAGGCTGGGAGAGG + Intronic
920385654 1:205568952-205568974 GGGGAGGGAGGGGCGGGGAGGGG - Intronic
920501427 1:206487831-206487853 AGGGAGGGGAAGGGTGGCAGTGG - Intronic
920535176 1:206732458-206732480 GGGCAGGGTGAGGGCGGCAGGGG - Intronic
920706288 1:208252962-208252984 GGGGAGGGTGAGGCAGGGGGTGG - Intergenic
920844608 1:209583554-209583576 AGGGAGGGTGAGCAGAGCCGAGG + Intergenic
920944133 1:210512319-210512341 AGGGGGGGTGGGGCAGGGAGAGG - Intronic
921036322 1:211382665-211382687 AGGGAGGGAGGGGAGGGGAGGGG - Intergenic
921304003 1:213777973-213777995 GAGGAAGGTGAGGTGGGCAGTGG + Intergenic
921629102 1:217412714-217412736 TGGGAGGCCGAGGCGGGCGGCGG - Intergenic
921643846 1:217589241-217589263 AGGGAGGGATGGGCGGGCCGTGG - Intronic
921866645 1:220094075-220094097 GGGGAGGGAGCGGCGGGTAGTGG - Intergenic
922213876 1:223505418-223505440 AGGCAGGGTGGCGGGGGCAGGGG - Intergenic
922322819 1:224503049-224503071 AGGGAGGGAGGTGGGGGCAGGGG + Intronic
922494037 1:226042004-226042026 AGAGAGGGTGGGGCCAGCAGTGG + Intergenic
922496529 1:226062314-226062336 GGGGAGGGGAAGGCGGGCGGAGG - Intronic
922695365 1:227728559-227728581 CGGGAGGGACAGGCGGGGAGGGG - Intronic
922722727 1:227906795-227906817 AGGGAGGGAGAGGCAGGAACAGG - Intergenic
922749683 1:228064630-228064652 ATGGAGGGTGAGATGTGCAGGGG - Intergenic
922776436 1:228216247-228216269 AGCGAGGGAGAGGCAGGCAGGGG - Intronic
922785037 1:228278437-228278459 TGGGAGGGCAGGGCGGGCAGAGG + Intronic
923023744 1:230187941-230187963 ATGGAGGGTGGGGCGGGCCGGGG + Intronic
923093539 1:230757290-230757312 AGAGGGGGAGAGGTGGGCAGCGG - Intronic
923109514 1:230879765-230879787 GAGGAGGGGGAGGCTGGCAGAGG - Intergenic
923109527 1:230879802-230879824 GAGGAGGGGGAGGCCGGCAGAGG - Intergenic
923109540 1:230879839-230879861 GTGGAGGGGGAGGCCGGCAGAGG - Intergenic
923109575 1:230879952-230879974 GAGGAGGGGGAGGCTGGCAGAGG - Intergenic
923596269 1:235362575-235362597 CGGGAGGGTGAGCCTGGAAGGGG + Intergenic
924603331 1:245510654-245510676 AGGGAGGGAGGGAGGGGCAGAGG - Intronic
924605965 1:245535526-245535548 AGGGAGAGGGATGCGTGCAGTGG - Intronic
924621074 1:245661226-245661248 TGGGAGGCTGAGGCAGGGAGTGG - Intronic
924638237 1:245808993-245809015 TGGGAGGCCGAGGCGGGCGGAGG - Intronic
924725652 1:246668040-246668062 AGGGAGGGTGAGGTGAGCTCGGG + Exonic
1062843356 10:687978-688000 ACGGAGGGTGCTGCAGGCAGGGG + Intronic
1062857216 10:785317-785339 ACGGCGGGTGCTGCGGGCAGGGG - Intergenic
1062866394 10:859044-859066 TGGGAGGCTGAGATGGGCAGAGG + Intronic
1063159970 10:3412116-3412138 CAGGAGAGTGAGGGGGGCAGGGG - Intergenic
1063200966 10:3785246-3785268 GCGGAGGGGGAGGCTGGCAGCGG - Exonic
1063275751 10:4565754-4565776 AGGCGGGGGGAGGGGGGCAGGGG + Intergenic
1063353138 10:5374260-5374282 GGGGAGGGCGAGGGGGGGAGGGG + Exonic
1063744761 10:8868367-8868389 AGGGAGGGGGAGGGGGAGAGAGG - Intergenic
1063989552 10:11545219-11545241 AGGGAGGGTGGGGCAGAGAGGGG - Intronic
1064094528 10:12413248-12413270 AGTGAGAGCGAGGCGGGAAGGGG + Intronic
1064143233 10:12807523-12807545 AGGCAGGGTGAGGAGGAGAGAGG - Intronic
1064159245 10:12929633-12929655 AGGGAAGGTGAGGGGGTCACTGG - Intronic
1064268989 10:13848471-13848493 AAGAAGGGGGAGGGGGGCAGGGG + Intronic
1064299613 10:14111946-14111968 AGGGAGGGAGAGGAGGGGAGGGG + Intronic
1064421736 10:15196715-15196737 AGGGAGGGAGATGGGGGAAGGGG - Intergenic
1064439506 10:15340911-15340933 ATGGAGGGTGGGGAGGGCATGGG + Intronic
1064455168 10:15480717-15480739 TGGGAGGCTGAGGCGGGCAGCGG - Intergenic
1064587690 10:16855072-16855094 AGGGAGGGAGGGGAGGGGAGGGG - Intronic
1064627232 10:17273825-17273847 AGGAAGGGGAAGGCGGGGAGGGG - Intergenic
1064697242 10:17980015-17980037 AGGGAGGGAGAGGAGGGCACGGG + Intronic
1064700073 10:18009454-18009476 AGGGAGGTTGATGGGGGAAGAGG - Intronic
1064795543 10:19007578-19007600 AGGGAGAGTGGGGAGGGGAGGGG - Intergenic
1064832873 10:19490556-19490578 AGGGAGGCTGAGGTGGGTGGGGG + Intronic
1064870512 10:19931765-19931787 AGGGAGGGTGAGTCAGATAGAGG - Intronic
1065379606 10:25076646-25076668 AGGGAGCGTGAGTCAGACAGCGG - Intergenic
1065608243 10:27444159-27444181 AGGGAGGGAGAGGCTGGATGCGG - Intergenic
1065627784 10:27649314-27649336 TGGGAGGCTGAGGTGGGCAGAGG - Intergenic
1065718120 10:28593660-28593682 TGGGAGGCTGAGGCAGGCAGAGG + Intronic
1065728712 10:28691538-28691560 AGGGAGGGGGAGGGAGGCGGAGG - Intergenic
1065728724 10:28691562-28691584 AGGGAGGGAGAGGGAGGGAGGGG - Intergenic
1065856952 10:29838836-29838858 AGGGAGGGAGAGGGGTGAAGGGG + Intergenic
1065870670 10:29953530-29953552 TGGGAGGCTGAGACGGGCAGAGG - Intergenic
1066074136 10:31855119-31855141 AGGGAGGGGGAGAAGGGGAGGGG + Intronic
1066122056 10:32298833-32298855 GGGGATGTTGAGGCAGGCAGTGG + Intronic
1066384656 10:34931940-34931962 TGGGAGGCTGAGGCGGGCTGAGG + Intergenic
1066431562 10:35356845-35356867 AGGGATTGTGAGCAGGGCAGTGG - Intronic
1066706025 10:38178913-38178935 AGGGAGGGAGAGGTAGGTAGAGG + Intergenic
1066978841 10:42392699-42392721 AGGGAGGATGAGGGAGGAAGAGG + Intergenic
1066984276 10:42450652-42450674 AGGGAGGGAGAGGCAGGTAGAGG - Intergenic
1067030340 10:42875405-42875427 AAGGAGGGTGCAGTGGGCAGGGG - Intergenic
1067072097 10:43140086-43140108 TGGGAGGCTGAGGCGGGAGGTGG + Intronic
1067121281 10:43474219-43474241 TGGGAGGCTGAGGTGGGCCGAGG + Intronic
1067158421 10:43802113-43802135 AGGGAGGGAGAGCTGGGCAAGGG + Intergenic
1067221716 10:44348657-44348679 AGGGTGGGTGAGGCTGGCCCAGG + Intergenic
1067830752 10:49610030-49610052 AGGCAGGGGGCGGGGGGCAGAGG + Intronic
1068171789 10:53403960-53403982 AGCCAGGGTGAAGCAGGCAGTGG - Intergenic
1068765360 10:60757411-60757433 GGGAAGGGTGAGTCGGGGAGAGG - Intergenic
1068895519 10:62195580-62195602 AGGGAAGGAGAGACGGACAGAGG + Exonic
1069035966 10:63646213-63646235 ACGGCGGGTGGGGAGGGCAGGGG + Intergenic
1069508222 10:69020647-69020669 TGGGAGGCCGAGGCGGGCAGAGG + Intergenic
1069673392 10:70230147-70230169 TGGGAGGCTGAGGCGGGTGGAGG - Intronic
1069697689 10:70398968-70398990 TGGGAGGCTGAGGTGGTCAGAGG + Intergenic
1069824199 10:71245391-71245413 ATGGAGGCTGAGTCTGGCAGGGG + Intronic
1069881583 10:71596904-71596926 AGGAAGGGAGTGCCGGGCAGCGG - Intronic
1069881705 10:71597458-71597480 AGGGCGGATGAGGTGGGGAGTGG - Intronic
1069926083 10:71851599-71851621 TGGGAGGCCGAGGCGGGCGGAGG + Intergenic
1069939125 10:71941674-71941696 GGGGGGGGAGAGGGGGGCAGGGG + Intergenic
1070311422 10:75276396-75276418 AAGGAGGGAGAGGAGGGCATCGG - Intergenic
1070553812 10:77513096-77513118 GGGTAGGGGGAGGCTGGCAGGGG - Intronic
1070850502 10:79558857-79558879 AGGGCGGGGCAGGTGGGCAGTGG - Intronic
1070856715 10:79612438-79612460 AGGGTGGGGCAGGTGGGCAGTGG + Intronic
1070866990 10:79712657-79712679 AGGGAGGGTCTGGGGGGAAGGGG + Exonic
1070880780 10:79850778-79850800 AGGGAGGGTCTGGGGGGAAGGGG + Exonic
1070923017 10:80200788-80200810 TGGGAGGCTGAGGCGGGGCGGGG + Intronic
1071393066 10:85194862-85194884 GGGGAGGATGGGGCTGGCAGAGG + Intergenic
1071544772 10:86521301-86521323 CGGGAGGGTGGGGGAGGCAGAGG - Intronic
1071633902 10:87234880-87234902 AGGGAGGGTCTGGGGGGAAGGGG + Exonic
1071647352 10:87367097-87367119 AGGGAGGGTCTGGGGGGAAGGGG + Exonic
1071828838 10:89352164-89352186 AGGGAGGGGGAGTCGAGCAGTGG - Intronic
1071967212 10:90864095-90864117 TGGGAGGCTGAGGCAGGGAGAGG - Intergenic
1072032753 10:91537079-91537101 AGGGAGGATCAGGAGGGCAGAGG + Intergenic
1072167878 10:92831219-92831241 AGGGAGGGTGGGGAGAGCTGAGG + Intergenic
1072217044 10:93296287-93296309 GGGGAGGGTGAGGAGGGCCCAGG + Intergenic
1072263205 10:93702355-93702377 AGGGTGTGTGAGGAGGGCTGTGG - Exonic
1072271260 10:93779431-93779453 AGGGAGGGAGGGGAGGGGAGGGG + Intronic
1072721313 10:97782619-97782641 AGGGAGGCTGTGGCCGGCTGGGG - Intergenic
1072742644 10:97919032-97919054 TGGGAGGCTGAGGCGGGGGGGGG - Intronic
1072750428 10:97974931-97974953 GGGGAAGGGGAGGCGGGCAGAGG + Intronic
1073008640 10:100343151-100343173 TGGGAGGCTGAGGCAGGCTGAGG - Intergenic
1073131867 10:101194575-101194597 AGGGAGGTTGAGGCGGGAGGAGG + Intergenic
1073135392 10:101217487-101217509 AGGGGGGCTCGGGCGGGCAGCGG - Intergenic
1073345728 10:102781543-102781565 AGGGAGGAGGAGGCCTGCAGTGG - Intronic
1073444974 10:103575164-103575186 AGAGAGGGAGGGGCGGGAAGTGG - Intronic
1073456485 10:103639881-103639903 AAGGAGAGTGGGGCGGGAAGGGG + Intronic
1074147057 10:110726096-110726118 TGAGAGGGAGAGGCCGGCAGAGG - Intronic
1074289876 10:112130428-112130450 AGGGAGGGGGTGGCAGGTAGTGG + Intergenic
1074377516 10:112951691-112951713 GGGGAGGGGGAGGCGGGGAGGGG - Intronic
1074386528 10:113020763-113020785 AGGGGGTGTGAGGGGGACAGAGG + Intronic
1074491092 10:113940325-113940347 AGGAAGGGTGAGGGGGAAAGAGG - Intergenic
1074524660 10:114253226-114253248 GGGGAGGGAGAGACGGGGAGGGG - Intronic
1074845855 10:117397102-117397124 TGGGAGGCTGAGGCGGGCGATGG + Intergenic
1074865697 10:117543328-117543350 TCGGAGCGCGAGGCGGGCAGGGG - Exonic
1074890770 10:117735187-117735209 ACGGAGGGAGAGGCGGCGAGAGG + Intergenic
1075001905 10:118804890-118804912 GGGGAGGGAGAGGTGGGCAGGGG + Intergenic
1075110101 10:119572416-119572438 TGGGAAGCTGAGGCGGGTAGTGG - Exonic
1075386665 10:122060167-122060189 AGAGATGGCGAGGTGGGCAGGGG + Intronic
1075431740 10:122389592-122389614 TGGGAGGCTGAGGCAGGCTGAGG + Intronic
1075559797 10:123460285-123460307 AGGGAGGGTGCAAAGGGCAGAGG + Intergenic
1075608907 10:123836018-123836040 AAGGAAGGTGAGAAGGGCAGAGG - Intronic
1075668685 10:124248359-124248381 AGGGAGAGTGAGGTGGACGGAGG + Intergenic
1076022163 10:127082806-127082828 AGGGAGTGTGAGGAGGGAATCGG - Intronic
1076243579 10:128928656-128928678 GGGGAAGGGGAGGCGGGAAGTGG - Intergenic
1076384759 10:130048141-130048163 AGGGAGGAGGAGGCAGGAAGGGG + Intergenic
1076501484 10:130939750-130939772 ATGGAGGGTGAGGCTGGAGGAGG + Intergenic
1076674909 10:132142686-132142708 AGGGAGGGTGGGGCGGCAAGAGG - Intronic
1076721397 10:132394977-132394999 AGGGAAGGTGGGCAGGGCAGAGG + Intergenic
1076806696 10:132862433-132862455 AGGGTGGGTGGGGCGGGGTGGGG + Intronic
1076808015 10:132869056-132869078 AGGGAGGGAGGGGCGGTGAGGGG - Intronic
1077062207 11:622579-622601 TGGGAGGCCGAGGTGGGCAGAGG - Intronic
1077066366 11:642718-642740 AGGAAGGGCCAGGCGGGCTGAGG + Intergenic
1077066375 11:642746-642768 AGGAAGGGCCAGGCGGGCTGAGG + Intergenic
1077066394 11:642802-642824 AGGAAGGGCCAGGCGGGCTGAGG + Intergenic
1077162696 11:1120984-1121006 AGTGAGGGTGAGGCAGCGAGAGG - Intergenic
1077184916 11:1231635-1231657 GGGCAGGCAGAGGCGGGCAGGGG + Intronic
1077218329 11:1404390-1404412 TGGGAGGCTGAGGCAGGCGGAGG - Intronic
1077334293 11:1996638-1996660 AGGGAGGATGGTGCAGGCAGGGG - Intergenic
1077351529 11:2095300-2095322 AGGGAGGTTGAGGTGGGCCTTGG - Intergenic
1077392558 11:2306870-2306892 AGGGAGGGGGAGAAGGGAAGAGG + Intronic
1077476505 11:2792876-2792898 AGGGAGGGGGCGAGGGGCAGGGG - Intronic
1077484275 11:2831726-2831748 AGAGAGGCAGAGGAGGGCAGCGG - Intronic
1077537014 11:3129280-3129302 AGGCAGGGTGAGGAGGGCCTGGG + Intronic
1077548291 11:3186531-3186553 AGGGAGGGTGGGAGGGGCAAGGG - Intergenic
1077611703 11:3647078-3647100 TAGGAGGCCGAGGCGGGCAGCGG + Intronic
1078083078 11:8217918-8217940 AGGCAGGGAGAGGTGGGCCGAGG - Intergenic
1078171268 11:8930841-8930863 AAGGAGGCTGAGGGGGGCTGAGG - Intronic
1078196358 11:9140086-9140108 AGGCAGGGCGAGGGAGGCAGGGG - Intronic
1078748402 11:14137263-14137285 AGGGATTCTGAGGCTGGCAGTGG - Intronic
1078784875 11:14479910-14479932 GGGGAGGCTGAGGCTGCCAGAGG - Intronic
1078850715 11:15160469-15160491 AGGGAGTGGGAGGAGGGCACAGG + Intronic
1078937123 11:15961773-15961795 TGGGAGGCCGAGGCGGGCTGAGG - Intergenic
1079144703 11:17840410-17840432 AGGAAGGGGGTGGTGGGCAGAGG - Intronic
1079204784 11:18405028-18405050 TGGGAGCGTGAGGGGGACAGAGG - Intronic
1079340720 11:19609665-19609687 AGGCTGGGTGAGGCATGCAGTGG - Intronic
1079763221 11:24356849-24356871 AGGCAGGGTGATGCAGGCAATGG + Intergenic
1080276252 11:30506282-30506304 TGGGAGGCTGAGGCGGGCTGAGG - Intronic
1080494771 11:32806377-32806399 TGGGAGGCTGAGGCGGGTGGGGG + Intergenic
1080554239 11:33401753-33401775 TGGGAGGCTGAGGCAGGCAGAGG - Intergenic
1081523574 11:43907102-43907124 AGGGAGGGTAAGGTGGCCTGTGG + Intronic
1081675337 11:44965286-44965308 AGGGAGGCTGGGGAGGGCTGAGG + Intergenic
1081736970 11:45410992-45411014 AGGGAGGTGGAGGCGGGGTGTGG - Intergenic
1081767495 11:45621674-45621696 TGGGAGGGTGAGGCTCTCAGAGG + Intergenic
1081793641 11:45805330-45805352 TGGGAGGGAGGGGCGGGCAGGGG - Exonic
1081794222 11:45808628-45808650 GGGTAGGGTGAGGGGGGCAGAGG - Intronic
1081931965 11:46877706-46877728 TAGGAGGCTGAGGTGGGCAGAGG - Intronic
1082097552 11:48143778-48143800 GGGGAGGGGGAGGAGGGGAGGGG - Intronic
1082784831 11:57311208-57311230 AGGGAGCGTGAGGTGGGGGGTGG - Intronic
1082786913 11:57322384-57322406 GGGAAGGGGGAGGCAGGCAGTGG - Intronic
1083226844 11:61290755-61290777 GGGGAGGGGGAGGGGGACAGCGG - Intronic
1083258026 11:61508645-61508667 AGGGAGGGCGGGGCGGGGCGGGG - Intergenic
1083303764 11:61752562-61752584 GGGGCGCGTGGGGCGGGCAGGGG + Intergenic
1083328139 11:61884015-61884037 AGGGAGTGCGAGTAGGGCAGGGG + Intronic
1083335546 11:61919689-61919711 AGGGAGGCTGAGGAGGGCAGTGG - Intronic
1083470705 11:62881827-62881849 AGGGAGGGTGGGGAGGTCAGGGG + Intronic
1083595186 11:63915660-63915682 AGGGAGGATGTGGCGGGCGGGGG + Intronic
1083633716 11:64109060-64109082 AGGCAGGGCCAGGCGGGGAGAGG - Intronic
1083660237 11:64248717-64248739 AGGGAGGCTGAGGCCGGAGGAGG - Intergenic
1083802239 11:65053369-65053391 GGAGAGGGAGAGGTGGGCAGGGG + Intronic
1083831847 11:65238568-65238590 AGGGAGGGAGAGGGAGGGAGAGG - Intergenic
1083881953 11:65553281-65553303 GGGGAGGGTGAGGAGGGAACTGG + Intronic
1083951517 11:65959191-65959213 AGTGACGGTGAGCCGGGCATTGG - Exonic
1084035372 11:66506632-66506654 AGGGGTGGTGAGGCTGGCAAGGG - Intronic
1084086477 11:66857384-66857406 GGGGAGGGTATGGCGGGGAGTGG + Intronic
1084151342 11:67289289-67289311 AGGGAGGGCGGGGCGGGCGGCGG - Exonic
1084410812 11:69005057-69005079 TGGGTGGGGGAGCCGGGCAGGGG + Exonic
1084534392 11:69748153-69748175 AGGGAGGGTGCCTCAGGCAGAGG - Intergenic
1084564392 11:69920954-69920976 AGGGTGGGGGAGGCTGTCAGAGG + Intergenic
1084624653 11:70296756-70296778 AGGGAGGGGGAGGGAGGGAGAGG + Intronic
1084673869 11:70623216-70623238 AGGGTGGGAGAGGCAGGCACAGG - Intronic
1084683082 11:70678474-70678496 AGGCAGGGAGAGGCAGGGAGAGG - Intronic
1084726711 11:70946690-70946712 AGGGAGGGTGAGTCTGGGAAGGG - Intronic
1084726739 11:70946799-70946821 AGGGAGGGTGAGTCTGGGAAGGG - Intronic
1084742709 11:71149921-71149943 AGGGAGGGAGAGGAGGGGAGGGG + Intronic
1084742719 11:71149944-71149966 AAGGAGGGAGAGGAGGGGAGGGG + Intronic
1084742830 11:71150256-71150278 AGGGAGGGAGAGGGAGGGAGAGG + Intronic
1084776863 11:71382787-71382809 AGGGAAGGGGAGGTGGGGAGTGG + Intergenic
1084857141 11:71996581-71996603 AGGGAGGGTGAAGCCTGGAGGGG - Exonic
1084967256 11:72751252-72751274 AAGGTGGGTGTGGCTGGCAGAGG - Intronic
1085024915 11:73230767-73230789 GGGGCGGGTGAGGTTGGCAGAGG + Intronic
1085059467 11:73431339-73431361 CGGGGGGGTGTGGGGGGCAGCGG - Intronic
1085085568 11:73664409-73664431 AGGGAGGGGGAGGGGGGGAGGGG - Intergenic
1085309318 11:75506908-75506930 AGAGAAGGGGAGGGGGGCAGGGG - Intronic
1085476780 11:76794035-76794057 AGGGATGGGCAGGAGGGCAGGGG + Intronic
1085777881 11:79382670-79382692 AGGGAGGGGGAGGAGGACACTGG + Intronic
1086040396 11:82469770-82469792 AGGGAGCGTGAGGTGGGAATAGG + Intergenic
1086455489 11:86955560-86955582 AGGGAGGGAGGGGCGGCCGGAGG - Intergenic
1087271330 11:96114883-96114905 AGGGAGGGTGGAGAGGGAAGAGG + Intronic
1087736939 11:101844702-101844724 AGGGAGGGAGGGGAGGGGAGTGG + Intronic
1088114052 11:106296329-106296351 AAGGAAGGTGAGGTGGGAAGAGG + Intergenic
1088117055 11:106324261-106324283 AGTGAGGGTGTGGGGTGCAGGGG + Intergenic
1088645493 11:111913385-111913407 AGGGAGGATGAGGCTGGCACAGG - Intronic
1088702004 11:112421811-112421833 AGGGAAACTGAGGCTGGCAGAGG + Intergenic
1088861205 11:113801292-113801314 AGGGAGGTTAAGAGGGGCAGAGG + Intronic
1089177839 11:116561201-116561223 AGGGAGGATGGGGCAGGCAGGGG - Intergenic
1089270743 11:117300024-117300046 AGGAAGGGGGAGGCAGGGAGGGG - Intronic
1089430488 11:118419988-118420010 TGGGAGGCCGAGGCAGGCAGAGG + Intronic
1089560438 11:119340679-119340701 AGGGGGGGTGAGTCTGGCGGAGG - Exonic
1089603561 11:119628982-119629004 AGGGTGGGGGAGGTGGGCAGGGG - Intronic
1089693589 11:120201807-120201829 AGGGAGGGGGTGGGGGGCACTGG - Intergenic
1089785336 11:120903441-120903463 AGGCAGGGTGGGGCGGGGTGAGG - Intronic
1090061118 11:123464942-123464964 AGGGTGTGGGAGGCGGGAAGGGG + Intergenic
1090077423 11:123588037-123588059 AGGGAGACTGAGGCAGGCATGGG - Intronic
1090227504 11:125080586-125080608 AGGGAGGGAGAGAAGGGAAGAGG - Intronic
1090267701 11:125363850-125363872 AGTGGGGGTGGGGAGGGCAGGGG + Intronic
1090274377 11:125409293-125409315 AGGAATGGTGAGGAGAGCAGAGG + Intronic
1090912878 11:131136612-131136634 AGGGAGGGTGAGACGGGGTGGGG + Intergenic
1090941500 11:131391851-131391873 AGGGAGGGAGTAGCGGGGAGTGG + Intronic
1090951414 11:131476752-131476774 GGGGTGGGTGGGGTGGGCAGGGG - Intronic
1090965863 11:131597348-131597370 AGGCAGGGTGAGGGGGAAAGGGG - Intronic
1091121355 11:133060552-133060574 AGGCAGGGTGTGGAGGGGAGGGG + Intronic
1091148860 11:133307068-133307090 AGGGAGGTAGAGGAGAGCAGAGG - Intronic
1091157253 11:133385077-133385099 AGGGAGGGTGGGGGGCTCAGAGG + Intronic
1091217051 11:133908515-133908537 AGGCAGGAGGAGGAGGGCAGTGG - Intergenic
1091241172 11:134053406-134053428 AGGGAGGGAGAGGCAGGAAGGGG + Intergenic
1091282007 11:134387203-134387225 AGGGAGGGGGAGGTGGGAAGTGG - Intronic
1202817276 11_KI270721v1_random:51820-51842 AGGGAGGATGGTGCAGGCAGGGG - Intergenic
1091393505 12:139857-139879 AGAGAGTGTGAAGCAGGCAGAGG + Intronic
1091396317 12:156032-156054 AAGGAGGGTGAGGCAGGGTGAGG + Intronic
1091449220 12:562232-562254 AGGCAGGGTGATGAAGGCAGGGG + Exonic
1091460867 12:642859-642881 CGGGCGGGCGAGCCGGGCAGGGG - Intronic
1091568062 12:1662410-1662432 GGGGAGGGGGAGGCGGGAAGTGG - Intergenic
1091568072 12:1662431-1662453 GAGGAGGGGGAGGCGGGAAGTGG - Intergenic
1091568098 12:1662494-1662516 GGGGAGGGGGAGGCGGGAAGTGG - Intergenic
1091568108 12:1662515-1662537 GGGGAGGGGGAGGCGGGAAGTGG - Intergenic
1091568136 12:1662576-1662598 AGTGAGGGGGAGGCGGGAAGTGG - Intergenic
1091568151 12:1662615-1662637 GAGGAGGGGGAGGCGGGAAGTGG - Intergenic
1091568185 12:1662699-1662721 GAGGAGGGGGAGGCGGGAAGTGG - Intergenic
1091586813 12:1821436-1821458 GGTGAGGGTGAGGCTGGGAGTGG + Intronic
1091589820 12:1836446-1836468 TGGGTGGGTGAGGTGGGCTGGGG + Exonic
1091596699 12:1883298-1883320 TGGGAGGGCGAGGCTGGGAGAGG - Intronic
1091899601 12:4134334-4134356 TGGGAGAGAGAGGCTGGCAGGGG - Intergenic
1091969061 12:4770991-4771013 CTGGCGGGTGAGGCGGGCATGGG + Intronic
1092039107 12:5367886-5367908 AGGCATGGTGAGGCGGGAAATGG - Intergenic
1092374878 12:7947285-7947307 AGGGAGGGAGGGGAGGGGAGGGG - Intergenic
1092817250 12:12322960-12322982 AGGGAGGGGGAGGGGAGGAGAGG + Intergenic
1092918423 12:13208928-13208950 AGAGAGTGTGAGCTGGGCAGAGG + Intronic
1093680183 12:21993560-21993582 AGGGAGGGAGGGGAGGGGAGGGG + Intergenic
1093785975 12:23192692-23192714 AAGGAGGTAGAGGCGGGGAGAGG - Intergenic
1094394782 12:29994149-29994171 TGGCAGGGTGAGGGGTGCAGTGG - Intergenic
1094762940 12:33556334-33556356 AGGGTGGGTGGGGAGGTCAGTGG + Intergenic
1095458913 12:42420684-42420706 AGGGAGGGAGGGGAGGGGAGGGG - Intronic
1095672407 12:44876356-44876378 GGGGAGGGAGGGGCGGGCCGGGG + Intronic
1096218122 12:49809554-49809576 GGGGAGGGTGCGGAGGGAAGCGG - Intronic
1096571272 12:52524645-52524667 AGGGAGGGGCAGGCCTGCAGGGG + Intergenic
1096582136 12:52592531-52592553 AGGGAGGGAGGGATGGGCAGGGG - Intronic
1096652028 12:53066557-53066579 AGTGAGGGTGAGTGGGGTAGGGG - Exonic
1096700004 12:53376302-53376324 TGGGAGGCCGAGGTGGGCAGAGG + Intergenic
1096748924 12:53746568-53746590 AGGGAGGCTGAGGAGGGCGATGG + Intergenic
1096772420 12:53944419-53944441 AGGGAGGGCATGGCAGGCAGGGG - Intronic
1096792805 12:54055385-54055407 TGGGAGGGAGAGGAGGGCAGGGG - Exonic
1096802703 12:54121883-54121905 AGGGAGTGGCAGGCAGGCAGTGG - Intergenic
1096973385 12:55684813-55684835 GGGTAGGGTGAGAAGGGCAGGGG - Exonic
1097168570 12:57099215-57099237 GGGCAGGGAGAGGAGGGCAGCGG + Intronic
1098021505 12:66160914-66160936 TGAGGGGGTGGGGCGGGCAGAGG + Intronic
1098167680 12:67714892-67714914 AGGGAGGGTGAAGAGGTGAGAGG - Intergenic
1098198172 12:68024391-68024413 AAGGATGGTGAGGTGGGCAAGGG - Intergenic
1099169352 12:79345137-79345159 TGGGAGGAGGAGGAGGGCAGGGG - Intronic
1099335582 12:81352468-81352490 AGGGAAAGTGAGGCAGGCAGTGG - Intronic
1100289341 12:93199104-93199126 AGGAAGGGTAGGGCGGGCATGGG - Intergenic
1100313202 12:93416772-93416794 TGGGAGGCTGAGGCAGGCAGGGG + Intronic
1101416517 12:104513150-104513172 AGGGAGGGAGAGGTGGGCCAGGG + Intronic
1101479654 12:105084606-105084628 TGGTAGGGTGGGGCGGGCCGCGG - Intergenic
1101732657 12:107439562-107439584 AGGGAAGCTGAGAAGGGCAGGGG - Intronic
1101983628 12:109428785-109428807 GAGGGGGGTGAGGTGGGCAGTGG - Intronic
1102042261 12:109808508-109808530 AGGGACAGTGGGGCAGGCAGGGG - Intronic
1102147885 12:110668579-110668601 AGGGATGCAGAGGCAGGCAGTGG - Intronic
1102186552 12:110951910-110951932 AGGGAGAGGGAGGGGGGGAGGGG + Intergenic
1102230376 12:111257663-111257685 AGGGAGGAAGAGGGGGGAAGAGG - Intronic
1102268108 12:111506627-111506649 GGGGAGGGGGAGGGGGGGAGAGG - Intronic
1102456124 12:113071774-113071796 ACGGATGGGCAGGCGGGCAGCGG + Intronic
1102456983 12:113077176-113077198 AGCCAGGGTGAGGGGGGCCGGGG - Intronic
1102501022 12:113352505-113352527 AGGGAGGGAGGGGAGGGCAGGGG - Intronic
1102520002 12:113472216-113472238 AGGGATGGCGAAGGGGGCAGGGG - Intronic
1102589425 12:113946291-113946313 GGGCAGGGTGAGGGTGGCAGAGG + Intronic
1102670506 12:114614968-114614990 AGGGAGGAGGCGGTGGGCAGAGG - Intergenic
1102745243 12:115243992-115244014 AGGGAGGGGAAGACGGGGAGGGG + Intergenic
1102804018 12:115763325-115763347 AGGGAGGGAGGGGAGGGGAGGGG + Intergenic
1102851185 12:116246777-116246799 AGGGAGGGACAGGAGGGGAGGGG + Intronic
1103270605 12:119669863-119669885 AAGCAGGGTGAGGCCGGGAGTGG - Intronic
1103432787 12:120903305-120903327 AGAGTTGGTGAGGTGGGCAGAGG - Intronic
1103527881 12:121579675-121579697 AGGCAGGGGGATGCGGGGAGTGG - Intronic
1103726276 12:122998778-122998800 TGGGTGGGTGGGGAGGGCAGGGG + Intronic
1103757284 12:123218754-123218776 TGGGAGGCTGAGGTGGGCAGAGG - Intronic
1103931329 12:124452643-124452665 TGGGAGGGCGAGGTGGGCAGAGG + Intronic
1103979145 12:124725015-124725037 TGGGAGGCCGAGGCGGGCGGAGG - Intergenic
1104001716 12:124864234-124864256 AGGAAGGGTGAGGGGCTCAGAGG - Intronic
1104270674 12:127279977-127279999 TGGGAGGCTGAGGCAGGCAGTGG + Intergenic
1104404189 12:128504037-128504059 AGGGAGGGAGAGGGGGAGAGAGG - Intronic
1104612787 12:130243035-130243057 AGGGTGGGTCAGGGAGGCAGGGG + Intergenic
1104676775 12:130716401-130716423 AGGGAGCGAGAGGCAGGCAGAGG + Intergenic
1104691109 12:130827068-130827090 AGGGAGGGAGGGGTGGGGAGGGG + Intronic
1104780962 12:131420290-131420312 AGGGCTGGTGTGGAGGGCAGTGG - Intergenic
1104977618 12:132559309-132559331 AGGGAGGGCGGGGCTTGCAGCGG + Intronic
1105019659 12:132807813-132807835 GGGGGGTGTGGGGCGGGCAGAGG - Intronic
1105405128 13:20127372-20127394 AGTGAGGGTGAGGAGGGTGGGGG - Intergenic
1105472289 13:20704386-20704408 GGGGAGGGTGGGGCGGGGAAGGG + Intronic
1105859042 13:24393566-24393588 AGAGAGGGTGAGGAGGGGAGGGG + Intergenic
1105997429 13:25685904-25685926 AGGGAGGGTGACCCTAGCAGTGG + Intronic
1106131208 13:26941054-26941076 AGTGGGGGTGAGGGGGACAGGGG - Intergenic
1106224286 13:27773523-27773545 AGGGAGGGAGAGACTGGAAGTGG - Intergenic
1106483501 13:30154249-30154271 AGGGAGGGGGAAGCAGGCAGGGG - Intergenic
1106512300 13:30422049-30422071 GGGGAAGGTGGGGCGGGCGGAGG + Intergenic
1106899914 13:34344567-34344589 AGGGAGGGGCAGGCAGGCAACGG + Intergenic
1107300861 13:38964324-38964346 AGGCAGGGTGAGGCCAGAAGGGG - Intergenic
1107415296 13:40194339-40194361 AGAGCGGGTGAGGCTGGAAGTGG - Intergenic
1107472323 13:40702456-40702478 TGGGAGGCCGAGGTGGGCAGAGG + Intergenic
1107738981 13:43428781-43428803 AGGGTTGGTGAGGCGGGTGGGGG + Intronic
1107767827 13:43756451-43756473 AGGAGGGGTGAGGAGGGGAGGGG + Intronic
1108292128 13:48972405-48972427 GGGGAGGGGGAGCAGGGCAGGGG + Intergenic
1108619090 13:52163538-52163560 TGGGAGGCTGAGGCAGGCAGAGG - Intergenic
1108687720 13:52835273-52835295 GGGGAGGGGGAGGGGGGAAGGGG + Intergenic
1108711353 13:53035596-53035618 ATGGAGGGTGAGGATGGAAGTGG - Intronic
1108722161 13:53143181-53143203 AGTGGGGGTGAGGTGGGAAGGGG + Intergenic
1108739165 13:53317349-53317371 AGGCAGGCAGAGGCAGGCAGAGG + Intergenic
1109771630 13:66982110-66982132 AGAGAGAGTGAGTGGGGCAGGGG - Intronic
1110834371 13:80066617-80066639 AGGGAGGGAGGGGAGGGGAGGGG + Intergenic
1111446294 13:88348971-88348993 TGGGAGGCTGAGGTGGGCGGCGG - Intergenic
1112350165 13:98626386-98626408 GGGGAGGGGGAGGAGGGGAGGGG + Intergenic
1112354132 13:98660348-98660370 CAGGAGGGTTGGGCGGGCAGTGG + Intergenic
1112391191 13:98985799-98985821 AGCGCTGGTGAGGAGGGCAGGGG + Intronic
1112503665 13:99960407-99960429 AGGGTGGGGGAGAGGGGCAGGGG - Intergenic
1113403385 13:110016401-110016423 AAGGAGGGTGTGGCAGGAAGTGG + Intergenic
1113424880 13:110199624-110199646 AGGGAGCTGGGGGCGGGCAGAGG + Intronic
1113431685 13:110255918-110255940 AGGGAGGGGGAAGGAGGCAGAGG + Intronic
1113459393 13:110471349-110471371 AGGGAGGCTGGGGCAGGCTGGGG + Intronic
1113475378 13:110576872-110576894 AGGGAGTGTGAGCGGGGCATGGG - Intergenic
1113695233 13:112341550-112341572 AGGGAGGGAGAGACAGGCAGAGG - Intergenic
1113726153 13:112603845-112603867 AGGAAGGGAGAAGAGGGCAGAGG + Intergenic
1113759996 13:112840455-112840477 AGGGAGGCTGAGGCTGGGGGGGG - Intronic
1113760017 13:112840520-112840542 AGGGAGGCTGAGGCTGGGGGGGG - Intronic
1113767587 13:112890760-112890782 TGGGAAGCTGAGCCGGGCAGGGG - Intergenic
1113852580 13:113426299-113426321 AGGTGGGGTGTGGCGGGCAGGGG - Intronic
1113992667 14:16040320-16040342 AGGGAGAGAGAGACAGGCAGAGG - Intergenic
1114532142 14:23402875-23402897 AGGGAGGGAGGGGCAGGGAGGGG + Intronic
1114577900 14:23730056-23730078 AGGGAGGCTGGGCCAGGCAGGGG - Intergenic
1114637269 14:24195140-24195162 GGGTAGGGTGAGGCGGGGAGGGG - Intronic
1114758975 14:25290427-25290449 AGGGAGGGAGGGGAGGGGAGGGG - Intergenic
1114866037 14:26597241-26597263 AGGGAGGCAGGGGCGGGCGGCGG + Intronic
1115028243 14:28766856-28766878 AGGGGGGGAGAGCCGGGCGGCGG - Intergenic
1115766075 14:36624886-36624908 AGGGTGGGTGAGGGTGGGAGTGG + Intergenic
1116751192 14:48886677-48886699 TGGGAGGCCGAGGCGGGCCGAGG - Intergenic
1116898451 14:50339531-50339553 AGGGAGGGAGGGGAGGGGAGGGG + Intronic
1116904813 14:50394269-50394291 GGGTAGGGTGACCCGGGCAGGGG + Intronic
1116956653 14:50930632-50930654 AGGGAGGGGAAAGAGGGCAGTGG + Intronic
1116971026 14:51066110-51066132 AGGGAGGGAGGGGAGGGGAGGGG + Intronic
1117038932 14:51752650-51752672 GGGCAGGGGGAGGCGGGGAGAGG - Intergenic
1117560181 14:56929522-56929544 TGGGAGGCCGAGGCGGGCGGAGG - Intergenic
1117863386 14:60117683-60117705 TGGGAGGCTGAGGTGGGCGGAGG + Intronic
1117993928 14:61461073-61461095 GGGAAGGGAGAGGCGCGCAGGGG - Intronic
1118394982 14:65328405-65328427 TGGGAGGCCAAGGCGGGCAGGGG - Intergenic
1118740623 14:68736997-68737019 AGGGAAGGTGAGGGGTACAGGGG + Intergenic
1118742860 14:68753277-68753299 AGGGAGGCTGAGGCGGAAGGCGG - Intergenic
1118814149 14:69298150-69298172 AGGAAGAGTCAGGAGGGCAGAGG + Intronic
1119036136 14:71231625-71231647 AGGGAGGCTGAGGGGGGCTGAGG + Intergenic
1119190716 14:72680023-72680045 GAGGAGGGAGAGGCGGGCTGGGG + Intronic
1119443854 14:74647736-74647758 AGGGAGAGGGAGGCAGGGAGAGG - Intergenic
1119642029 14:76322727-76322749 AGGGAGTGAGACGTGGGCAGTGG + Intronic
1119847426 14:77840869-77840891 AGGGAGGGAGAGAAGGGAAGGGG + Intronic
1119932035 14:78556957-78556979 AGGGAGGGAGGGGAGGGGAGGGG - Intronic
1119991615 14:79204322-79204344 AGGGAGGGTGAGGGAGAAAGAGG - Intronic
1120699764 14:87686086-87686108 AGGGAGGGTGAGGTGGGGAGTGG - Intergenic
1120840714 14:89082838-89082860 AGGGAGGGGGAGGAAGGGAGAGG - Intergenic
1121004523 14:90480672-90480694 TGGGAGGCTGAGGCGGGAAGAGG - Intergenic
1121026049 14:90616804-90616826 ACGAAGGGTGAGGCGGGCAGTGG - Intronic
1121050485 14:90816436-90816458 AGGGGCGGGGAGGCGGGCGGCGG + Intronic
1121120273 14:91371947-91371969 AGGGTGGGAAAGGCAGGCAGTGG + Intronic
1121134743 14:91486677-91486699 TGGGAGGCTGAGGTGGGCGGAGG + Intronic
1121274123 14:92656357-92656379 AGGGTGTGTGTGGAGGGCAGAGG + Intronic
1121437680 14:93929752-93929774 AAGGAGGGTGAGGAGGGGAGCGG + Intergenic
1121529051 14:94639925-94639947 AGGCAGGGTGAGGGTGGCAAGGG + Intergenic
1121656998 14:95604536-95604558 AGAGAGGGAGAGGCCTGCAGTGG + Intergenic
1121800341 14:96769186-96769208 AGGGAGGGAGAGAGGGACAGAGG - Intergenic
1122003323 14:98682521-98682543 AGGGAGGGTGGGGCAGGATGAGG + Intergenic
1122036120 14:98950449-98950471 GGGGAGGGAGAGGAGGGGAGGGG + Intergenic
1122081521 14:99270738-99270760 GGGGAGGGGGAGCCGGGAAGTGG - Intronic
1122082840 14:99278485-99278507 AGAGAGAGAGAGGCAGGCAGAGG - Intergenic
1122088178 14:99321143-99321165 AGGGTGGGTGAGGACGGCATGGG - Intergenic
1122295424 14:100703110-100703132 TGGGTGGGTGAGGAGGGCACGGG + Intergenic
1122448227 14:101783143-101783165 AGGGAGGGGGAGGGGGAGAGGGG - Intronic
1122465697 14:101932172-101932194 AGGGAGGGAGAGAGGAGCAGGGG - Intergenic
1122604258 14:102937963-102937985 TGTGAGGGTGACGGGGGCAGGGG - Intronic
1122657855 14:103273962-103273984 GGGGAGACTGAGGCGGGGAGAGG - Intergenic
1122783244 14:104152569-104152591 AGGGAGGGGACGGCGGGCATGGG + Intronic
1122819649 14:104335045-104335067 AGGGAGGGTGCCGAGGGCCGAGG - Intergenic
1122881770 14:104693496-104693518 AGGGAGGGAGAGGGAAGCAGTGG + Intronic
1122941307 14:104982631-104982653 GGGGAGAGTGAGGCGGTTAGAGG - Intergenic
1122954713 14:105065287-105065309 TGGGAGCTGGAGGCGGGCAGAGG - Intronic
1122954879 14:105065979-105066001 AGGAAGAGGGAGGCGGGGAGGGG - Intergenic
1122982911 14:105199607-105199629 AGGTAGGGAGAGCAGGGCAGAGG - Intergenic
1123219843 14:106844951-106844973 AGGGAGGCTGCGGCGGCGAGAGG - Intergenic
1123423195 15:20148048-20148070 AGCGACGGAGAGGCGGACAGCGG + Intergenic
1123423233 15:20148216-20148238 AGCGACGGAGAGGCGGACAGCGG + Intergenic
1123471101 15:20552727-20552749 TGGGAGGATGAGGCAGGCGGAGG + Intergenic
1123532421 15:21154587-21154609 AGCGACGGAGAGGCGGACAGCGG + Intergenic
1123646957 15:22447975-22447997 TGGGAGGATGAGGCAGGCGGAGG - Intergenic
1123684402 15:22786866-22786888 CGGGTGGGGGAGGCGGGCGGCGG + Intronic
1123731402 15:23147721-23147743 TGGGAGGATGAGGCAGGCGGAGG + Intergenic
1123749540 15:23345133-23345155 TGGGAGGATGAGGCAGGCGGAGG + Intergenic
1124263129 15:28210374-28210396 TGGGAGGCCGAGGCGGGCGGCGG - Intronic
1124281913 15:28369008-28369030 TGGGAGGATGAGGCAGGCGGAGG + Intergenic
1124300790 15:28542592-28542614 TGGGAGGATGAGGCAGGCGGAGG - Intergenic
1125147707 15:36491432-36491454 AGGGAGAGAGAAGGGGGCAGGGG + Intergenic
1125284070 15:38073278-38073300 AGGGTGGGGGAGGCCGGGAGAGG - Intergenic
1125339511 15:38661052-38661074 AGGGAGGGAGGGGAGGGGAGGGG - Intergenic
1125516244 15:40322993-40323015 TGGCGGGGTGAGGCGGGCTGGGG + Intergenic
1125519708 15:40340902-40340924 CGGCAGGGAGAGGCCGGCAGAGG - Exonic
1125523612 15:40361871-40361893 AGGCTGGGTGAGCCAGGCAGAGG + Intronic
1125696697 15:41643806-41643828 TGGGAGGCTGAGGCGGGCGGAGG - Intronic
1125744767 15:41990705-41990727 AGGGAGGGAGGGGAGGGCAGGGG - Intronic
1126163104 15:45632185-45632207 AGGGAGGGAGGGGAGGGGAGGGG - Intronic
1126306817 15:47268456-47268478 AGTGAGTGTTAGGAGGGCAGAGG + Intronic
1126322207 15:47437030-47437052 AGGGAGGGTAGGGAGGGGAGGGG + Intronic
1126665128 15:51069011-51069033 AGGGAGGGAGAGGCAGGCTTGGG + Intronic
1126732617 15:51699780-51699802 GGAGAGCGGGAGGCGGGCAGTGG - Intronic
1126824146 15:52532067-52532089 AGGGATGGTGGGGTGGGGAGAGG + Intergenic
1126853676 15:52816442-52816464 TGGGAGGCTGAGGTGGGCTGAGG + Intergenic
1127221389 15:56884868-56884890 AGGGAGGGAGAGGAGGGAAGGGG + Intronic
1127253575 15:57268491-57268513 TGGGAAGCTGAGGCGGGCATGGG - Intronic
1127443507 15:59036299-59036321 TGGGAGGCTGAGGTGGGCAGCGG - Intronic
1127498276 15:59532572-59532594 TGGGAGGGTGAGGTGGGAGGAGG + Intergenic
1127693717 15:61423109-61423131 AGGGAGGAAGAGGCTGGCAAGGG + Intergenic
1127825844 15:62702096-62702118 ATGGATGATGAGGTGGGCAGCGG + Exonic
1128149059 15:65350362-65350384 TGGGAGGCTGAGGCGGGCTGAGG - Intronic
1128363242 15:66977485-66977507 ATGGATGGTGATGGGGGCAGGGG - Intergenic
1129228554 15:74183825-74183847 AGGCTGGGTGTGGCGGGCAAGGG + Intronic
1129229320 15:74188168-74188190 AGGGAGTGGGGGGTGGGCAGAGG - Intronic
1129338102 15:74866021-74866043 AGGGAGGGAGGGGAGGGGAGGGG + Intronic
1129832594 15:78680597-78680619 TGGGAGGGTGAGGCGCGGAAGGG - Intronic
1130333996 15:82943267-82943289 AGTGAGGGTGAGGAGGGCTGGGG + Intronic
1130871229 15:87973829-87973851 AGGGAGGGAGAGACAGGGAGGGG - Intronic
1130897996 15:88185571-88185593 TGGGAGGATGGGGTGGGCAGTGG - Intronic
1130915854 15:88303957-88303979 TGGGAGGCTGAGGCGGGCGGGGG + Intergenic
1131053626 15:89363140-89363162 AGGAAGGGGTAGGGGGGCAGTGG - Intergenic
1131056698 15:89379167-89379189 ACGGAGGGTCCGGCGGGCTGTGG - Intergenic
1131231881 15:90665569-90665591 GGGGAGGGACAGCCGGGCAGAGG - Intergenic
1131387811 15:92021842-92021864 AGGGAGGCTGTGGGAGGCAGAGG + Intronic
1132309641 15:100848248-100848270 AAGGAGGGGGAGGCTGGCCGTGG + Intergenic
1132420801 15:101666241-101666263 TGGGAGGCTGAGGTGGGCGGAGG + Intronic
1132475991 16:138391-138413 AGGGGGCCTGAGGAGGGCAGGGG + Exonic
1132476005 16:138423-138445 AGGGGGCCTGAGGAGGGCAGGGG + Exonic
1132476019 16:138455-138477 AGGGGGCCTGAGGAGGGCAGGGG + Exonic
1132476033 16:138487-138509 AGGGGGCCTGAGGAGGGCAGGGG + Exonic
1132476060 16:138551-138573 AGGGGGCCTGAGGAGGGCAGGGG + Intronic
1132535341 16:476434-476456 AGGGAGGGAGGTCCGGGCAGTGG - Intronic
1132667453 16:1088768-1088790 AGCAGGGGTCAGGCGGGCAGGGG - Intergenic
1132667464 16:1088800-1088822 AGCAGGGGTCAGGCGGGCAGGGG - Intergenic
1132725949 16:1338444-1338466 TGGGGGGGTGGGGCGGGAAGAGG - Intronic
1132746008 16:1436594-1436616 AGGGAGAGGGAGGAGGGGAGAGG + Intronic
1132772132 16:1569551-1569573 GGGGAGGGAGAGGAGGGGAGTGG - Intronic
1132793327 16:1706041-1706063 AGCGCGGGTGAGCCGGGCAGAGG - Intergenic
1132851372 16:2026485-2026507 GGGGAGGGTGGGGAGGGCTGTGG + Intronic
1132851592 16:2027237-2027259 GGGGAGGGGGCGGCGGGCCGGGG - Intronic
1132909014 16:2299011-2299033 AGAGGCGGTGAGGAGGGCAGGGG + Intronic
1132909033 16:2299063-2299085 AGAGGCGGTGAGGAGGGCAGGGG + Intronic
1132909052 16:2299115-2299137 AGAGGCGGTGAGGAGGGCAGGGG + Intronic
1132909071 16:2299167-2299189 AGAGGCGGTGAGGAGGGCAGGGG + Intronic
1132945564 16:2529929-2529951 AGGGAGGGGCAGGCAGTCAGTGG + Intronic
1132974985 16:2706658-2706680 TTGGAGGGTGGGGAGGGCAGGGG + Intronic
1133018491 16:2955655-2955677 AGGCAGGGGGAGCCGGGGAGCGG + Intergenic
1133225478 16:4338465-4338487 AGGAAGGGGGAGGCTGGCTGGGG + Exonic
1133229472 16:4359831-4359853 AGGGGCGGTGAGGCAGTCAGGGG - Intronic
1133229515 16:4359963-4359985 GGGGAGGGTGAGGGGGGTAGGGG - Intronic
1133270547 16:4609089-4609111 GGGGAGGGGGCGGCGGGCAGGGG + Exonic
1133281833 16:4671106-4671128 GGGGGTGGTGAGGCGGTCAGGGG + Intronic
1133303954 16:4798593-4798615 GGGGAGGGTGAGGGTGGCGGGGG + Exonic
1133485563 16:6215248-6215270 AGGGAGAGAGAGAAGGGCAGAGG + Intronic
1133767358 16:8847324-8847346 AGGGAGCGTCAGGAGGGCAGAGG - Intronic
1133834901 16:9359120-9359142 TGAGAGGCTGAGGTGGGCAGAGG - Intergenic
1133992868 16:10723614-10723636 GGAGAAGGGGAGGCGGGCAGAGG + Intergenic
1134148129 16:11784030-11784052 GGGGAGGGTGAGAAGTGCAGGGG + Intronic
1134149861 16:11797155-11797177 AGGCAGGCGGAGGCGGGCGGCGG + Intronic
1134398648 16:13889057-13889079 GGGGAGGGGGAGGGGGGGAGGGG - Intergenic
1135694760 16:24575921-24575943 AGGGAGAGGGAGGAGGGGAGAGG + Intergenic
1135970867 16:27070966-27070988 CGGGAGGCTAAGGCGGGCTGGGG - Intergenic
1136540272 16:30924545-30924567 AGAGAGGGTGAGGCTGGGGGCGG - Intronic
1136627762 16:31472347-31472369 AGGAAGGGAGAGGCAGGAAGGGG - Intronic
1136765437 16:32772720-32772742 AGGGCGGGGGAGGTGGGCGGGGG + Intergenic
1136802662 16:33097659-33097681 AGGGCGGGGGAGGTGGGCGGGGG - Intergenic
1137066228 16:35847239-35847261 AGGGAGGATGAGGAGGCCATCGG - Intergenic
1137313645 16:47292647-47292669 AAGGAGGGTGAGGGGGGTTGAGG - Intronic
1137536859 16:49333841-49333863 TGGGAGGCTGAGGTGGGAAGTGG - Intergenic
1137581182 16:49634523-49634545 TGAGGGGGTGAGGAGGGCAGAGG - Intronic
1137605626 16:49784994-49785016 TGGGAGGGGTAGGAGGGCAGGGG + Intronic
1137733986 16:50710800-50710822 GTGGTGGGTGAGGCGGGCAGTGG + Exonic
1137892397 16:52176179-52176201 AGGGATGGAGAGGCAGGCAGTGG - Intergenic
1137919670 16:52474670-52474692 AGGGAGGGAGAGAGGGACAGAGG + Intronic
1137947821 16:52751173-52751195 AGGTGGGGAGAGGAGGGCAGTGG + Intergenic
1138344433 16:56311472-56311494 AGGGAAGATGAGGATGGCAGGGG + Intronic
1138532012 16:57639688-57639710 AGGGACGGGGAGGAGGGGAGAGG - Intronic
1138538147 16:57670934-57670956 CTGGGGGCTGAGGCGGGCAGGGG - Intronic
1138585973 16:57970735-57970757 AGGGAGGCTCAGGTGGGAAGGGG + Intronic
1138921503 16:61535646-61535668 AGGGAGGGGGAGGAGAGGAGAGG + Intergenic
1139291497 16:65862595-65862617 AGGGAGGGTGGGGTGGGATGAGG + Intergenic
1139392916 16:66616779-66616801 AGGGATGGTGAGGAGGGGAGAGG - Exonic
1139439773 16:66960337-66960359 AGGGAGGGAGGGGAGGGGAGAGG - Intergenic
1139580211 16:67868622-67868644 AGGGAGGGGTGGGCAGGCAGAGG + Intronic
1139738195 16:69011558-69011580 AGGGAGGCTGAGGTGGGAGGAGG - Intronic
1139990715 16:70937845-70937867 AGGGATGGGGTGGGGGGCAGTGG - Intronic
1140176150 16:72662270-72662292 AGTGAGGGTGAGGTGGGATGGGG + Intergenic
1140408958 16:74729924-74729946 AGGCAGGGAGAGGAGGGGAGAGG + Intronic
1140412357 16:74748753-74748775 AGGCAGTGTGCGGCGGGCGGGGG + Intronic
1140914571 16:79482843-79482865 AGGGAGGGAGGGGAGGGGAGGGG - Intergenic
1141011266 16:80402075-80402097 TGAGAGGCTGAGGTGGGCAGGGG - Intergenic
1141191854 16:81830807-81830829 GGGAAGGGTGAGGGGGGCATCGG + Intronic
1141609818 16:85174946-85174968 AGGTGGGATGAGGAGGGCAGTGG + Intronic
1141614555 16:85202952-85202974 AGGGAGGGGGAGGAGGGAAGGGG - Intergenic
1141727549 16:85799724-85799746 AGGGCGGTCGCGGCGGGCAGTGG + Exonic
1141728912 16:85809009-85809031 AGGGAGGGGGAGGGAGGGAGAGG + Intergenic
1141766657 16:86063666-86063688 AGGGAGGGAGAGGGAGGGAGAGG + Intergenic
1141882336 16:86868268-86868290 TGTGAGGGTGAGGTGGGCGGAGG + Intergenic
1141991422 16:87612773-87612795 TGGGAGGCCGAGGCGGGCGGAGG + Intronic
1142006422 16:87691486-87691508 AGGGCGTGTGGGCCGGGCAGGGG + Intronic
1142034275 16:87854082-87854104 AGGCAGGGTCAGGCTGGCGGTGG - Intronic
1142189388 16:88710847-88710869 AGGGAGGTGGAGGCGGGCTTAGG + Intronic
1142196290 16:88740750-88740772 TGGGAGGGTGAGGTGGGAGGAGG + Intronic
1142205800 16:88782556-88782578 AGGGAGGGCGTGGGGGCCAGGGG + Intronic
1142251434 16:88993746-88993768 AGGGAGGGAGAGGAGGGGGGAGG - Intergenic
1142252627 16:88999673-88999695 AGGGAGGGGGCGGGGGGCAGAGG + Intergenic
1142276053 16:89119417-89119439 AGGGAGGGTGTGGCGGTCGTGGG + Intronic
1142411855 16:89921020-89921042 GGGGAGGGGAAGGTGGGCAGGGG + Intronic
1142616249 17:1137450-1137472 AGGGAGGCTGGAGCGGGGAGAGG + Intronic
1142669162 17:1479572-1479594 AGGGTGAGTGGGGCGGGCAGAGG - Exonic
1142669712 17:1482599-1482621 AGGCGGGGTGGGGAGGGCAGGGG - Intronic
1142694903 17:1628284-1628306 ACGCAGCGTGAGGTGGGCAGGGG + Exonic
1142701355 17:1663470-1663492 TGGGAGGCTGAGGCGGGCCTCGG + Intronic
1142769319 17:2085278-2085300 AGGGAGGGAGGGTAGGGCAGGGG + Intronic
1142811099 17:2395849-2395871 GAGGTGGGAGAGGCGGGCAGAGG + Intronic
1142849230 17:2696276-2696298 AGAGAGGCTGAGCCAGGCAGTGG + Intronic
1142915220 17:3131089-3131111 TGGGAGGATGAGGAAGGCAGAGG - Intergenic
1142996957 17:3766153-3766175 GGGGACGTTGAGGCAGGCAGAGG + Intronic
1143297677 17:5883486-5883508 AGGGAAGGGAAGGCGGGGAGGGG - Intronic
1143576960 17:7799347-7799369 GAGATGGGTGAGGCGGGCAGAGG - Intronic
1143583719 17:7840967-7840989 AGGGAGGGAGAGTAGGACAGAGG + Intronic
1143839855 17:9723550-9723572 AGGGAGGGAGGGGAGGGGAGGGG - Intronic
1143850692 17:9809477-9809499 AGGGTGGCTGTGGCGGGCTGGGG + Intronic
1143885788 17:10063853-10063875 ACGGGTGGTGAGGGGGGCAGAGG + Intronic
1144579598 17:16450877-16450899 AGGGAGGGTGAGGAGGGTCTAGG + Intronic
1144682294 17:17204150-17204172 GGGGACGGGGAGGTGGGCAGTGG - Intronic
1144761370 17:17709450-17709472 AGGGAGGCCGAGGCAGGCAGGGG - Intronic
1145051573 17:19666045-19666067 AGTGAGGGACAGGCGGGAAGAGG + Intronic
1145398856 17:22515452-22515474 AGGGAGGGAGAGGAGGGGAGAGG + Intergenic
1145828891 17:27898876-27898898 GTGGAGGTTGAGGTGGGCAGAGG + Intergenic
1145935435 17:28712106-28712128 AGGGTCGGTGGGGCGGGGAGCGG - Intergenic
1146049049 17:29533836-29533858 AGGGAGGGGGAGGGGGAGAGGGG + Intronic
1146068944 17:29661147-29661169 AGCGAGAGTGATGAGGGCAGAGG - Intronic
1146448800 17:32955119-32955141 AGGGAGGGTGTTGCAAGCAGAGG - Intergenic
1146625464 17:34431842-34431864 ATGGAGAGTGAGGAGTGCAGGGG - Intergenic
1146667640 17:34715607-34715629 ATGGAGGTGGAGGAGGGCAGAGG - Intergenic
1146678476 17:34790194-34790216 AGGGAGGGAGGGGAGGGGAGGGG + Intergenic
1146944179 17:36862867-36862889 AGGGAGGGAGAGGAAGGCATTGG + Intergenic
1147153741 17:38532913-38532935 AGTGAGGGGAAGGCGGGAAGGGG + Exonic
1147317178 17:39626676-39626698 AGGGAGGGGGAGAGGGGCAGCGG - Intergenic
1147317264 17:39626934-39626956 CCGGAGGGTGAGCCCGGCAGAGG + Exonic
1147375751 17:40021687-40021709 AGGGAGGGGCAGGAGGGCTGTGG + Intronic
1147401808 17:40184678-40184700 AGTGAGGGGGAGTGGGGCAGGGG + Exonic
1147449241 17:40493658-40493680 AGGGAATGTAAGGCAGGCAGTGG - Intronic
1147743545 17:42681887-42681909 AGGAAGGAAGAGGCGGGGAGAGG + Intronic
1147819517 17:43233285-43233307 AGCGAGGGAGAGGCGGGGGGGGG + Intergenic
1147820609 17:43239433-43239455 AGCGAGGGAGAGGCGGGGGGGGG + Intergenic
1147820821 17:43240698-43240720 AGCGAGGGAGAGGCGGGGGGGGG + Intergenic
1147821631 17:43245167-43245189 AGCGAGGGAGAGGCGGGGGGGGG + Intergenic
1147822725 17:43251325-43251347 AGCGAGGGAGAGGCGGGGGGGGG + Intergenic
1147825242 17:43266121-43266143 AGCGAGGGAGAGGCGGGGGGGGG + Intergenic
1147826083 17:43270856-43270878 AGCGAGGGAGAGGCGGGGGGGGG + Intergenic
1147826362 17:43272633-43272655 AGCGAGGGAGAGGCGGGGGGGGG + Intergenic
1147827250 17:43277485-43277507 AGCGAGGGAGAGGCGGGGGGGGG + Intergenic
1147828362 17:43283641-43283663 AGCGAGGGAGAGGCGGGGGGGGG + Intergenic
1147829472 17:43289805-43289827 AGCGAGGGAGAGGCGGGGGGGGG + Intergenic
1147830563 17:43295940-43295962 AGCGAGGGAGAGGCGGGGGGGGG + Intergenic
1147831247 17:43299528-43299550 AGCGAGGGAGAGGCGGGGGGGGG + Intergenic
1147875628 17:43618522-43618544 AGGGAAGGTGGGGCGGGGAGGGG + Intergenic
1148073619 17:44922710-44922732 AGGCAGGATGAGGCAGGGAGCGG + Intergenic
1148220560 17:45858751-45858773 AGGGAGGGTGAGGAAGGCAGGGG + Intergenic
1148340904 17:46872822-46872844 AGGGAGGAGGAGGCTGGGAGAGG + Intronic
1148431982 17:47650125-47650147 AGGGAGGGTGGGGTGGGGGGCGG - Exonic
1148463218 17:47849988-47850010 AGGGAGGGAGAGGAGGACGGGGG + Intronic
1148466264 17:47866905-47866927 AGGGAGGGGGAGGTGAGCAGAGG + Intergenic
1148805954 17:50264171-50264193 AGGGAGGGAGAGTGGGGAAGGGG + Intergenic
1148911624 17:50946076-50946098 AGGGAGACTGAGGCAGGGAGTGG + Intergenic
1148984992 17:51613397-51613419 AGAGAGGGAGAGGTGGGGAGAGG - Intergenic
1149595783 17:57863766-57863788 TGGGAGGCTGAGGCGGGCCGAGG + Intronic
1150477743 17:65487702-65487724 GGGGAGGAGGAGGCGGACAGTGG + Intergenic
1150477834 17:65488032-65488054 AGGGAGGGAGAGGGAGGGAGAGG + Intergenic
1150477892 17:65488276-65488298 AGGGAGAGGGAGGGAGGCAGAGG + Intergenic
1150624801 17:66835055-66835077 CGAGAGGGAGGGGCGGGCAGGGG - Intergenic
1150644355 17:66968693-66968715 AGGGAAGGTGAGGGGAGGAGAGG - Intronic
1150784971 17:68154837-68154859 AGGGAGGGAGGGGAGGGGAGGGG - Intergenic
1150830172 17:68512021-68512043 AGGGAGAGTGGGGTGGACAGAGG + Intronic
1150984860 17:70184553-70184575 AGGGAGGGAGGGGAGGGGAGAGG - Intergenic
1151316442 17:73325380-73325402 AGGGAGGAAGAGGAGGGGAGTGG + Intergenic
1151352790 17:73541576-73541598 AGGGAGGGTGGGGCGAGCTCTGG - Intronic
1151362769 17:73598503-73598525 AGGGAACGAGAGCCGGGCAGAGG - Intronic
1151418905 17:73984815-73984837 GGGGAGGGTGAGGTGGGGGGAGG - Intergenic
1151543382 17:74776684-74776706 AGAGAGGGAGAGGCTGGGAGTGG + Intronic
1151660799 17:75516940-75516962 AGCGGGGGCGAGGCGGGCCGCGG + Intronic
1151853882 17:76708419-76708441 AGGGAGAAGGAGGCTGGCAGAGG + Intronic
1151983585 17:77528415-77528437 AGGGAAGGTGAGGAGGGGAGGGG - Intergenic
1151995085 17:77603346-77603368 AGGGAGGCTGTGGGGGGCGGGGG - Intergenic
1152028014 17:77824274-77824296 AGGGAGGGTGCTCTGGGCAGAGG + Intergenic
1152220195 17:79059874-79059896 TGGGAGGCTGAGGGGGGCCGAGG + Intergenic
1152279393 17:79376375-79376397 AGGGAAGGTGGGGGTGGCAGGGG + Intronic
1152336711 17:79703091-79703113 AGGGAGGAGGAGGGGGGAAGAGG - Intergenic
1152368381 17:79870424-79870446 GGAGAGGGTGGGACGGGCAGGGG - Intergenic
1152388203 17:79987675-79987697 AGGGAGGCTGTGGCTGGGAGTGG - Intronic
1152395301 17:80029287-80029309 AAGGAGAGAGGGGCGGGCAGGGG + Intronic
1152410442 17:80120292-80120314 AGGGGAGGTGAGGTGGGGAGGGG - Intergenic
1152441375 17:80312279-80312301 AGGGAGGAAGAGGAAGGCAGGGG + Intronic
1152581692 17:81168126-81168148 AGGCAGGGGGAGGTGGCCAGTGG + Intergenic
1152616363 17:81339757-81339779 AGGAAGGGCCAGGAGGGCAGAGG + Intergenic
1152682587 17:81676820-81676842 AGGGTGGGTGAGGGGTGCTGGGG - Intergenic
1152701929 17:81823652-81823674 AGTGAGGCTGGGGTGGGCAGAGG - Intronic
1152800235 17:82327427-82327449 AGGGAAGGGAAGGAGGGCAGGGG - Intronic
1153241923 18:3038729-3038751 CAGGAGGCTGAGGCGGGCTGAGG - Intergenic
1153560013 18:6362210-6362232 AGGGAGGGAGGGGAGGGGAGGGG + Intronic
1153796615 18:8629558-8629580 CTGGAAGGTGAGGAGGGCAGAGG - Intronic
1153843235 18:9025982-9026004 AGGGAGGGTGTGGGGAGCAGGGG - Intergenic
1153905725 18:9659636-9659658 AGGGAGGGTGATGAGGCCAGCGG - Intergenic
1154355299 18:13619943-13619965 AGGGTGGGAGTGGAGGGCAGTGG - Intronic
1155066571 18:22273857-22273879 AGGGAGGAGGAGGAGGGAAGAGG - Intergenic
1155066596 18:22273932-22273954 AGGGAGGAGGAGGAGGGAAGAGG - Intergenic
1155066605 18:22273958-22273980 AGGGAGGAGGAGGAGGGAAGAGG - Intergenic
1155066619 18:22273997-22274019 AGGGAGGAGGAGGAGGGAAGAGG - Intergenic
1155147401 18:23095429-23095451 TGGGAGGCTGAGGCGGGAGGAGG + Intergenic
1155218315 18:23662585-23662607 AAGGAGGAGGCGGCGGGCAGCGG + Intronic
1155241430 18:23867138-23867160 GAGGAGGGTGGGGAGGGCAGAGG - Intronic
1155359679 18:24987709-24987731 TGGGAGGGTGAGGCGGGGCTGGG + Intergenic
1155499289 18:26470948-26470970 AGAGTGGGTGAGGTGGGCAGGGG + Intronic
1155584678 18:27351468-27351490 ATGGAGGGAGAGGCTGCCAGAGG - Intergenic
1155677123 18:28442415-28442437 TGGGAGGGTGAAGTGGGGAGGGG + Intergenic
1156333425 18:36147661-36147683 TGGGAGGCTGAGGCGGGGGGAGG - Intronic
1156352296 18:36311762-36311784 GTGGAGGTTGAGGCAGGCAGGGG - Intronic
1156475442 18:37402910-37402932 ATGGAGGGTGGGGAGGGCAGAGG - Intronic
1157260822 18:46174324-46174346 AGCGCAGGTGAGGCGGGAAGGGG + Exonic
1157268057 18:46246232-46246254 ATGGGGGGTGAGGCGGGGTGGGG + Intronic
1157366273 18:47067494-47067516 AGGGTAGGTCAGGGGGGCAGGGG - Intronic
1157470137 18:47982555-47982577 AGGGAGGGGGAGAGGGGAAGAGG + Intergenic
1157482607 18:48065110-48065132 AGGGAGGGGGCGGGGGGCACTGG - Intronic
1157544577 18:48539098-48539120 AGGGAGGGAGGGGCGGGTAGGGG - Intronic
1157583576 18:48787288-48787310 AGGGAAGGGGAGGCGGGGAAAGG + Intronic
1157599538 18:48885626-48885648 AGGGAGGCTAAGGCGGGCCAGGG + Intergenic
1158278471 18:55794505-55794527 AGGGAGAGTGAGCAGGGAAGAGG + Intergenic
1158287804 18:55904135-55904157 CGGGCGGGTGGGGGGGGCAGGGG + Intergenic
1158520764 18:58170285-58170307 TGGGGTGATGAGGCGGGCAGGGG - Intronic
1159186988 18:64988131-64988153 AGGGGGCGGGGGGCGGGCAGTGG - Intergenic
1159492987 18:69162921-69162943 AGGGAGGGGAAGGAGGGGAGGGG - Intergenic
1160090415 18:75821509-75821531 AGGTAGGGTGGCGCAGGCAGAGG - Intergenic
1160114991 18:76070070-76070092 AGGGTGGGTGGGCAGGGCAGTGG + Intergenic
1160157385 18:76443939-76443961 CCAGAGGGTGAGGAGGGCAGAGG + Intronic
1160367086 18:78335536-78335558 AGGGAGAAGGAGGAGGGCAGGGG + Intergenic
1160393882 18:78558275-78558297 ATGTAGGGTGGGGAGGGCAGGGG - Intergenic
1160448627 18:78946981-78947003 AGGGAGGAGGAGGAGGGAAGAGG + Intergenic
1160566259 18:79788322-79788344 AGCGCGGGACAGGCGGGCAGAGG - Intergenic
1160575187 18:79849123-79849145 AGACAGGGTGGGGCTGGCAGAGG - Intergenic
1160659508 19:291541-291563 AGGGAGGGGGAGGGGAGGAGGGG + Intergenic
1160788687 19:913001-913023 AGGGGAGGGGAGGCGGGGAGAGG + Intronic
1160891376 19:1380514-1380536 AGGGGGCGTGAGGCTGGCACAGG - Intergenic
1160900174 19:1424073-1424095 AGGGAGGAGGTGGCGGGGAGGGG - Intronic
1160931090 19:1569757-1569779 AGGGTGTGTGAGGCGGGGGGAGG - Intergenic
1160942709 19:1627805-1627827 ACAGGGGGTGAGGCGGGAAGGGG + Intronic
1160942719 19:1627840-1627862 ACAGGGGGTGAGGCGGGAAGGGG + Intronic
1160942729 19:1627875-1627897 ACAGGGGGTGAGGCGGGAAGGGG + Intronic
1160942739 19:1627910-1627932 ACAGGGGGTGAGGCGGGAAGGGG + Intronic
1160942767 19:1628013-1628035 ACAGGGGGTGAGGCGGGAAGGGG + Intronic
1160942777 19:1628048-1628070 ACAGGGGGTGAGGCGGGAAGGGG + Intronic
1160942824 19:1628218-1628240 ACAGGGGGTGAGGCGGGAAGGGG + Intronic
1160942862 19:1628355-1628377 ACAGGGGGTGAGGCGGGAAGGGG + Intronic
1160942899 19:1628493-1628515 ACAGGGGGTGAGGCGGGAAGGGG + Intronic
1160942930 19:1628596-1628618 ACAGGGGGTGAGGCGGGAAGGGG + Intronic
1160942967 19:1628734-1628756 ACAGGGGGTGAGGCGGGAAGGGG + Intronic
1160943031 19:1628969-1628991 ACAGGGGGTGAGGCGGGAAGGGG + Intronic
1160950450 19:1664395-1664417 AGGGAGGGAGGGGAGGGGAGGGG - Intergenic
1160954014 19:1681422-1681444 TGGGAGGTTGAGGCGGGAGGAGG + Intergenic
1160977481 19:1800468-1800490 AGGGTGGGTGAGGGGGGCGGGGG + Intronic
1160979654 19:1811205-1811227 TGGGGGGGTGAGGAGGGGAGTGG - Intronic
1161044507 19:2128106-2128128 AGGGAAGGGGAGGGGTGCAGTGG - Intronic
1161299518 19:3536037-3536059 GGAGAGGGTGGGGCGGGCTGGGG + Intronic
1161300309 19:3539284-3539306 AGGGAGGGAGGGGCTGGGAGGGG - Intronic
1161477440 19:4494329-4494351 GGGGAGGCTGAGCGGGGCAGCGG + Exonic
1161498102 19:4598287-4598309 AAGGAGGCTGAGTGGGGCAGAGG + Intergenic
1161540785 19:4850182-4850204 TGGGAGGCTGAGGCGGGTGGAGG - Intronic
1161642386 19:5432395-5432417 TGGGAGGCTGAGGCAGGCAGAGG + Intergenic
1161657730 19:5526138-5526160 GGGAAGGGTGTGGCAGGCAGAGG + Intergenic
1161680772 19:5678680-5678702 AGGCTGGGTGAGGCTGGGAGGGG - Intronic
1161750500 19:6092727-6092749 GGGGAGGGAGAGGCTGCCAGGGG + Intronic
1162072962 19:8165888-8165910 GGGGAGGGGGAGGAGGGGAGGGG + Intronic
1162090217 19:8274763-8274785 CAGGAGGCTGAGGCGGGCGGTGG - Intronic
1162092449 19:8289624-8289646 CAGGAGGCTGAGGCGGGCGGTGG - Intronic
1162126259 19:8501011-8501033 TGGGAGGCTGAGGCGGGTGGAGG - Intronic
1162269624 19:9603628-9603650 AGGGAGGGGGGGGAGGGGAGGGG + Intergenic
1162593985 19:11613092-11613114 AGGGAGGGAGGGGAGGGGAGGGG - Intronic
1162805137 19:13134162-13134184 AGGGAGGGTGTGGTGGGGGGTGG - Intronic
1162904154 19:13813550-13813572 AGAGAGGGAGAGGCAGACAGAGG + Intronic
1162962408 19:14136043-14136065 GGGGAGGTCGGGGCGGGCAGTGG + Intronic
1162962433 19:14136115-14136137 CGGGAGGTCAAGGCGGGCAGTGG + Intronic
1163029917 19:14537268-14537290 AGGGAGGGGGAGGCGGGACCAGG + Intronic
1163102923 19:15108501-15108523 AGGGAGGGTAAAAGGGGCAGGGG + Intronic
1163269299 19:16241078-16241100 TGGGAGGCCGAGGCGGGCAGAGG + Intronic
1163369934 19:16896349-16896371 CGGGAGGGCGTGGCGGGGAGGGG + Intronic
1163524142 19:17810145-17810167 ACTGAGGCTGAGGCGGGTAGGGG + Intronic
1163528533 19:17835892-17835914 ATGGAGGGTGGAGCAGGCAGAGG + Intronic
1163537789 19:17887524-17887546 TGGGAGGCTGAGGCAGGCTGAGG - Intronic
1163560853 19:18018610-18018632 CTGGAGGGAGAGGTGGGCAGGGG - Intergenic
1163722097 19:18903213-18903235 AGGGAAGGCCAGGCGGCCAGAGG - Intronic
1163726576 19:18926407-18926429 AGGAGGGGTGGGGTGGGCAGAGG + Intronic
1163776989 19:19224668-19224690 AGGGACAGGGAGGCAGGCAGGGG - Intronic
1164463041 19:28464632-28464654 AGGGAGGGAGGGTCGGGCTGGGG - Intergenic
1164566614 19:29330337-29330359 AGGGGGTGTGAGGCCAGCAGAGG - Intergenic
1164581696 19:29438916-29438938 AGGGAGGGAGAGGGAGGGAGAGG + Intergenic
1164835246 19:31351461-31351483 AGGGAGTCCGAGGCGGGCTGCGG + Intergenic
1164837902 19:31369831-31369853 TGGGAGGCTGAGGTGGGCGGGGG + Intergenic
1165072408 19:33263255-33263277 AGAGAGGGAGGGGAGGGCAGCGG - Intergenic
1165429577 19:35764946-35764968 AGGAAGGGTGATGGGGGCAGGGG - Intronic
1165770122 19:38375065-38375087 AGCGAGACTGAGGCGGGCTGGGG + Intronic
1165843558 19:38803801-38803823 AGGAAGGGTGAGAGGGGCTGAGG + Intronic
1166034008 19:40154193-40154215 AGGGTGGGTGAGGTGGGAATGGG + Intergenic
1166142700 19:40813536-40813558 AGGGAGGGAGGGACGGACAGAGG - Intronic
1166154171 19:40898354-40898376 AGGGAGAGAGAGGAGTGCAGTGG - Intergenic
1166173935 19:41052226-41052248 AGGGAGAGAGAGGAGTGCAGTGG + Intergenic
1166303068 19:41922923-41922945 ATGGAGGGAGAGGTGGGCAGAGG - Intronic
1166374695 19:42321070-42321092 AAGGAGGGTGGGGAAGGCAGTGG - Intronic
1166669451 19:44701248-44701270 AGGGTGGGTGTGGCGGGCACCGG - Intronic
1166688116 19:44808245-44808267 AGAGCAGGTGAGGAGGGCAGGGG - Intergenic
1166748653 19:45154107-45154129 AGCGAGGGTGTGGAGGGCACCGG + Intronic
1166977479 19:46613283-46613305 TGGGAGGTTGAGGCAGGCGGAGG - Intergenic
1167011870 19:46813806-46813828 AGGGAGGGTGGGAGAGGCAGTGG - Intergenic
1167112847 19:47472019-47472041 GAGGAGGCGGAGGCGGGCAGAGG + Exonic
1167206453 19:48105810-48105832 AGGGAGGGAGGGGAGGGAAGGGG - Intronic
1167250923 19:48398114-48398136 ACAGAGGGAGAGACGGGCAGAGG - Intronic
1167272188 19:48511782-48511804 AGGGATGGAGAGGCGGACAGAGG + Intronic
1167421166 19:49404203-49404225 AGGGAGGGAGAGGCTGGCCTTGG + Intronic
1167428679 19:49442449-49442471 AGGGCGGGTGAGGATGCCAGGGG - Intergenic
1167487205 19:49769604-49769626 AGGGCGGGTGTGGAGGGGAGTGG + Intronic
1167488532 19:49777697-49777719 CGGGAGGCTGAGGTGGGCGGAGG + Intronic
1167600820 19:50453870-50453892 TTGGAGGGCGAGGAGGGCAGTGG + Intronic
1167698282 19:51027402-51027424 CGGCAGGGAGAAGCGGGCAGGGG - Intronic
1167706597 19:51084659-51084681 AGGGAGGCTGAGTCAGGCTGAGG - Intergenic
1167880453 19:52453441-52453463 AGAGAGGGTGGGGCGGTGAGGGG - Intergenic
1167906458 19:52664753-52664775 TGGGGGGGTGAGGGGGGAAGAGG + Intronic
1168153330 19:54460547-54460569 AGTGAGGGTGAGGGGGGCACAGG + Intronic
1168241606 19:55091731-55091753 AGTGAGGCTGAGGAGGGCAGGGG + Intronic
1168255930 19:55165319-55165341 AGGGAGGGGGAGGAGACCAGCGG + Intronic
1168299799 19:55397761-55397783 AGGGAGGCTGAGGTGGGAGGTGG + Intronic
1168325166 19:55535175-55535197 TGGGGGGGTTGGGCGGGCAGTGG - Intronic
1168327631 19:55546319-55546341 AGGGAGGGGGCAGCGGTCAGAGG - Intergenic
1168696423 19:58406359-58406381 GGGGAGGGGGAGGAGGGAAGAGG + Intronic
925106553 2:1297166-1297188 AGGGAACCTGAGGCTGGCAGTGG - Intronic
925225964 2:2184646-2184668 GGGGAGGCTTAGGCGGGAAGAGG - Intronic
925268562 2:2584953-2584975 AGGGATTGTCAGGCAGGCAGGGG + Intergenic
925366201 2:3313846-3313868 AGGGAGGGCGAGGAAGGCAGAGG + Intronic
925408790 2:3626923-3626945 AGGGAGGGTGTGGAGGGTGGTGG - Intronic
925436457 2:3842433-3842455 AGGAAGGGGGTGGTGGGCAGAGG + Intronic
925461481 2:4067162-4067184 AGGGTGGGGGGGGCGGGCACTGG + Intergenic
925503076 2:4528714-4528736 AGGGTGGGTGAGGCGGGTGGAGG + Intergenic
926084689 2:10013043-10013065 TGGGCGGGTCAGGTGGGCAGGGG + Intergenic
926101849 2:10122908-10122930 GGGGAGGGCGCTGCGGGCAGGGG + Intronic
926125987 2:10272230-10272252 ATGGAGGGTGGGGCAGGCAGGGG - Intergenic
926207439 2:10844121-10844143 CAGGAGGGTGAGGCAGGCTGTGG + Intergenic
926510505 2:13771561-13771583 TGGGAGGCTGAGGCAGGCAGAGG - Intergenic
926783243 2:16495025-16495047 AGGGAGAGTGAGGTGGGGAAAGG + Intergenic
926803896 2:16686810-16686832 AGAGAGGTTGAGGCAAGCAGGGG - Intergenic
926973648 2:18491651-18491673 AGGGAGAGAGATGAGGGCAGTGG - Intergenic
926990718 2:18677009-18677031 AGGCAGGGTGATGCAGGCAATGG + Intergenic
927052364 2:19342866-19342888 AGGGAGGGAGGGGAGGGGAGAGG + Intergenic
927618692 2:24628057-24628079 TGGGAGGCTGAGGCGGGTGGAGG + Intronic
927638321 2:24831821-24831843 AGGGACGGGGATGGGGGCAGGGG + Intronic
927868646 2:26609284-26609306 ATAGAGGCTGAGGAGGGCAGGGG + Intronic
928149163 2:28810782-28810804 AGGGAGCGCGAGGCCGGCAGGGG - Intronic
928171853 2:29009477-29009499 AGGGTGGCTGAGCAGGGCAGAGG + Intronic
928216563 2:29366394-29366416 AGGGGAGTTGAGGAGGGCAGTGG + Intronic
928217183 2:29371517-29371539 GGGAAGGGTGAGGTGGGGAGAGG - Intronic
928218014 2:29378701-29378723 AGGGAGGGAGGGGAGGGGAGGGG - Intronic
928402513 2:30989319-30989341 AGGGATGGTGAGGGGGGCAGAGG - Intronic
929453508 2:42051327-42051349 GGGGAGGGGGAGGTGGGGAGAGG - Intronic
929488244 2:42373924-42373946 CGGGAGGCTGAGGCAGGCAGGGG - Intronic
929562016 2:42961978-42962000 AGGGAGGGGGAGGGGGCCTGTGG + Intergenic
929750321 2:44705266-44705288 AGAGAGGGAGAGGTGGGAAGAGG - Intronic
929800271 2:45093793-45093815 AGTGAGGGTGGGGCAGGCTGAGG + Intergenic
929815478 2:45227805-45227827 AGGGAGGGTGAGCCACCCAGGGG + Intergenic
930204217 2:48572212-48572234 GGGGAGGAAGAGGAGGGCAGTGG + Intronic
930686782 2:54317978-54318000 AGGGATGGTAAGGAGGTCAGAGG - Intergenic
930771507 2:55134647-55134669 AGGGTGGGTGAAGCGGGAGGTGG + Intergenic
931169839 2:59790986-59791008 AGGGAGGCTGGGGAGGGTAGGGG + Intergenic
931248015 2:60507237-60507259 AGGGAGGGAGGGGAGGGGAGGGG + Intronic
931852583 2:66266957-66266979 AGGGTGGGAGAGGGGGACAGGGG - Intergenic
932036842 2:68253901-68253923 AGGGATGGAGGGGCGGGGAGGGG - Intronic
932445332 2:71777473-71777495 TGGGAGGGGGAGATGGGCAGGGG + Intergenic
932585089 2:73022620-73022642 AGGGAGGGGGAAGGGGGAAGGGG + Intronic
932635730 2:73386186-73386208 GGAGAAGGTGAGGCGGGCCGGGG + Exonic
932689067 2:73897071-73897093 AGTGAGGGTGGGGAAGGCAGGGG - Exonic
932831022 2:74990442-74990464 AGGGATGGTGAGGTGCTCAGGGG + Intergenic
932864007 2:75322660-75322682 TGGGAGGCCGAGGCAGGCAGAGG + Intergenic
933259438 2:80115588-80115610 AGAGAGGGGGAGACGGGGAGAGG + Intronic
933498777 2:83086135-83086157 AGGGAGGGAGGGGAGGGGAGGGG - Intergenic
933687891 2:85157851-85157873 AAGGAGGGAGAGGAGGGGAGGGG - Intronic
933760433 2:85668488-85668510 AGGGAGGTTGAGGAGGGTGGAGG + Intronic
933774143 2:85761703-85761725 AGGGAGGGTGTGGCAGCCTGAGG - Intronic
933868655 2:86546361-86546383 AGGGAGGGGAAGGGGGGGAGGGG + Intronic
934516765 2:94993364-94993386 AGTGAGGCTGAGACGGCCAGTGG + Intergenic
934547502 2:95230596-95230618 AGCGATGGTGAGACGGGAAGTGG + Intronic
934553965 2:95277847-95277869 AGGGTGGATGAGGGGGGCAGGGG - Intronic
934557948 2:95297281-95297303 AGGGAGGAAGGGGTGGGCAGGGG + Intergenic
934575427 2:95397576-95397598 AGCGAGGGTGAGGCAGAGAGAGG + Intergenic
934689646 2:96348430-96348452 TGGGAGGCCGAGGCGGGCGGCGG - Intronic
934728067 2:96638038-96638060 AGGGAGCGGGAGGCGGGAGGCGG - Intronic
934765350 2:96877370-96877392 AGGGTGGGTGCGGAGGGAAGGGG - Intronic
934782209 2:96977933-96977955 CTGGAGGGTGGGGCGGGCGGGGG + Intronic
935074708 2:99729766-99729788 TTGGATGGTGGGGCGGGCAGGGG - Intronic
935230275 2:101090010-101090032 AGGAAGGAAGAGGAGGGCAGGGG + Intronic
935300839 2:101692793-101692815 GGGCAGGGTAAGGAGGGCAGAGG - Intergenic
935413308 2:102788353-102788375 ACTGAGGGAGACGCGGGCAGGGG + Intronic
935640296 2:105283712-105283734 AAGGCAGGTGTGGCGGGCAGGGG + Intronic
935828397 2:106974260-106974282 AAGGAAGGAGAGGTGGGCAGGGG + Intergenic
936006328 2:108892249-108892271 TGGGAGGGTGAGACAGGCATGGG - Intergenic
936034840 2:109102695-109102717 AGGGAGGATGAGGAAGGGAGAGG + Intergenic
936378259 2:111961393-111961415 TGGGAGGCTGAGGCGGGCGGAGG - Intronic
936557306 2:113508008-113508030 AGGGAGGGTGGGGACGGGAGCGG + Intergenic
937036847 2:118789158-118789180 TGGAAGGCTGAGGCAGGCAGAGG + Intergenic
937042308 2:118832276-118832298 AGGGAAGGTGAGGCTAGCCGAGG - Intergenic
937150937 2:119685203-119685225 AGGGGGGGGGGGGCGGGCTGAGG - Intronic
937439843 2:121906333-121906355 CGGCAGGGTGGGGCGGGGAGTGG - Intergenic
937625088 2:124035001-124035023 AGGGAGGGAGGGGAGGGGAGGGG - Intronic
937690529 2:124749960-124749982 AAGGAGGGAGAGGCTGGGAGCGG - Intronic
937859886 2:126699259-126699281 AGGGATGGGGATGCTGGCAGAGG - Intergenic
937906242 2:127054269-127054291 TGGGAGTTTGAGGCGGGCACTGG - Intronic
937907155 2:127058009-127058031 GGGAAGGGAGAGGTGGGCAGGGG - Intronic
938074080 2:128322723-128322745 AGGGCGGGGGGGGCGGGCAAGGG - Intergenic
938244308 2:129765352-129765374 AGAGAGGGAGAGGCAGGGAGGGG - Intergenic
938265754 2:129927006-129927028 AGGGAAGGTGAGGTTGGGAGTGG + Intergenic
938406511 2:131035843-131035865 GGGCAGGGTGGGGAGGGCAGTGG + Intronic
938754352 2:134365957-134365979 GGGGAGGTTGAGGTGGGGAGGGG + Intronic
938780201 2:134577695-134577717 AGGGTGGGTGGGGAGGGCTGGGG - Intronic
938863096 2:135390649-135390671 TGGGAGGGTGAGGAGGGAGGGGG - Intronic
938981647 2:136532688-136532710 TGGGAGGGTGAGCTGGGTAGAGG + Intergenic
939010296 2:136838614-136838636 AGGGAGGATGGGGAAGGCAGAGG - Intronic
939251669 2:139688707-139688729 TGGGAGGCAGAGGCGGGCAGAGG - Intergenic
939533136 2:143390593-143390615 AGGGAGGGGGAAGCGGAGAGTGG - Intronic
939618395 2:144386920-144386942 AGAGGGGGTGGGGGGGGCAGGGG - Intergenic
940312727 2:152295236-152295258 TGGGAGGCTGAAGCAGGCAGAGG - Intergenic
940591160 2:155729543-155729565 AGGAAGGCTGAGGCTGGCACGGG - Intergenic
941145676 2:161841316-161841338 TGGGAGGCTGAGGCAGGTAGAGG - Intronic
941717233 2:168777017-168777039 AGGGAGAGTGAGGCACCCAGAGG + Intergenic
941820283 2:169837616-169837638 AGGGGGGGAGAAGCGAGCAGGGG + Intronic
941987265 2:171522135-171522157 GGGGAGGTTGAGTAGGGCAGTGG - Intergenic
942451273 2:176109164-176109186 AGGGTGGGTGAGTGGGGCTGGGG - Exonic
942506220 2:176644302-176644324 AGGGAGGAGGATGCTGGCAGGGG + Intergenic
942519278 2:176786177-176786199 AGAGAGAGTGAGGTGGGGAGAGG - Intergenic
942604884 2:177680007-177680029 ACAGAGGGTGGGGCAGGCAGTGG + Intronic
942690992 2:178584942-178584964 ATGGAGGCTGAGGGGGGCCGGGG + Exonic
943735613 2:191351120-191351142 TGGGATGGTGAGGCAGGCAAGGG - Intronic
943750901 2:191508473-191508495 AGGGAGGGAGAAGGGGGCAGAGG + Intergenic
944553807 2:200868723-200868745 AGGGAGTGTGAGGCGGGAAAGGG - Intergenic
944599044 2:201284655-201284677 AGGGAGAGGGAGACGGGGAGAGG + Intronic
944599053 2:201284681-201284703 AGGGAGAGGGAGACGGGGAGAGG + Intronic
944753839 2:202739439-202739461 AGGGAGGGAGGGGAGGGGAGGGG - Intronic
944784257 2:203052223-203052245 ACAGAGGTTGGGGCGGGCAGGGG - Intronic
945740643 2:213656397-213656419 TGGGAGGCCGAGGCGGGCGGAGG - Intronic
946148231 2:217746997-217747019 AGGGTGGGTGAGGTGGGAGGAGG - Intronic
946165021 2:217858503-217858525 AGGGAGGGAGAGGGAGGAAGCGG + Intronic
946168887 2:217882029-217882051 AGGGAGTGGCTGGCGGGCAGGGG - Intronic
946221343 2:218230363-218230385 TGGGAGGTTGAGGGGTGCAGTGG - Intronic
946237463 2:218332857-218332879 GGGGTTGGTGAGGTGGGCAGGGG - Intronic
946249059 2:218402084-218402106 AGGGAGGGCGGGGCTGGCTGGGG - Intronic
946298610 2:218807584-218807606 TGGGAGGGTCAGGGGAGCAGCGG - Intronic
946310185 2:218878963-218878985 AGGGAGAGTGGGGAGGGCAGGGG + Intergenic
946420260 2:219560829-219560851 GGGGAAGGTGATGAGGGCAGTGG + Intronic
946638156 2:221753556-221753578 AGGAAGCGTGAGGGTGGCAGGGG + Intergenic
947773113 2:232686613-232686635 AGGGAGGGAGTGCCAGGCAGAGG - Intergenic
947909250 2:233790647-233790669 AGGGAGGGAGGGGAGGGGAGGGG - Intronic
947975018 2:234357994-234358016 AGGGAGGGAGGGGAGGGGAGGGG - Intergenic
948091788 2:235301734-235301756 AGGGAGGGGGAGGGGGGATGAGG - Intergenic
948156600 2:235788463-235788485 AGGGAAGGTGAGGCAGGGTGGGG + Intronic
948156611 2:235788497-235788519 AGGGTAGGTGAGGCGGGGTGAGG + Intronic
948333737 2:237192011-237192033 GGGGAAGGTGAGGCAGGGAGGGG - Intergenic
948669670 2:239559798-239559820 CAGGAGGGTGAGGCGGGGTGGGG + Intergenic
948728944 2:239951525-239951547 AGGGAGGGTGTGGCGAGAGGAGG - Intronic
948742483 2:240056920-240056942 AGGGAGGGAGAGGCGGTGTGTGG + Intergenic
948874489 2:240819665-240819687 AGGGATGGTGAGCGGGGCTGAGG - Intronic
948903581 2:240967725-240967747 AGGGTGGGGCAGGGGGGCAGAGG - Intronic
948917032 2:241039624-241039646 AGGCTGGGTGGGGCAGGCAGTGG - Intronic
949002911 2:241627773-241627795 AGCGAGGGTGTGGTGGGGAGAGG - Intronic
949009799 2:241671973-241671995 GGGCAGGGTGAGGAGGGCAGGGG - Intronic
1168826769 20:819370-819392 AGGGAGGGGGAGAGGGGGAGGGG - Intergenic
1168831007 20:845276-845298 CGGGCAGGCGAGGCGGGCAGGGG - Exonic
1168856510 20:1012952-1012974 TGGGAAGGAGAGGCGAGCAGAGG + Intergenic
1168877717 20:1182651-1182673 CGGGAGGGAGAGGCGAGAAGAGG + Intronic
1169001755 20:2172925-2172947 AGGGAGGGAGGGGAGGGGAGGGG + Intronic
1169084612 20:2818967-2818989 AGGGAAGGTGAAGGGGGCAAAGG + Intronic
1169091288 20:2862732-2862754 GGGGAGGGTGGGGCTGGGAGGGG + Intronic
1169217216 20:3800809-3800831 AGGAAGAGCGAGGCGGGCAGTGG + Exonic
1169477131 20:5941787-5941809 AAGGAGGCTGAGGCTGGCAGGGG - Intronic
1169791299 20:9413370-9413392 TGGGAGGCCGAGGCGGGCAGTGG + Intronic
1169920605 20:10730930-10730952 AGGGAGGGAGGGGAGGGGAGAGG - Intergenic
1170306475 20:14944227-14944249 AGGAAGGGAGAGGAGGGCTGGGG + Intronic
1170361879 20:15555154-15555176 AGGGAGTGAGAGGCGGCCAGGGG + Intronic
1170439876 20:16368315-16368337 AGGGAGCCTGAGGCCAGCAGAGG - Intronic
1170765321 20:19285020-19285042 AGGGAAGGGGAGGAGGGGAGAGG - Intronic
1171212230 20:23325801-23325823 AGGGGGGGTGTGGGGGGCAGGGG + Intergenic
1171437564 20:25135095-25135117 AGGAGGGGTGATGCAGGCAGGGG - Intergenic
1171794046 20:29552705-29552727 AGGGAGTGGCAGGCAGGCAGTGG + Intergenic
1171812370 20:29755471-29755493 AGGGAGAGAGAGACAGGCAGAGG + Intergenic
1171854424 20:30331685-30331707 AGGGAGTGGCAGGCAGGCAGTGG - Intergenic
1172008024 20:31830767-31830789 AGGGAGGGTGAGCTGGTCAGAGG + Intronic
1172064534 20:32209680-32209702 AGGGAGAGTGAGTATGGCAGGGG + Intronic
1172118686 20:32585440-32585462 AGGAAGGGGGGGGCGGGCGGCGG - Intronic
1172241015 20:33412483-33412505 GGGCAGGGTGAGGTGGCCAGGGG + Intronic
1172320811 20:33994026-33994048 AGGGCGGCTGCGGCGGGAAGAGG - Exonic
1172339110 20:34142478-34142500 GGGGTGGGGGAGGGGGGCAGAGG - Intergenic
1172468512 20:35174645-35174667 TGGGAGGGGGCGGCGGGCAGCGG - Intronic
1172529268 20:35618892-35618914 AGGGAGGGCGAGGCCTGGAGGGG - Intronic
1172596457 20:36154301-36154323 AGGGAGGGGGAGGAGAGAAGAGG - Intronic
1172635195 20:36405606-36405628 AGGGAGGCTGGAGCGGGCTGGGG + Intronic
1173152509 20:40579650-40579672 AGAGAGGGTGAGGCTGGAGGTGG - Intergenic
1173865857 20:46312400-46312422 AGGGAGCGGGAGGAGGGGAGTGG - Intergenic
1174080541 20:47968369-47968391 GGGGGGGGGGAGGGGGGCAGGGG - Intergenic
1174178138 20:48657747-48657769 AGTGAGGGTGTGGCTGGCCGAGG - Intronic
1174230949 20:49045249-49045271 ATGGATGGGGAGGAGGGCAGGGG + Intergenic
1174350948 20:49967607-49967629 AGGGAGGGAAAGGGGGGCGGGGG - Intergenic
1174383485 20:50172348-50172370 AGGGAGGGTCTGTCGGGCGGGGG + Intergenic
1174406456 20:50306256-50306278 AGGGAGGGAGCCGCGGGGAGGGG + Intergenic
1174566642 20:51469513-51469535 AGGGAGGAGGAGTCGGGTAGGGG - Intronic
1174863481 20:54114183-54114205 GGGGAGAGTGGGGCAGGCAGAGG + Intergenic
1175084031 20:56444269-56444291 AGGGAGGGGAACGCAGGCAGAGG - Intronic
1175248157 20:57593577-57593599 AGGGAGGAGGAGGAGGGCAATGG + Intergenic
1175356822 20:58375267-58375289 AGGGAGGGAGAGCTGGGGAGAGG - Intergenic
1175748078 20:61475523-61475545 AGAGAGGGAGGGGCGGGCAGGGG - Intronic
1175748099 20:61475576-61475598 AGAGAGGGAGGGGCGGGCAGGGG - Intronic
1175766115 20:61594124-61594146 AGGGAGGGGGAGGTGAGCTGGGG + Intronic
1175773020 20:61635588-61635610 AGGGAACGAGGGGCGGGCAGGGG + Intronic
1175936722 20:62517629-62517651 GGGGAGGCTGTGGGGGGCAGGGG - Intergenic
1175938100 20:62524455-62524477 AGGGGGGCTGAGGCAGGCGGGGG - Intergenic
1176031685 20:63015975-63015997 AGGCAGGGAGAGGCAGGGAGAGG - Intergenic
1176031688 20:63015985-63016007 AGGCAGGGAGAGGCAGGGAGAGG - Intergenic
1176031691 20:63015995-63016017 AGGCAGGGAGAGGCAGGGAGAGG - Intergenic
1176031694 20:63016005-63016027 AGGCAGGGAGAGGCAGGGAGAGG - Intergenic
1176031697 20:63016015-63016037 AGGCAGGGAGAGGCAGGGAGAGG - Intergenic
1176039238 20:63055777-63055799 AGGGAGGGTGGAGGGGGAAGAGG - Intergenic
1176139386 20:63538341-63538363 TGGGAGGGTGGGGCGGGGAGGGG - Intergenic
1176218262 20:63958220-63958242 AGGGTGGGTGCTGGGGGCAGAGG + Exonic
1176227165 20:64007365-64007387 AGGGGAGGGGAGGCGGGGAGGGG - Intronic
1176227184 20:64007407-64007429 AGGGAAGCGGAGGCGGGGAGGGG - Intronic
1176297122 21:5079880-5079902 AGGGAAGGGCAGGCAGGCAGTGG + Intergenic
1176389181 21:6154905-6154927 GGGGAGGGGGAAGGGGGCAGGGG - Intergenic
1176419151 21:6500057-6500079 AGGGAGGGTAAAGCGGAGAGGGG - Intergenic
1176513666 21:7767380-7767402 AGGGAGGGGGCGGGGGGAAGGGG - Intronic
1177662557 21:24105110-24105132 AGGGCCTGTGAGGTGGGCAGTGG + Intergenic
1178457857 21:32772209-32772231 AGGGAGGAGGAGGAGGGGAGAGG + Intergenic
1178502551 21:33137829-33137851 CGGGAGGCTGAGGCGGGAAATGG + Intergenic
1178535609 21:33407861-33407883 TGGGAGGCTGAGGCTGGCGGGGG - Intronic
1178647779 21:34397904-34397926 AGGGAGGGGGCGGGGGGAAGGGG - Intronic
1179185214 21:39080579-39080601 AGGGAGAGCGAGCAGGGCAGAGG + Intergenic
1179516449 21:41911626-41911648 TGGGAGGCTGAGGTGGGTAGAGG - Intronic
1179519416 21:41932281-41932303 AGGGATGCTTAGGCGGGCGGAGG - Intronic
1179543687 21:42100724-42100746 GGGGAGGGTGAGGAGGGCACGGG - Intronic
1179543701 21:42100758-42100780 GGGGAGGGTGAGGAGGGCATGGG - Intronic
1179543716 21:42100792-42100814 GGGGAGGGTGAGGAGGGCACAGG - Intronic
1179543729 21:42100826-42100848 GGGGAGGGTGAGGAGGGCACGGG - Intronic
1179543744 21:42100860-42100882 GGGGAGGGTGAGGAGGGCACGGG - Intronic
1179543759 21:42100894-42100916 GGGGAGGGTGAGGAGGGCACGGG - Intronic
1179609472 21:42540500-42540522 AGGGGGTGTGAGGCAGTCAGTGG + Intronic
1179694644 21:43108379-43108401 AGGGAGGGTAAAGCGGAGAGGGG - Intergenic
1179734291 21:43383343-43383365 GGGGAGGGGGAAGGGGGCAGGGG + Intergenic
1179780384 21:43696414-43696436 AGCTAGGGTGAGGCGGGCACAGG + Intergenic
1179780401 21:43696475-43696497 AGCTAGGGTGAGGCGGGCACGGG + Intergenic
1179859906 21:44182067-44182089 AGGGAAGGGCAGGCAGGCAGTGG - Intergenic
1180097173 21:45561468-45561490 AGTGAGGGTGAGGCCGGGCGCGG + Intergenic
1180140323 21:45889553-45889575 AGGGAGGAGGAGGCTGGCCGTGG - Intronic
1180157308 21:45983848-45983870 TGGGAGGGTGGGTGGGGCAGAGG + Intronic
1180185230 21:46135925-46135947 AGGGAGGGGGTGCCGGGGAGGGG - Intergenic
1180314602 22:11267201-11267223 AGGGAGAGAGAGACAGGCAGAGG + Intergenic
1180854963 22:19039951-19039973 TGGGAGGCTGAGGCGGGAGGAGG - Intronic
1181036607 22:20172640-20172662 AGCGGGGGTGAGGCAGGCTGGGG + Intergenic
1181038090 22:20179432-20179454 AGGGGAGGGGAGGTGGGCAGGGG + Intergenic
1181141178 22:20806043-20806065 AGGGGTGGTGGGGAGGGCAGGGG + Intronic
1181492866 22:23271631-23271653 AGGGAGGCTGCTGCTGGCAGAGG + Intronic
1181527198 22:23496696-23496718 AGGCAGGGTGAGGAGGCCAGAGG + Intergenic
1181527777 22:23500044-23500066 AGTGGAGGTGAGGCGGGAAGAGG - Intergenic
1181579905 22:23822350-23822372 AGGGCTGGGGAGGTGGGCAGGGG + Intronic
1181590030 22:23878349-23878371 GGGGCGGGGGAGGGGGGCAGTGG + Intronic
1182322357 22:29486263-29486285 TGGGAGGCTGAGGTGGGCAGAGG - Intronic
1182359491 22:29738260-29738282 AGGAAGGGGAAGGCGGGCTGGGG + Intronic
1182550875 22:31100171-31100193 AGAGAGGGAGAAGGGGGCAGAGG - Intronic
1182634359 22:31712558-31712580 TGGGAGGTTGAGACGGGCACTGG + Exonic
1182638770 22:31750254-31750276 AGGGAGGCTGGGGCTAGCAGAGG - Intergenic
1183058069 22:35319101-35319123 AGGGAAGGAGTGGTGGGCAGAGG + Intronic
1183102694 22:35593599-35593621 AGGGAGAGAGAGGTGGGGAGAGG + Intergenic
1183246984 22:36701528-36701550 AGGGAGGGAGGGGAGGGCATGGG - Intronic
1183252589 22:36740785-36740807 AGGGAGGGCATGGCAGGCAGGGG + Intergenic
1183293858 22:37018883-37018905 AGCGAGGCTGGGGCGTGCAGCGG + Exonic
1183306526 22:37085907-37085929 AGGGAGGGGGTGAGGGGCAGAGG + Intronic
1183312151 22:37116071-37116093 AAGCAGGGTGAGGCAGGCAGGGG + Intergenic
1183335846 22:37245325-37245347 AGGGACGGAGGGGCGGGGAGAGG + Intergenic
1183381686 22:37493377-37493399 AGAGAGTGTGAGGTGTGCAGTGG - Intronic
1183467131 22:37985416-37985438 AGGGAGGGAGAGGTGGGCAGAGG - Intronic
1183486302 22:38089250-38089272 GGGGAGGGTGGGGCGGGGGGGGG + Intronic
1183546705 22:38457979-38458001 AGGTAGGGAGAGGCAAGCAGAGG + Intergenic
1183587679 22:38762484-38762506 TGGGAGGGAGAGGGGGGCACAGG - Intronic
1183630824 22:39031665-39031687 AAGGAGGAGGAGGAGGGCAGGGG - Intronic
1183634340 22:39052045-39052067 AAGGAGGAGGAGGAGGGCAGGGG - Intronic
1183645146 22:39121476-39121498 TGGGAGGCTGAGGCGGGTGGAGG + Intronic
1183666549 22:39249429-39249451 TGTGAGGGTGAGGCAGGCAGAGG - Intergenic
1183676124 22:39299715-39299737 AGGGAGGGGGCGCCAGGCAGAGG - Intergenic
1183829816 22:40411757-40411779 AGGGAGGGTGAGCCTGGAGGAGG + Exonic
1183966088 22:41443864-41443886 TGGGAGGCTGAGGCGGGCAGCGG - Intronic
1184234631 22:43176437-43176459 AGGGAGGGAAAGGCCGGCCGTGG + Intronic
1184238831 22:43200885-43200907 AGGGGAGGAGAGGCGGGCAGTGG + Exonic
1184255936 22:43287033-43287055 AGGGTGTGTGATGGGGGCAGCGG + Intronic
1184286226 22:43473235-43473257 CGGGAGGGTGAGGAGTGAAGGGG + Intronic
1184340888 22:43885310-43885332 AGGGAGAGTGGGGTGGGCAAGGG - Intronic
1184405977 22:44301049-44301071 GGGGACGGGCAGGCGGGCAGCGG + Intronic
1184509353 22:44924061-44924083 AGGGAGGGAGGGGAGGGAAGAGG + Intronic
1184535687 22:45085186-45085208 AGGGAGGGTGTGGTGGGCTTTGG + Intergenic
1184600218 22:45539082-45539104 AGGGAGGGGGAGGATGGGAGGGG - Intronic
1184600242 22:45539131-45539153 AAGGAGGGGGAGGAGGGAAGTGG - Intronic
1184617040 22:45645469-45645491 AGGGAGGGTGGGCAGAGCAGCGG + Intergenic
1184891350 22:47381286-47381308 AGAGAGGGGGAGCCGGGGAGAGG + Intergenic
1185004890 22:48270040-48270062 GGGGACGGGGAGGGGGGCAGCGG + Intergenic
1185158136 22:49206520-49206542 AGCGAGAGCGAGGCAGGCAGAGG - Intergenic
1185254989 22:49827194-49827216 AGGGAGGCCGAGTCGGGCTGTGG - Intronic
1185280018 22:49966051-49966073 AGGTGGGGTGGGGCCGGCAGGGG - Intergenic
1185281214 22:49970908-49970930 AGGGAGGGTGAGTCACGCGGTGG - Intergenic
1185363371 22:50422787-50422809 GGGGAGGGTGAGACGGGATGGGG - Intronic
1185382407 22:50515993-50516015 CGGGAGGCTGAGGGGAGCAGAGG + Intronic
1185391060 22:50562118-50562140 AGGCGGGGTGAGGCGGGGTGAGG + Intronic
1185391110 22:50562263-50562285 AGGAGGGGTGAGGCGGGGTGAGG + Intronic
1185399333 22:50607847-50607869 AGGCAGGGTGAGGGGAGGAGGGG + Intronic
949122387 3:402308-402330 AGTGAGGGTGTGTCGGGCAAGGG + Intronic
949541468 3:5035335-5035357 TTGGAGGGTGGGGTGGGCAGTGG + Intergenic
950024522 3:9811016-9811038 AGGAAGGGTGTGTGGGGCAGCGG - Intronic
950432321 3:12958040-12958062 AGGAGGGGTGAGGCTGGCTGAGG + Intronic
950460116 3:13116107-13116129 CTGGAGGGTGAGCCAGGCAGAGG + Intergenic
950556753 3:13700689-13700711 AGGGAGGGTGCGGTTGGCTGAGG - Intergenic
950644258 3:14367690-14367712 AGGGAAGGTGATGCGGGGAGGGG + Intergenic
950657366 3:14444945-14444967 AGGAAGGGTGAGGTGGTAAGGGG - Intronic
952006489 3:28847550-28847572 AGGGAGGGGGAGAGGGGGAGAGG - Intergenic
952049699 3:29369538-29369560 AGTGAGGGTGAGGAGGAGAGAGG + Intronic
952084428 3:29800285-29800307 AGGAAGGGAGAGGAGGGAAGGGG + Intronic
952881198 3:37987207-37987229 AGGGAGGCTGGGGCAGGAAGAGG + Intergenic
952898204 3:38093276-38093298 AGAGAGGGAGGGGCGGCCAGGGG - Intronic
953024945 3:39139377-39139399 AGTGGGGGTGCGGGGGGCAGGGG - Intergenic
953329777 3:42043332-42043354 AGGGAGTGTGAGTCGGGGAGGGG - Intronic
953355568 3:42253667-42253689 AGGGAGAGTGAGCCGGGCAGAGG + Intergenic
953391663 3:42537371-42537393 AGGGAGGGTGGGGTGGCAAGGGG - Exonic
953881368 3:46693095-46693117 AGGAAGGGTGCAGCGGGGAGAGG - Intronic
953911657 3:46896366-46896388 AGAGAAGGAGAGGAGGGCAGTGG + Intronic
954411744 3:50374069-50374091 AGGGAGAGGGAGGAGGGGAGGGG + Intronic
954453989 3:50587094-50587116 AGGGAGGATGAGGCTGCCATTGG + Intergenic
954714822 3:52521770-52521792 AGGGTGGGTGGAACGGGCAGAGG + Intronic
954810067 3:53242086-53242108 AGGCAAGGTGTGGCTGGCAGTGG + Intronic
955311193 3:57888382-57888404 TGGGAGGCTGAGGCGGGTGGAGG + Intronic
955512175 3:59692238-59692260 AGGGAGGGAGAGGAGAGGAGAGG + Intergenic
955815821 3:62841609-62841631 CAGGAGGGTGAGGCAGGAAGAGG + Intronic
955996927 3:64687678-64687700 AGGGAGGGGGGTGGGGGCAGCGG - Exonic
956192645 3:66622080-66622102 AGGGGGGGTGAGGTGGGTAAGGG - Intergenic
956219320 3:66884768-66884790 AGGGAGGGAAAGGAGGGGAGGGG + Intergenic
956277246 3:67515945-67515967 GGGGAGGGGGCAGCGGGCAGAGG - Intronic
956508377 3:69967615-69967637 GGGGAGGGGGAGGCAGGCAATGG - Exonic
957468204 3:80622752-80622774 AGGGAGGGAGAGGGAGGGAGGGG + Intergenic
958431201 3:94043616-94043638 AGGGAGGGGGAGGGGAGGAGGGG - Intronic
958607774 3:96381072-96381094 TGGGAGGCTGAGGCGGGCTGAGG - Intergenic
958735649 3:98006768-98006790 GTGGAGGGTGAGGAGGGCAGAGG + Intronic
959087586 3:101868084-101868106 GGGGAGGGGGAGGGGGACAGGGG - Intergenic
959542636 3:107557906-107557928 AAGCAGGATGAGGAGGGCAGTGG + Intronic
960047565 3:113212237-113212259 AGTTGGGGCGAGGCGGGCAGCGG + Intronic
960155655 3:114295123-114295145 AGGGAGGTTGAGATGGGCTGAGG + Intronic
960664088 3:120093900-120093922 AGGGAGGGAGAGGGAGGGAGGGG + Intronic
961016970 3:123475915-123475937 AGAGAGGGTAAGGAAGGCAGGGG + Intergenic
961190130 3:124953450-124953472 AGGCATGGTGGGGAGGGCAGAGG - Intronic
961374034 3:126450617-126450639 AGGAAGGGAGATGCGGGTAGGGG - Intronic
961381101 3:126497089-126497111 GTGGAGGAGGAGGCGGGCAGGGG - Intronic
961387559 3:126530929-126530951 AGGGGGCCTGAGGCAGGCAGGGG + Intronic
961412008 3:126729377-126729399 AGGGAGCGGGGAGCGGGCAGGGG + Intronic
961443531 3:126967042-126967064 AGGGAGGGGGCAGTGGGCAGAGG - Intergenic
961480253 3:127174911-127174933 AGGGAGGGTGAGGTGCTCTGTGG + Intergenic
961530590 3:127537629-127537651 AGGAAGGGTGTGCTGGGCAGGGG - Intergenic
961748187 3:129079320-129079342 AGGAAGGGAGGGGAGGGCAGGGG + Intergenic
962606293 3:137035389-137035411 AGGGTGTGTGAGGGGGGCATCGG + Intergenic
962727748 3:138249739-138249761 AGGGAAGGAGAGGCAGGGAGGGG + Intronic
962924355 3:139977701-139977723 GGGGAGGGGGTGGGGGGCAGTGG + Intronic
962990368 3:140572445-140572467 AGGAAGGGTGATGCAGGTAGAGG + Exonic
963289221 3:143470233-143470255 TGGGAGGCTGAGGCGGGTGGTGG + Intronic
963738502 3:149049994-149050016 AGGGAGGGGGAGGGGAGGAGTGG + Intronic
964376331 3:156052138-156052160 GGGGAGGTTGTGGGGGGCAGGGG - Intronic
964394497 3:156231483-156231505 AGGGAGGGAGGGGAGGGGAGGGG - Intronic
964449420 3:156796694-156796716 CAGGAGGCTGAGGCAGGCAGAGG + Intergenic
964763137 3:160153313-160153335 AGGGAGGGGGAAGCAGCCAGGGG - Intergenic
965682284 3:171263852-171263874 ATGGAGGGCAGGGCGGGCAGAGG + Intronic
965768893 3:172160014-172160036 AAGGTGGGGGAGGCCGGCAGGGG + Intronic
966314021 3:178625256-178625278 AGGCAGAGAGAGGCAGGCAGGGG + Intronic
966594584 3:181713597-181713619 GGGGAGGGTGGGGAGGGCGGGGG + Exonic
966797576 3:183730303-183730325 TGGGAGGCCAAGGCGGGCAGGGG - Intronic
966817013 3:183897521-183897543 CGGGAGGCTGAGGCAGGCAAAGG + Intergenic
966821045 3:183924806-183924828 AGGGCGGCTGAGGCAGCCAGGGG + Intronic
966861403 3:184232858-184232880 AGGCAGGGGGAGAGGGGCAGAGG + Intronic
966901707 3:184491528-184491550 GGGGAGAGGGACGCGGGCAGGGG + Intronic
967167158 3:186791381-186791403 TGGGAGGGTGAGGCGGGAGGTGG + Intronic
967557117 3:190873335-190873357 AGGGAGGGAGAGAGAGGCAGTGG - Intronic
967847931 3:194058567-194058589 GGGGAGGGGGACGGGGGCAGGGG + Intergenic
967882896 3:194314284-194314306 AGGGAGGGAGAGGCTGCCAGCGG - Intergenic
967937016 3:194737146-194737168 AGGCAGGGTGGGGAGGGAAGAGG - Intergenic
968288882 3:197523913-197523935 AGGGCTGGAGAGGAGGGCAGGGG + Intronic
968442405 4:630541-630563 AGGGAAGCTGAGGAGGGCAGAGG + Intronic
968563186 4:1295763-1295785 GGCGCGGGTGAGGGGGGCAGAGG - Intronic
968603855 4:1522365-1522387 CATGAGGGTGAGGGGGGCAGGGG - Intergenic
968610942 4:1556750-1556772 AGGCTGGGTGGGGCGGGCTGGGG - Intergenic
968616280 4:1579169-1579191 AGGGAGGGCAGGGGGGGCAGGGG - Intergenic
968650492 4:1758452-1758474 AGGGAGGGTAAGGCAGGCCCCGG + Intergenic
968658386 4:1788417-1788439 GGGGTGGGTGGGGCGGGCAGTGG - Intergenic
968738008 4:2308513-2308535 AGGGAGGGAGGGGAGGGGAGGGG + Intronic
968762481 4:2449805-2449827 AGGGAAGGTGGGGTGGGGAGAGG + Intronic
968808523 4:2789807-2789829 AGGGAGGATGAGGCAGGCAGGGG + Intergenic
968933591 4:3597498-3597520 AGGGAAGCTGAGTCAGGCAGGGG + Intergenic
969228592 4:5814757-5814779 AGGGCTGGGGAGGGGGGCAGGGG - Intronic
969244778 4:5925119-5925141 TGGGAGGGAGAGGCCAGCAGAGG + Intronic
969373528 4:6748666-6748688 TGGGAGGGTGGGACCGGCAGCGG - Intergenic
969406505 4:6996621-6996643 GGGGATGTTGAGGCAGGCAGAGG + Intronic
969422408 4:7104983-7105005 AGGAAGGGAGGGGCAGGCAGGGG - Intergenic
969547626 4:7841893-7841915 GGTGAGGGAGAGGAGGGCAGGGG + Intronic
969636195 4:8370592-8370614 GGGGAGTGGGAGGAGGGCAGAGG + Intronic
969728581 4:8940030-8940052 AGGGAGGGTGGGGTGGGCAGAGG + Intergenic
970403913 4:15743945-15743967 ATGGAGGGTGAGAGAGGCAGTGG + Intergenic
970637185 4:18021989-18022011 CGGGAGGGGGAGGAGGGTAGTGG - Intergenic
971326795 4:25651019-25651041 TGGGAGGTGGAGGCGGGCTGAGG + Intergenic
971413156 4:26396652-26396674 TGGGAGTGGGAGGCGGGGAGGGG + Intronic
971776645 4:30974809-30974831 AGGGTGGGCGATGGGGGCAGGGG + Intronic
972278959 4:37585143-37585165 GGGGAGGGTCAGGAGGGGAGGGG + Intronic
972415800 4:38839134-38839156 AGGGAGGGAGGGGAGGGAAGGGG + Intronic
972698191 4:41468336-41468358 AGGGAGGAGGAGGAGGGGAGGGG - Intronic
972842435 4:42947202-42947224 AGAGAGGATGAGGTGGTCAGTGG + Intronic
972931094 4:44072219-44072241 AGGGAAGCTGATGCGGGCTGAGG - Intergenic
973581635 4:52349648-52349670 AGGGGGTGGGAGGTGGGCAGGGG + Intergenic
973683641 4:53347245-53347267 AGAGAGGGTGAAGCTGGAAGAGG - Intronic
973692403 4:53451068-53451090 TGGAAGGCTGAGGCAGGCAGAGG - Intronic
974482970 4:62470269-62470291 GGGGAGGGGGAGGGGGGAAGGGG - Intergenic
974505868 4:62771736-62771758 ATGGGGGGTGGGGCGGGCAATGG - Intergenic
974877736 4:67718211-67718233 AGGCAGGGTGAGGGTGGGAGAGG + Intergenic
974880393 4:67749654-67749676 AGGGAGGGAAAGGAGGGAAGGGG - Intronic
975194232 4:71504872-71504894 TGGGAGGGGGAGGTGGGAAGAGG - Intronic
975590517 4:75995159-75995181 AGGGAGTGTGGGGTGAGCAGAGG - Intergenic
975756976 4:77580749-77580771 AAGGAGGGAGAGGAGGGGAGGGG - Intronic
976389357 4:84493263-84493285 CGGGAAGGTGCGGCGGGCGGCGG + Exonic
976744780 4:88392023-88392045 AGGGAGGGAGAGAAGGGGAGGGG - Intronic
977732143 4:100366460-100366482 AGGGGTGGAGAGGCAGGCAGCGG - Intergenic
977821357 4:101475795-101475817 TAGGAGGGTGAGGTGGGAAGTGG + Intronic
977957377 4:103045617-103045639 TGGGGGGGTGGGGCGGGGAGAGG + Intronic
978030003 4:103929862-103929884 TGGGAGGCTGAGGCAGGGAGGGG - Intergenic
978913235 4:114091382-114091404 AGGGAGGCTGAGGTGGGAAGAGG - Intergenic
979649006 4:123107734-123107756 AGGGAGGCTGAGGAGGGCTGAGG - Intronic
980044725 4:127974745-127974767 TGGGAGGCTGAGGAGGGTAGAGG + Intronic
980544739 4:134244446-134244468 AGGGAGGCTGAGGGGGACTGAGG + Intergenic
981082569 4:140649726-140649748 GAAGAGGGTGAGGGGGGCAGAGG + Intronic
981568955 4:146131583-146131605 AGGGAGGGTGAGGCTGCCGTGGG - Intergenic
981920245 4:150078572-150078594 AGGAAGGGTGGGGCGGGGCGCGG - Intronic
981937021 4:150249472-150249494 AGGGTGGTTGAGGCGGGGAGGGG + Intronic
982358285 4:154491960-154491982 AGGGAGGGGAAGGCAGGCGGCGG - Intergenic
983191230 4:164755524-164755546 AGGGAGGGAGAGGAGAGGAGGGG + Intergenic
983254084 4:165379087-165379109 GGGGAAGGTGAGGCGAGTAGAGG + Exonic
983974955 4:173922522-173922544 TGGGAGGCTAAGGCGGGCCGAGG + Intergenic
984008509 4:174342430-174342452 AGGGAGGGAGGGGAGGGGAGGGG + Intergenic
984020072 4:174474839-174474861 AGCGAGGGTGATGCAGGCAATGG - Intergenic
984261870 4:177452327-177452349 AGGAAAGGAGAGGCGGGGAGAGG - Intergenic
984368607 4:178831537-178831559 GAGGATGGTGGGGCGGGCAGCGG + Intergenic
984421994 4:179535346-179535368 TGGGAGGCCGAGGCGGGCGGCGG + Intergenic
984522978 4:180823559-180823581 AGGGAGGGAGAGGGAGGGAGAGG - Intergenic
984522982 4:180823569-180823591 AGGGAGGGAGAGGGAGGGAGAGG - Intergenic
984522992 4:180823593-180823615 AGGGAGGGAGAGGGAGGGAGAGG - Intergenic
984522996 4:180823603-180823625 AGGGAGGGAGAGGGAGGGAGAGG - Intergenic
984523000 4:180823613-180823635 AGGGAGGGAGAGGGAGGGAGAGG - Intergenic
984523004 4:180823623-180823645 AGGGAGGGAGAGGGAGGGAGAGG - Intergenic
984523008 4:180823633-180823655 AGGGAGGGAGAGGGAGGGAGAGG - Intergenic
984523020 4:180823663-180823685 AGGGAGGGAGAGGGAGGGAGAGG - Intergenic
984523036 4:180823701-180823723 AGGGAGGGAGAGGGAGGGAGAGG - Intergenic
984523046 4:180823725-180823747 AGGGAGGGAGAGGGAGGGAGAGG - Intergenic
984751047 4:183275065-183275087 AGGGAGGGTGAGGAGGAAAAGGG - Intronic
984780894 4:183524991-183525013 AGAGACGGTGAGGGGGGCGGTGG - Intergenic
984865261 4:184275405-184275427 AGCGAGGGTGGGGTAGGCAGTGG - Intergenic
984897850 4:184557765-184557787 AGGGAGGGAGAGGGGGACAGGGG + Intergenic
984974192 4:185215900-185215922 CGGGAGGGTGAGGTGGGAGGTGG - Intronic
985135882 4:186785722-186785744 TGGGAGGCTGAGGCAGGCAGAGG - Intergenic
985323049 4:188735466-188735488 AGGGAGGGAGAGGGAGGGAGGGG - Intergenic
985624820 5:979829-979851 AGGTGGGCAGAGGCGGGCAGAGG + Intronic
985625407 5:982847-982869 AGGGAGGGGCTGGCAGGCAGAGG + Intergenic
985703745 5:1388840-1388862 AGGGAGGGTGAGAGGGAAAGGGG - Intergenic
985733406 5:1564057-1564079 AGGGGAGGTGAGGAGGACAGGGG - Intergenic
985813713 5:2111028-2111050 AGCGAGGGAGAGGTGGGCAGAGG + Intergenic
986707402 5:10463390-10463412 AGGGCTGGTGGGGTGGGCAGAGG + Intronic
986707506 5:10463880-10463902 CAGGAGGCTGAGGCGAGCAGGGG - Intronic
987050213 5:14142911-14142933 AGGCGGGGTGACGCGGGCCGGGG - Intergenic
987222202 5:15802375-15802397 AGGGACGGTGGGGCGGGGTGGGG - Intronic
987261183 5:16205181-16205203 AGGGGGAGTGAGGGAGGCAGAGG + Intergenic
988450274 5:31335259-31335281 AGAGAGAGAGAGGTGGGCAGTGG - Intergenic
988515990 5:31905222-31905244 TGGGAGGCTGAGGAGGGCGGTGG - Intronic
988550972 5:32200594-32200616 AGGGAGGGAGGGGAGGGGAGGGG + Intergenic
988577361 5:32440405-32440427 TTGGAGGCTGAGGCGGGCGGAGG + Intronic
988577895 5:32444470-32444492 AGGGAGTGCGAGGCGGGAGGGGG - Intronic
988610891 5:32723880-32723902 AGGAAGGGAGAGGAGGGGAGAGG - Intronic
988777537 5:34490804-34490826 GGGGAGGGTGGCGGGGGCAGTGG + Intergenic
988921434 5:35946268-35946290 AGGAAGAGAGAGGCTGGCAGGGG - Intergenic
989011427 5:36876825-36876847 AGGGAGGGGGGGGAGGGCGGGGG - Exonic
989041340 5:37232728-37232750 TGGGAAGTTGAGGCAGGCAGGGG + Intronic
989474377 5:41857404-41857426 AGGGATGGTGAGGCCAGGAGAGG - Intronic
989520620 5:42396387-42396409 AGGGAGGCTGAGGGGGGCTGAGG + Intergenic
989812521 5:45695636-45695658 AGGGAGGGTGGGGCGGCGACCGG + Intronic
990446135 5:55896467-55896489 AGGGAGGGAAAGGAGGGAAGGGG - Intronic
990446213 5:55896636-55896658 GGGAAAGGTGAGGCGGGGAGGGG - Intronic
990539321 5:56756813-56756835 AGGGAAGGTGGGGTGGGAAGTGG + Intergenic
990588811 5:57240866-57240888 CGGGAGGCTGAGGCAGGCGGAGG + Intronic
990794016 5:59519549-59519571 TGAGTGGGTGAGGCGGACAGTGG + Intronic
991425940 5:66491871-66491893 AGGGAGGTTGAGGCGGAGAGAGG + Intergenic
991443258 5:66673726-66673748 TGGGAGGCCGAGGCAGGCAGAGG - Intronic
991481885 5:67089997-67090019 AGGGATGGTGGGGTGGGCGGTGG - Intronic
992362058 5:76049035-76049057 AGGGAGGGAGGGGAGGGGAGGGG + Intergenic
992603023 5:78424114-78424136 TGGGAGGCCGAGGTGGGCAGAGG - Intronic
992877757 5:81074804-81074826 AGGAAGAGTGAGGCAAGCAGAGG + Intronic
993416378 5:87638500-87638522 AGGGAGGGTGAAGTGGGTGGGGG + Intergenic
993703389 5:91143861-91143883 AGGGAGGCTGAGGGGGGCTGAGG - Intronic
994510034 5:100690850-100690872 AGGAAGGGAGGGGCGGGGAGGGG - Intergenic
994570263 5:101506013-101506035 CGGGGAGGTGTGGCGGGCAGAGG + Intergenic
994825877 5:104712548-104712570 ATGAAGGGTGAGGCAGGAAGTGG - Intergenic
995198566 5:109400500-109400522 CGGGGGGGTGTCGCGGGCAGTGG + Intronic
995518503 5:112977150-112977172 AGGGAGGCTGCGGCGGAAAGAGG - Intronic
995629417 5:114117359-114117381 AGGAAGGGTGAGGCACTCAGAGG - Intergenic
996238793 5:121169310-121169332 TGGGAGGGTGAGGTTGGTAGTGG + Intergenic
997340370 5:133140313-133140335 TGGGTGGGTGAGGCGGGGAGTGG - Intergenic
997385380 5:133468171-133468193 AGGCTGGGGGAGGCAGGCAGGGG + Intronic
997643439 5:135464914-135464936 TGGGAGGCTGAGGCAGGAAGAGG - Intergenic
997977407 5:138448437-138448459 GGGGAGGGAAAGGCTGGCAGAGG + Intergenic
998066978 5:139167198-139167220 TGGGAGGCTGAGGCGGGGGGTGG - Intronic
998377653 5:141701875-141701897 AGCGAGGGGGAGGCAGGCTGGGG + Intergenic
998397037 5:141825430-141825452 AGGGAGTGGGAGAGGGGCAGGGG - Intergenic
998411378 5:141914192-141914214 AGGGAACGTGATGCAGGCAGTGG + Intergenic
998445753 5:142197173-142197195 AGGGATGGTGTGGCGGGGGGAGG - Intergenic
998466953 5:142354189-142354211 AGGGAGAGTGAGGAGGGTGGGGG + Intergenic
998492477 5:142559204-142559226 TGGGAGGCTGAGGCGGGTGGAGG - Intergenic
998908180 5:146929130-146929152 AGAGAGAGGTAGGCGGGCAGTGG - Intronic
998957627 5:147453714-147453736 AGGGGGGCGGAGGCGGGCGGAGG - Intronic
999120723 5:149207318-149207340 AGGGAGGGTGTCTCAGGCAGAGG - Intronic
999143007 5:149375035-149375057 AGTGGGGGTGGGGCAGGCAGAGG - Intronic
999143968 5:149380664-149380686 AGGGAATGTGAGGAGGACAGAGG + Intronic
999150436 5:149422923-149422945 GGGGAGGGTGAGGGGGGAAGTGG - Intergenic
999212846 5:149905276-149905298 AGGGAGAGGGAGACAGGCAGTGG - Intronic
999256014 5:150210384-150210406 AGGGATGATGGGGTGGGCAGGGG + Exonic
1000285175 5:159820445-159820467 GTGGAGGGTGAGGAGGGCAGGGG - Intergenic
1001276422 5:170354766-170354788 AGGGAAGGTGAGGCCCTCAGAGG + Intronic
1001419462 5:171575505-171575527 AGGGATGTGGAGGCGGGAAGAGG - Intergenic
1001559314 5:172659025-172659047 GGGGGGGGGGGGGCGGGCAGGGG - Intronic
1001564101 5:172688432-172688454 AAGGAGGGAGAGGAAGGCAGGGG + Exonic
1001568713 5:172716570-172716592 AGGGAGGGTGGGCAGGGCTGGGG - Intergenic
1001568832 5:172717193-172717215 AGGGAGGGAGAGAAAGGCAGTGG - Intergenic
1001686344 5:173597564-173597586 AGGGAGGGAGAGGAGGGGAAGGG - Intergenic
1001963597 5:175895063-175895085 AGGCAGGGAGAGGTGGGGAGGGG - Intergenic
1002027244 5:176403993-176404015 TGGGAGGCTGAGGCAGGCAGAGG - Intronic
1002087504 5:176785232-176785254 ACGCAGCGTGAAGCGGGCAGAGG + Intergenic
1002135043 5:177102184-177102206 AGGGAGGGGGAGGCGCACGGTGG + Intergenic
1002315675 5:178341602-178341624 TGGGTGGGTGAGGCTGGAAGAGG + Intronic
1002401142 5:178992137-178992159 AGGGAGGGTAAGGGGGGCCCAGG + Intronic
1002526085 5:179816888-179816910 AGGGAGGGAGAGGCTGGCGAGGG + Intronic
1002568859 5:180128879-180128901 AGGGAGGGTGACGGGGGCCGGGG + Intronic
1002594584 5:180313679-180313701 AGAAGGGGTGAGGCGGGAAGGGG + Intronic
1002765572 6:235868-235890 AGAGAGGGAGAGGAGGGAAGGGG + Intergenic
1002895347 6:1376899-1376921 ATGGAGGCTGAGGGAGGCAGGGG - Intergenic
1002897444 6:1388031-1388053 AGGGCGGGTGGGGAGGGGAGGGG - Intergenic
1003060895 6:2861332-2861354 AGGGAGGGGGAGGAAGGGAGAGG - Intergenic
1003318913 6:5035564-5035586 AGGGAGGGAAAGGAGGGGAGGGG - Intergenic
1003323401 6:5073132-5073154 TGGGAGGCCGAGGCGGGCAGTGG + Intergenic
1003498905 6:6687795-6687817 AAGGAGGGAGAGGGGGGCAATGG - Intergenic
1003518109 6:6834560-6834582 AGGGAGGTGGAGGTGGGGAGTGG - Intergenic
1003520962 6:6857717-6857739 AGGCAGGGTGAGGTTGGCAGAGG + Intergenic
1003617798 6:7671003-7671025 AGGGAGGGTGCTGAAGGCAGTGG - Intergenic
1004044254 6:12011276-12011298 GGGGAGGGGGAGGCGGGGGGGGG - Intronic
1004081090 6:12393991-12394013 AGGTGAGGTGAGGCAGGCAGTGG + Intergenic
1004378197 6:15109065-15109087 AGAGAGGGTGAGGCAGGTCGGGG - Intergenic
1004443089 6:15672211-15672233 ACTGAGGGGGAGGTGGGCAGGGG + Intergenic
1004536594 6:16509096-16509118 AGGGAGGGGGAAGGGGGAAGGGG + Intronic
1004610077 6:17231705-17231727 TGGGAGGCTGAGACAGGCAGTGG + Intergenic
1004651671 6:17615921-17615943 AGGGTGGGTGAGGCAGGGTGGGG + Exonic
1005057450 6:21743489-21743511 TGGGAAGCTGAGGCAGGCAGCGG - Intergenic
1005111157 6:22283543-22283565 TGGGAGTGTGAGACAGGCAGAGG - Intergenic
1005310688 6:24556182-24556204 AGGAGGGGAGAGGAGGGCAGAGG - Intronic
1005652364 6:27895861-27895883 AGGGAGCGGGAGGGGGGCGGGGG + Intergenic
1005668863 6:28084410-28084432 TGGGAGGCTGAGATGGGCAGTGG + Intronic
1005683009 6:28225404-28225426 AGGGAGGGTGGGGCTGGAAAAGG + Intronic
1005717924 6:28569296-28569318 AGGGAAGGTGGGGTGGGGAGGGG - Intergenic
1005952628 6:30642931-30642953 CGGTAGGGTGTGGGGGGCAGAGG - Exonic
1006088700 6:31615357-31615379 AGGGAGGGTGGGATAGGCAGCGG + Intronic
1006103742 6:31703320-31703342 AGGGAGGGCGGGGCCGGCAGGGG - Exonic
1006132071 6:31875711-31875733 AGGGAGGCTGAGGTGGGGTGGGG + Intronic
1006137774 6:31906382-31906404 AGGCAGGTTGAGGCTGGGAGAGG - Intronic
1006155017 6:32009234-32009256 TGGGAGGGTGAGGCTGGGAGGGG - Intergenic
1006161328 6:32041969-32041991 TGGGAGGGTGAGGCTGGGAGGGG - Intronic
1006185412 6:32178882-32178904 AGAGAAGGTGGGGCGGGGAGTGG + Intronic
1006371671 6:33648450-33648472 TGGGAGGATGAGGGGGGCAATGG - Intronic
1006375690 6:33670590-33670612 AGGCAGGGTGGGCGGGGCAGGGG + Intronic
1006412361 6:33881702-33881724 AGGGAGGTTGAGGGGAACAGGGG + Intergenic
1006436613 6:34029110-34029132 AGGAAGGGAGAGGCAGGGAGGGG - Intronic
1006503974 6:34476407-34476429 AGGGAGTGTGGGGAGGGCTGGGG - Intronic
1006544937 6:34772766-34772788 AGGGAGGGGAGGGCAGGCAGAGG - Intronic
1006750113 6:36371700-36371722 AGGGAGGCAGTGGGGGGCAGTGG + Intronic
1006831060 6:36968668-36968690 AGGGAAGGTGAGGCGAGGTGGGG - Exonic
1007630085 6:43268591-43268613 AGAGAGGGTCAGGCTGGGAGAGG + Intronic
1007685941 6:43667489-43667511 GGGGCGAGTGAGGCGGGCATGGG + Intronic
1008279054 6:49573654-49573676 AGGGAGGGAAAGGCAGGCTGGGG + Intergenic
1008303007 6:49865718-49865740 AGGGAAGTTGAGGAGGGCTGAGG + Intronic
1008342227 6:50381201-50381223 AGGGAGTGGGAGGCTGACAGAGG + Intergenic
1009392001 6:63155751-63155773 AGGGAGGATGAGGCAGGAGGTGG - Intergenic
1009590508 6:65663784-65663806 AGGGAGGCTGAGGCAGGAAATGG - Intronic
1010564942 6:77399412-77399434 AGTGGGGGTGGGGCGGGGAGTGG + Intergenic
1011152126 6:84286224-84286246 AGGGAGGGAGAGGAGGGGAAGGG - Intergenic
1011219318 6:85037169-85037191 AGAGAGGGTGAGGCTGGAAGAGG - Intergenic
1011406702 6:87022866-87022888 AGGGAGGGAGGGGAGGGAAGGGG + Intergenic
1011410237 6:87059748-87059770 GGGGAGGGGGAGGCGGGGGGAGG + Intergenic
1011474390 6:87736841-87736863 AGGGAGGGGGAGGGGGGAGGGGG + Intergenic
1011474420 6:87736887-87736909 GGGGAGGGGGAGGGGGGGAGGGG + Intergenic
1011474437 6:87736912-87736934 AGGGAGGGGGAGGGGGGGAGGGG + Intergenic
1011755469 6:90494339-90494361 AGAGAGTGTGAGGTGGGCAGAGG - Intergenic
1012244226 6:96908726-96908748 AGGGAGGGGGGTGCGGACAGTGG - Intergenic
1012305572 6:97653394-97653416 AGGGAGGGAGGGGAGGGGAGGGG - Intergenic
1012632131 6:101483808-101483830 TGGGAGGCTGAGGCGGACTGAGG - Intronic
1012639223 6:101588362-101588384 AGGCAGGTTGAGGTGTGCAGGGG + Intronic
1013036545 6:106390385-106390407 AGGGAGAGAGAGGAGGGAAGGGG - Intergenic
1013056596 6:106589199-106589221 AGGGAGGGGGAGGAGGGAGGAGG + Intronic
1013306138 6:108848600-108848622 AGGGCGGGAGAGGCGGGCCGGGG - Intronic
1013331366 6:109104654-109104676 CGGGAGGTTGAGGCTTGCAGTGG - Intronic
1014038836 6:116800179-116800201 AGGGAGGGAGGGGAGGGGAGGGG - Intronic
1014138179 6:117911390-117911412 AGGGAGGGAGGGGAGGGGAGGGG - Intronic
1014513461 6:122353965-122353987 TGGGGGGGTGGGGAGGGCAGGGG + Intergenic
1014648365 6:124004431-124004453 AGGGAGGGTGGGGAAGGAAGAGG + Intronic
1014677012 6:124379206-124379228 AGGGAGGGAAAGGAGGGAAGAGG + Intronic
1015234118 6:130951261-130951283 AAGGAGGGGGAGGGGGGGAGGGG + Intronic
1015334333 6:132020200-132020222 AGGGAGAGTGATGCAGGCAAGGG + Intergenic
1015612720 6:135042701-135042723 CAGGAGGCTGAGGCAGGCAGGGG + Intronic
1015612933 6:135045150-135045172 TGGGTGGGTGAGGTGGGGAGCGG + Intronic
1015717428 6:136206739-136206761 GGGGAGGGGGAGAAGGGCAGTGG + Intergenic
1015756876 6:136616545-136616567 TGGGAGGCTGAGGTGGGGAGAGG - Intronic
1016099824 6:140085299-140085321 AGGGTGGGTGTGGGGGGAAGGGG + Intergenic
1016574740 6:145556444-145556466 AGTGATGGTGAGGCCAGCAGGGG - Intronic
1016710899 6:147170802-147170824 TGGGAGGCCGAGGTGGGCAGAGG + Intergenic
1017220065 6:151955864-151955886 AGGGAGGGTGAGAGGAGGAGAGG - Intronic
1018036696 6:159888201-159888223 ATGGAGAGTCAGGAGGGCAGGGG - Intergenic
1018252369 6:161883502-161883524 AGGGAAGGTGGGGAGGGGAGGGG + Intronic
1018923772 6:168193165-168193187 AGGACGGGTGGGACGGGCAGTGG + Intergenic
1018962081 6:168456317-168456339 AGGGTGGGTGGGGCGTGGAGGGG + Intronic
1019207684 6:170376481-170376503 GGTGGGGGGGAGGCGGGCAGCGG + Intronic
1019318914 7:406022-406044 AGGGAGGGAGAGTCAGGCGGTGG - Intergenic
1019328579 7:451874-451896 CTGGGGGGTGAGGGGGGCAGGGG - Intergenic
1019346118 7:531639-531661 AGGGGAGGTGAGGGGGACAGGGG + Intergenic
1019346126 7:531657-531679 AGGGGAGGTGAGGGGGACAGGGG + Intergenic
1019346134 7:531675-531697 AGGGGAGGTGAGGGGGACAGGGG + Intergenic
1019346142 7:531693-531715 AGGGGAGGTGAGGGGGACAGGGG + Intergenic
1019346150 7:531711-531733 AGGGGAGGTGAGGGGGACAGGGG + Intergenic
1019346158 7:531729-531751 AGGGGAGGTGAGGGGGACAGGGG + Intergenic
1019346166 7:531747-531769 AGGGGAGGTGAGGGGGACAGGGG + Intergenic
1019354293 7:570801-570823 AGGGAGGGGGCTGCAGGCAGCGG - Intronic
1019354312 7:570845-570867 AGGGAGGGTGGTGGGGGCCGTGG - Intronic
1019355976 7:579162-579184 AGGGAGGGTGAGGCGGGCAGTGG + Intronic
1019434303 7:1014000-1014022 TGGGATGGGGAGGCGGCCAGCGG + Intronic
1019496260 7:1341841-1341863 TGGGCGGGTGTGGAGGGCAGTGG + Intergenic
1019683290 7:2365317-2365339 AGGCAGTGTGAGGCGAGCTGGGG + Intronic
1019706619 7:2500015-2500037 AGGGTGGGTGGGGTGGCCAGGGG - Intergenic
1019930661 7:4220888-4220910 CAGGAGGGTGAGGCGGGGTGGGG - Intronic
1019937456 7:4265721-4265743 AGGAAGGGTCAAGCGGGGAGAGG + Exonic
1019962995 7:4476891-4476913 AGGGAGAGAGAGGGGAGCAGGGG + Intergenic
1020034888 7:4958919-4958941 AGGGAGGGAGGGGCGCGCGGCGG - Intronic
1020083646 7:5299174-5299196 GGGGTGGGGGAGGCAGGCAGGGG + Intronic
1020125927 7:5532462-5532484 TGGGGGGGTGGGGTGGGCAGTGG + Intronic
1020586733 7:10078858-10078880 AGGGAGGTTAAGGGGGGCTGAGG + Intergenic
1020798003 7:12699563-12699585 TGGGAGGCTGAGGTGGGTAGAGG - Intergenic
1021116625 7:16752318-16752340 AGGGAAGGAGAGGCTGGAAGAGG + Intergenic
1021290975 7:18845297-18845319 AGAGAGGGTGAGTCTGGCACAGG + Intronic
1021343171 7:19489285-19489307 AGGGAGGCTGAGGGGGACTGAGG - Intergenic
1021579008 7:22132740-22132762 AGGGATGATGAGGAGGGCAGTGG + Intronic
1021717258 7:23471128-23471150 GGAGTGGGTGAGGGGGGCAGGGG + Intergenic
1021950481 7:25769436-25769458 TGGGAGGCTGAGGCGGGCGCTGG - Intergenic
1022091857 7:27113377-27113399 AGGGAAGGAGAGGTGGGCAGGGG - Intronic
1022114171 7:27248196-27248218 AGGGAAGGTGAGTGGGGCAGTGG + Intergenic
1022181326 7:27923483-27923505 AAGGAGGCTGAGTCTGGCAGCGG - Intronic
1022194252 7:28049048-28049070 AGGGAGGGAGGGGAGGGGAGGGG - Intronic
1022630541 7:32080281-32080303 AGGGAAGGTCAGGGGGACAGGGG - Intronic
1023089134 7:36601360-36601382 AGGGAGGGAGAGGGGGGAAGGGG + Intronic
1023198398 7:37666799-37666821 AAGGAGGGTGAGGAGAGAAGAGG - Intergenic
1023487011 7:40698280-40698302 AGGGAGGGTGAGGCCAGAAGAGG + Intronic
1023533409 7:41183031-41183053 AGGGAGGGAGAGGAGGGGATGGG - Intergenic
1023766917 7:43520418-43520440 AGGAAGCGTGGGGAGGGCAGAGG - Intronic
1023792314 7:43762855-43762877 TGGGAGGCCGAGGCGGGCATGGG - Intronic
1023821439 7:43982875-43982897 AGGCTGGGAGAGGCAGGCAGGGG - Intergenic
1023833037 7:44051281-44051303 AGAGAGGGTGATGGGGACAGGGG - Intronic
1023863272 7:44227578-44227600 AGGGAGAGTGTGGGGGACAGGGG + Intronic
1024138252 7:46432709-46432731 TGGGATGGTGAGGGGAGCAGAGG - Intergenic
1024230138 7:47357660-47357682 AGGGAGGGTGGGCCTGGGAGGGG - Intronic
1024503146 7:50135111-50135133 AGGGAGAGTGATGAAGGCAGTGG - Intronic
1024551470 7:50566056-50566078 AGTGAGAGTGAGGCTGGCTGCGG + Intergenic
1025034860 7:55587729-55587751 AGGGAGGGAGAGGGTGGGAGAGG - Intergenic
1025210629 7:57018010-57018032 GGGGTGGGGGAGGCAGGCAGGGG - Intergenic
1025661327 7:63558837-63558859 GGGGTGGGGGAGGCAGGCAGGGG + Intergenic
1025852642 7:65257360-65257382 GGGGAGGGGGAGGGGGGGAGAGG - Intergenic
1026125675 7:67577437-67577459 AGGAAGGGTGTGGAGGGCGGTGG + Intergenic
1026282946 7:68937824-68937846 TGGGAAGCTGAGGCGGGCGGAGG + Intergenic
1026308843 7:69166279-69166301 GGGGAGGGGGAGGGGGGAAGGGG + Intergenic
1026662477 7:72314174-72314196 AGGGAGGGGGATGGTGGCAGAGG - Intronic
1026690174 7:72544224-72544246 GGGGAGGGAGAGGAGGGGAGGGG + Intergenic
1026788048 7:73314071-73314093 AAGGGGTGGGAGGCGGGCAGGGG - Intronic
1026806134 7:73430468-73430490 AGGGAGGGGGAGGAGGGGAAGGG - Intergenic
1026817359 7:73522777-73522799 AGGGAGGGGTTGGCGGGAAGTGG + Intergenic
1026832341 7:73617967-73617989 AGGGAGGGAGAGACTAGCAGGGG - Intronic
1026889375 7:73973253-73973275 AGGGCTGCTGAGGAGGGCAGAGG - Intergenic
1026938025 7:74270247-74270269 GGGGAGGGAGAGGAGGGGAGGGG - Intergenic
1026938057 7:74270313-74270335 AGGGAGGGAGGGGAGGGGAGGGG - Intergenic
1027056377 7:75052695-75052717 ATGGAGGGTAAGGCTGGCCGGGG - Exonic
1027140025 7:75650304-75650326 AGGGAGGAGCTGGCGGGCAGGGG - Intronic
1027165350 7:75830195-75830217 AGGGAGAGAGACGAGGGCAGGGG - Intergenic
1027165796 7:75833549-75833571 AGGGAGAGAGACGAGGGCAGGGG + Intergenic
1027250056 7:76393371-76393393 AGCGAAGGTGAGGCTGACAGCGG - Intronic
1028058708 7:86282247-86282269 CGGGTGGGGGAGGGGGGCAGTGG + Intergenic
1029113813 7:98226695-98226717 TGGGAGGCTGAGGCGGGCTTCGG + Intronic
1029161115 7:98552712-98552734 AGGGAGGCTGGTGCGGCCAGAGG + Intergenic
1029169199 7:98618573-98618595 ACGGAGGGGGAGGGGGGGAGGGG - Intronic
1029446392 7:100615198-100615220 AGGGAGGGTGGGGTGGGCTGGGG - Exonic
1029451436 7:100643450-100643472 GGGGAGGATGAGGTGGGGAGGGG - Intronic
1029452170 7:100647335-100647357 AGGGAGGGGGAGCGGGGCAGGGG - Intronic
1029457211 7:100677414-100677436 AGGTAGGGTGGCGCGGGCTGCGG + Exonic
1029501924 7:100936618-100936640 TGGGAGGCCGAGGCGGGCGGAGG - Intergenic
1029704725 7:102270240-102270262 AGGCAGGGTGAGGCAGCCGGTGG + Intronic
1029749702 7:102536296-102536318 AGGCTGGGAGAGGCAGGCAGGGG - Intergenic
1029767652 7:102635401-102635423 AGGCTGGGAGAGGCAGGCAGGGG - Intronic
1030062803 7:105636442-105636464 AGTGGGGGTGGGGGGGGCAGAGG - Intronic
1030164799 7:106543433-106543455 TGTGAGTGTGAGGAGGGCAGGGG - Intergenic
1030331867 7:108279626-108279648 GGGGTGGGTGGGGAGGGCAGGGG - Intronic
1031117915 7:117688055-117688077 AGGGAGGGTGGGGCGGATATGGG + Intronic
1031673959 7:124586756-124586778 TGGGAGGGTGAGAAGAGCAGAGG - Intergenic
1031707621 7:125000773-125000795 TGGGAGGCCCAGGCGGGCAGAGG + Intergenic
1031935958 7:127735868-127735890 TGGGAGGCTGGGGCGGGCGGGGG - Intronic
1031971479 7:128068000-128068022 GGGGAGGGTGAGGCGGGAGAAGG - Intronic
1032037422 7:128531043-128531065 AGGGAAGGTCAGGCGGCCCGGGG - Intergenic
1032086554 7:128886821-128886843 GGGGAGGGAGAGGCGGGGAAGGG + Intronic
1033033256 7:137846934-137846956 AGGGCGCGGGAGGCGGGGAGCGG - Intronic
1033096747 7:138438876-138438898 TGGGAGGCTGAGGCGGGTGGAGG + Intergenic
1033114104 7:138609970-138609992 TGGGAGGCTGAGGCAGGCATCGG - Intronic
1033328480 7:140398477-140398499 GCGGCGGGGGAGGCGGGCAGCGG - Exonic
1033551305 7:142450885-142450907 AGGGAGGGAGAGGCCAGGAGAGG - Intergenic
1033659726 7:143395105-143395127 CCTGAGGGTGAGGAGGGCAGAGG - Exonic
1034013543 7:147557005-147557027 TGGGAGGCTGAGGCAGGCGGGGG + Intronic
1034013552 7:147557029-147557051 CGGGAGGCTGAGGCAGGCGGGGG + Intronic
1034274599 7:149818561-149818583 GGGGAGGGGGAAGCGGGGAGGGG - Intergenic
1034339986 7:150346733-150346755 TAGGAGGGTGAGGAGGGAAGAGG + Intergenic
1034393016 7:150800736-150800758 TTGGAGGGGGAGGCGGGGAGGGG - Exonic
1034423279 7:151000133-151000155 TGGGTGGGTGAGGGGGGCATGGG + Intronic
1034451594 7:151139922-151139944 AGGGAGGCAGAGGAGGGGAGGGG - Intronic
1034494210 7:151410269-151410291 AGGGAGGGGGAGGCGGACAAAGG + Intronic
1034962480 7:155371586-155371608 AGGGCAGGTGGGGCGGGGAGTGG + Intergenic
1035289698 7:157830044-157830066 AGGGAGGGTGGGGCAGGAGGGGG - Intronic
1035293913 7:157857159-157857181 AGGGAGGGGGACGCTGGAAGGGG + Intronic
1035314897 7:157991559-157991581 AGGGAGGGTGAGGGAGGGCGAGG + Intronic
1035389751 7:158496755-158496777 AGGGAAGGGGAGGGGGGCACAGG - Intronic
1035431781 7:158828687-158828709 AGGGCGGGAGCGGCGAGCAGCGG + Intronic
1035447542 7:158952971-158952993 GGGGAGCGTGATGCTGGCAGAGG - Intronic
1035580960 8:738715-738737 AGGGAGGGCCGGGCGGGGAGAGG - Intergenic
1035649271 8:1252907-1252929 AGGGAGGCAGAGGAGGACAGAGG + Intergenic
1035677716 8:1467108-1467130 AGGGAGGGAGGGTCCGGCAGGGG + Intergenic
1035899932 8:3448372-3448394 AGGGAGGGGGAGGAGGGAGGAGG + Intronic
1036235149 8:7033506-7033528 TGGGAGGCTGAGGCGGGTGGCGG - Intergenic
1036665123 8:10732714-10732736 AGGGAGGGTGCTACGGGCTGCGG - Intronic
1036687255 8:10920062-10920084 AGGGAGGGAGAGACTGGCATTGG + Intronic
1036691836 8:10949198-10949220 ATGGAGGGAGAGGCTGGAAGCGG - Intronic
1036915493 8:12799893-12799915 AGGGAGGCTAAGGGGGGCTGAGG - Intergenic
1037029045 8:14079152-14079174 AGGGAGGGAGGGGAGGGCTGGGG + Intergenic
1037110531 8:15159726-15159748 GGGGAGGGTGGGGGGGGCGGGGG - Intronic
1037567227 8:20128059-20128081 AGGAAGGGAGAGGAGGGGAGGGG + Intergenic
1037707800 8:21330308-21330330 CTGGGGGGTGCGGCGGGCAGAGG + Intergenic
1037886352 8:22598403-22598425 AGGCAGGGTGAGGTGGGAACAGG + Intronic
1038049379 8:23794807-23794829 TGGGAGGGTGAGGCAGGAAGAGG + Intergenic
1038144249 8:24879671-24879693 AAGGAGGGTGATGAGAGCAGGGG - Intergenic
1038148815 8:24923798-24923820 TGGGTGGGTGAGGTGGGTAGTGG + Intergenic
1038314775 8:26474911-26474933 CGGGAGGCTGAGGCAGGCGGAGG - Intronic
1038329122 8:26593731-26593753 AGGGTGGGTGCCGGGGGCAGAGG + Intronic
1038562350 8:28591262-28591284 AAGGAGAGAGAGGTGGGCAGGGG + Intergenic
1038662462 8:29509061-29509083 TGGGAGGCTGAGGCGGGAGGAGG - Intergenic
1038679815 8:29656321-29656343 GAGGAGGATGAGGCAGGCAGTGG - Intergenic
1039064882 8:33599413-33599435 AGGGAGGGAGCGGCGGGCCAGGG - Intronic
1039753330 8:40497220-40497242 AGAGAGGGAGAGGGAGGCAGTGG + Intergenic
1039792080 8:40884176-40884198 GGGGTGGGTGAGGCGGGGTGGGG - Intronic
1039907073 8:41794477-41794499 AGGGAGAGGGAAGCGGGCAAGGG - Intronic
1039922474 8:41903330-41903352 AGGAAGGGAGAGGAGGGGAGGGG + Intergenic
1040047231 8:42976263-42976285 GGGGAGGCTGAGGTGGACAGAGG + Intronic
1040109881 8:43562567-43562589 GGGGACGTTGAGGCAGGCAGGGG - Intergenic
1040109939 8:43562785-43562807 GGGGACGGTGAGGCAGGCGGGGG - Intergenic
1040110153 8:43563663-43563685 GGGGACGTTGAGGCGGGCTGGGG - Intergenic
1040111806 8:43570080-43570102 GGGGAGGTTGAGGCAGGCCGGGG - Intergenic
1040111930 8:43570513-43570535 AGGGAGGTTGAGGCAGGCCTGGG - Intergenic
1040285099 8:46095448-46095470 GGGGAGGTTGAGGCAGGTAGAGG + Intergenic
1040285285 8:46097619-46097641 AGGGACATTGAGGCTGGCAGAGG + Intergenic
1040286246 8:46101909-46101931 AAGGAAGTTGAGGCAGGCAGAGG - Intergenic
1040286764 8:46104432-46104454 GGGGACGTTGAGGCAGGCAGAGG - Intergenic
1040287176 8:46106373-46106395 TGGGACGTTGAGGCAGGCAGAGG - Intergenic
1040287430 8:46107667-46107689 GGGGATGTTGAGGCAGGCAGAGG - Intergenic
1040287480 8:46107884-46107906 GGGGATGATGAGGCAGGCAGAGG - Intergenic
1040288032 8:46110349-46110371 GGGGACGTTGAGGCAGGCAGTGG - Intergenic
1040288272 8:46111433-46111455 GGGGACGTTGAGGCAGGCAGAGG - Intergenic
1040288475 8:46112300-46112322 GGGGAAGTTGAGGCAGGCAGAGG - Intergenic
1040289008 8:46114848-46114870 AGGGACGTTGAGGCAGGCAGAGG - Intergenic
1040289477 8:46117009-46117031 AGGGACGTTAAGGCAGGCAGAGG - Intergenic
1040289727 8:46118091-46118113 GGGGATGTTGAGGCAGGCAGAGG - Intergenic
1040290325 8:46120903-46120925 GGGGACGTTGAGGCAGGCAGTGG - Intergenic
1040292576 8:46132986-46133008 GGGGATGTTGAGGCAGGCAGAGG - Intergenic
1040295476 8:46146826-46146848 GGGGACGTTGAGGCAGGCAGAGG - Intergenic
1040296080 8:46149795-46149817 AGGGATGTTGAGGCAGGCAGAGG - Intergenic
1040296214 8:46150444-46150466 GGGGATGTTGAGGCAGGCAGAGG - Intergenic
1040296260 8:46150660-46150682 AAGGATGATGAGGCAGGCAGAGG - Intergenic
1040298049 8:46173465-46173487 AGGAATGTTGAGGCAGGCAGAGG + Intergenic
1040298640 8:46176409-46176431 TGGGACGTTGAGGCAGGCAGTGG + Intergenic
1040298718 8:46176840-46176862 AGGGATGTTGAGGCAGGCATAGG + Intergenic
1040301828 8:46191979-46192001 TGTGAGGTTGAGGCAGGCAGAGG + Intergenic
1040302394 8:46194821-46194843 GGGGACGTTGAGGCTGGCAGAGG + Intergenic
1040302858 8:46196953-46196975 AGGGACGTTGAGGCAGGCAGAGG + Intergenic
1040303551 8:46200505-46200527 GGGGACGTTGAGGCTGGCAGAGG + Intergenic
1040304327 8:46204171-46204193 AGGGAGGTTGAGGCAGGCAGAGG + Intergenic
1040305404 8:46209309-46209331 AGGGACGTTGAGGCAGGTAGGGG + Intergenic
1040306135 8:46212811-46212833 AGGGATATTGAGGCAGGCAGAGG + Intergenic
1040307578 8:46220185-46220207 GGGGATGTTGAGGCAGGCAGAGG + Intergenic
1040309723 8:46230539-46230561 GGGGACGTTGAGGCAGGCAGAGG + Intergenic
1040310161 8:46232702-46232724 GGGGACGTTGAGGCAGGCAGAGG + Intergenic
1040310367 8:46233765-46233787 AGGGACATTGAGGCAGGCAGAGG + Intergenic
1040311625 8:46239779-46239801 GGGGAAGTTGAGGCAGGCAGAGG + Intergenic
1040311846 8:46240860-46240882 AGGGACACTGAGGCAGGCAGAGG + Intergenic
1040315248 8:46257543-46257565 GGGGACGTTGAGGCAGGCAGAGG + Intergenic
1040316300 8:46262683-46262705 GGGGATGCTGAGGCAGGCAGAGG + Intergenic
1040316347 8:46262900-46262922 TGGGACGTTGAGGCAGGCAGAGG + Intergenic
1040316570 8:46263983-46264005 AGGGATGCTGAAGCAGGCAGTGG + Intergenic
1040324177 8:46333274-46333296 AGTGATGTTGAGGCAGGCAGAGG + Intergenic
1040325025 8:46337304-46337326 GGGGACGTTGAGGCAGGCAGAGG + Intergenic
1040325167 8:46337955-46337977 GGGGATGTTGAGGCAGGCAGAGG + Intergenic
1040328728 8:46375265-46375287 AGGGATGTTGAGGCAGGCATAGG - Intergenic
1040329483 8:46378600-46378622 GGGGACGTTGAGGCAGGCAGAGG + Intergenic
1040330098 8:46381481-46381503 GGGGATGTTGAGGCAGGCAGAGG + Intergenic
1040330422 8:46382991-46383013 GGGGATGTTGAGGCAGGCAGAGG + Intergenic
1040330525 8:46383504-46383526 GGGGAAGTTGAGGCAGGCAGAGG + Intergenic
1040331517 8:46388109-46388131 GGGGATGTTGAGGCAGGCAGAGG + Intergenic
1040331924 8:46390051-46390073 AGGGAAGTTGAGGCATGCAGAGG + Intergenic
1040333830 8:46406068-46406090 GGGGATGTTGAGGCAGGCAGAGG + Intergenic
1040335402 8:46413452-46413474 GGGGATGTTGAGGCAGGCAGAGG + Intergenic
1040335573 8:46414296-46414318 AGGGATGTTGAGGCAGGCAGAGG + Intergenic
1040337001 8:46421133-46421155 AGGGAAGTTAAGGCAGGCAGAGG + Intergenic
1040337314 8:46422647-46422669 GGGGATGTTGAGGCAGGCAGAGG + Intergenic
1040337785 8:46424874-46424896 AGGGATGTTTAGGCAGGCAGAGG + Intergenic
1040338250 8:46427035-46427057 GGGGATGTTGAGGCAGGCAGAGG + Intergenic
1040340244 8:46436848-46436870 AGGGATGTTGAGGCAGGCAGAGG - Intergenic
1040340589 8:46438560-46438582 AGGGAGGTTGACACAGGCAGAGG - Intergenic
1040341345 8:46442699-46442721 GGGGACGTTGAGGCAGGCAGAGG - Intergenic
1040341774 8:46444703-46444725 GGGGACGTTGAGGCAGGCAGAGG - Intergenic
1040342592 8:46448471-46448493 GGGGATGTTGAGGCAGGCAGAGG - Intergenic
1040342646 8:46448680-46448702 AAGGACGTTGAGGCAGGCAGAGG - Intergenic
1040441687 8:47449927-47449949 TGGGAGGCCGAGGCAGGCAGTGG + Intronic
1040483802 8:47851686-47851708 AGGCTGGACGAGGCGGGCAGGGG + Intronic
1041250980 8:55934767-55934789 AAGGGGGGTGAGGTGGGAAGTGG - Intronic
1042217208 8:66438663-66438685 AGGGAGAGTGAGCCCGCCAGAGG + Intronic
1042242878 8:66682076-66682098 AGGGAGAGAGAGGAGGGGAGGGG - Intronic
1042608975 8:70577175-70577197 AGGGAGGCCGAGGGGGGCTGAGG + Intronic
1042849091 8:73198056-73198078 AGGGAGGTTGAGGCGTGAACAGG + Intergenic
1043018851 8:74975380-74975402 AGGGAGGGTGTGGCAAGCACAGG + Intergenic
1043260493 8:78188502-78188524 AGGGAGGGAGGGGAGGGGAGGGG + Intergenic
1043750354 8:83926610-83926632 AGGGAGGCTGAAGGGGGCTGAGG - Intergenic
1044152209 8:88795304-88795326 AGGGATGGTGAGGATGGAAGGGG + Intergenic
1044591525 8:93917524-93917546 GGGCAGGGCGGGGCGGGCAGCGG + Intronic
1044983253 8:97736390-97736412 GGGGAGGGGGAGGAGGGGAGGGG + Intergenic
1045478045 8:102569696-102569718 AGAGAGGGGGAGGAGGGGAGGGG - Intergenic
1045582856 8:103499582-103499604 AGGGAGGTAGAGGCGGCGAGTGG - Intergenic
1045619630 8:103959507-103959529 AGGGAGGTTGAGGCAGGAGGCGG - Intronic
1045724765 8:105159534-105159556 AGGGAGGCAGAGCCAGGCAGAGG - Intronic
1046669063 8:117037498-117037520 GCGGTGGGTGAGGGGGGCAGTGG - Intronic
1047060187 8:121216657-121216679 AGAGAGAGAGAGGAGGGCAGAGG + Intergenic
1047319334 8:123764934-123764956 AGGGAGGTTGAGGGGAGAAGTGG + Intergenic
1047388776 8:124432851-124432873 AGGGAGAGGGAGACGGGGAGAGG + Intergenic
1047481051 8:125283431-125283453 TGGGAGGCTGAGGTGGGAAGTGG + Intronic
1047511627 8:125520300-125520322 AGGGAGGGAGGGGAGGGAAGGGG + Intergenic
1047523939 8:125616429-125616451 AGGGAGGATGAGGAGGGCAGTGG + Intergenic
1047717326 8:127607528-127607550 TGGGAGGCCAAGGCGGGCAGAGG - Intergenic
1047883117 8:129218370-129218392 ATGGAGGGTGTGGCGGGCCAGGG - Intergenic
1047916853 8:129592372-129592394 GGGGAGGCTGAGGCGGGGAGGGG + Intergenic
1047917231 8:129595164-129595186 AGGGAGGGGGAGGTGAGAAGTGG - Intergenic
1048005996 8:130419708-130419730 AGGGAGGGAGAGGGAGGCTGAGG + Intronic
1048279828 8:133097004-133097026 AGGCAGGGTGGGGTGGGCAGAGG - Intronic
1048296677 8:133219995-133220017 AGGGAGGGGGAGTTGGGCGGGGG - Intronic
1048451237 8:134535502-134535524 AGGGAGGGAGAGGGAGGGAGAGG - Intronic
1048548002 8:135404933-135404955 AGGGAGGCTGAGTGGGGCTGAGG - Intergenic
1048696257 8:137031625-137031647 AGGAAGGGAGAGGAGGGAAGGGG - Intergenic
1048918220 8:139204085-139204107 AGGAAGGCTGAGGTGGGCAGGGG - Intergenic
1049115344 8:140681529-140681551 TGGGAGGCGGAGGCGGGCAGGGG + Intronic
1049346144 8:142139841-142139863 AGGTAGGGTGGGGTGGGGAGTGG - Intergenic
1049389379 8:142360224-142360246 AGGGAGGGCTGGGCAGGCAGAGG + Intronic
1049613205 8:143565339-143565361 AGGGAGGGGGAGGAGCGCAGGGG + Intergenic
1049684522 8:143933972-143933994 AGGGGGTGTGGGGCAGGCAGTGG - Intronic
1049697281 8:143990405-143990427 AGGGAGGGGGCGGCGCGCTGCGG + Intronic
1049707404 8:144049258-144049280 AGGGTGGCTGAGGAGGGCGGCGG + Intergenic
1049737747 8:144218791-144218813 AGGGGAGGTGAGGGGGGGAGGGG - Intronic
1049738593 8:144223101-144223123 TGGGCAGGTGAAGCGGGCAGTGG + Exonic
1049778791 8:144418144-144418166 TGGTGGGGTGAGGCCGGCAGGGG - Intergenic
1049846387 8:144803920-144803942 AGGCAGGCTGACGCTGGCAGTGG - Intronic
1050782578 9:9356175-9356197 AGGGAGAGTGAATCTGGCAGAGG + Intronic
1050790554 9:9463379-9463401 AGGGAGGGAGGGGCAGGAAGAGG + Intronic
1050992004 9:12167460-12167482 AGGGAGGCTGAGGCGGAGAATGG - Intergenic
1051163427 9:14234600-14234622 TGGGAGGCCGAGGTGGGCAGAGG - Intronic
1051640536 9:19220810-19220832 CGGGAGGCCAAGGCGGGCAGGGG - Intergenic
1051724463 9:20074624-20074646 AGGGAGGGAGGGACGGGAAGGGG + Intergenic
1052523352 9:29579891-29579913 GGAGAGAGTGAGGCGGGAAGTGG + Intergenic
1052961002 9:34296419-34296441 TGGGAGGCTGAGGCAGGCTGAGG + Intronic
1053183634 9:35995656-35995678 TGGGATGGTGAGGGGGGCTGAGG - Intergenic
1053230109 9:36400920-36400942 AGGCGGGGTGAGGCGGGGTGCGG - Intronic
1053463294 9:38287414-38287436 AAGGAAGGTGAGGCTGGCAGTGG - Intergenic
1053792235 9:41694965-41694987 AGGGAGTGGCAGGCAGGCAGTGG - Intergenic
1053919489 9:42973735-42973757 TGGGAGGCCGAGGCGGGCTGAGG + Intergenic
1054180646 9:61906985-61907007 AGGGAGTGGCAGGCAGGCAGTGG - Intergenic
1054472710 9:65551001-65551023 AGGGAGTGGCAGGCAGGCAGTGG + Intergenic
1054474031 9:65560211-65560233 AGGAGGGGGGAGGCGGGCAAGGG - Intergenic
1054656945 9:67674157-67674179 AGGGAGTGGCAGGCAGGCAGTGG + Intergenic
1054790664 9:69253683-69253705 TGGGAGGCCGAGGCGGGCGGAGG - Intronic
1054807940 9:69411371-69411393 AGGGAGGGTGAGAGGGAGAGGGG - Intergenic
1055182223 9:73402174-73402196 AGCTAGGGTGTGGCAGGCAGTGG + Intergenic
1055318929 9:75063068-75063090 TGGGAGGCCGAGGCGGGCGGAGG + Intronic
1055620781 9:78122812-78122834 AGGGAGGGAGTGGCGGCCAGAGG - Intergenic
1055623482 9:78149850-78149872 AAGAAGCGTGAGGAGGGCAGGGG - Intergenic
1055769433 9:79701764-79701786 AGTGAGATTGAGGCGTGCAGAGG + Intronic
1055824496 9:80307135-80307157 AGGGAGGAGGGGGAGGGCAGAGG - Intergenic
1056182987 9:84103444-84103466 GGGGAGGGGGAGGGAGGCAGGGG + Intergenic
1056328028 9:85497187-85497209 GGGGAGGGGGAGGGGGGAAGAGG + Intergenic
1056648671 9:88437917-88437939 TGGGAGGCTGAGGGGGGCAGAGG + Intronic
1056788125 9:89606875-89606897 AGGGAGGGGGAGGAGGGCCGAGG - Intergenic
1056798977 9:89678230-89678252 AGGGAGGGGGTGGGAGGCAGAGG + Intergenic
1057075626 9:92136777-92136799 AGTGAGGGTGAAGCTGCCAGAGG - Intergenic
1057197085 9:93121245-93121267 AGGCAGGGTCAGGTGGGGAGCGG - Intergenic
1057276698 9:93680010-93680032 AGGGAGGGTGCTGAGCGCAGGGG + Intergenic
1057497408 9:95571943-95571965 AGGGAGGAAGAGGAGGGGAGGGG + Intergenic
1057598335 9:96435775-96435797 AGGGAGGGTAAGTCAAGCAGAGG + Intergenic
1057695805 9:97322255-97322277 AGGGCTGGGGAGGAGGGCAGGGG - Intronic
1057759417 9:97860569-97860591 AGGGAGTGTGGGGCTGGCAGAGG - Intergenic
1057790969 9:98124744-98124766 CCTGAGGGTGAGGAGGGCAGAGG + Exonic
1058655121 9:107213263-107213285 AGTGAAGGTGAGTAGGGCAGAGG - Intergenic
1058866486 9:109166648-109166670 GGGGAGAGTGAGGCTGGGAGAGG - Intronic
1059309318 9:113377317-113377339 AGCGGCGGTGTGGCGGGCAGGGG - Intergenic
1060123990 9:121024222-121024244 AGGGAGGGAGGGGAGGGGAGGGG + Intronic
1060218018 9:121750062-121750084 CGGGAGGCTCAGGAGGGCAGGGG - Intronic
1060488702 9:124065807-124065829 AGGGAGGAGGAGGCGGGGAAAGG + Intergenic
1060935025 9:127509767-127509789 AGGGAAGGAGAGGAGGGGAGAGG - Intronic
1060935049 9:127509837-127509859 AGGGAAGGAGAGGAGGGGAGAGG - Intronic
1060997825 9:127885081-127885103 AGGCAGGGTGAGGTGGGGACAGG + Intergenic
1061246280 9:129402613-129402635 AGGGAGGGGAAGGCGGCGAGAGG - Intergenic
1061295716 9:129675639-129675661 AGCGAGGGGGAGACCGGCAGTGG - Intronic
1061390578 9:130315267-130315289 AGGGAGGGGAAGGAGGGGAGGGG - Intronic
1061402970 9:130378415-130378437 TGGGAGGGGGAGGCCGGGAGGGG + Intronic
1061452921 9:130678316-130678338 GGGCAGGGAGAGGGGGGCAGAGG + Intronic
1061517117 9:131096453-131096475 AGGGAGGGAGGGGCCGGCAGCGG + Intergenic
1061546470 9:131307733-131307755 AGGCAGGATGTGCCGGGCAGGGG + Intronic
1061553289 9:131350199-131350221 AGGAAGAGTGTGGCCGGCAGAGG + Intergenic
1061709809 9:132479961-132479983 AGGGAGGCAGAGGCGCACAGTGG - Intronic
1061761381 9:132854374-132854396 AAGGAGGGTGGAGAGGGCAGGGG - Intronic
1061778883 9:132984334-132984356 AGGGAGGGGGAGGAGGCAAGAGG + Intronic
1061849260 9:133404937-133404959 AGGGAGTGTGAGGTGAGAAGGGG - Intronic
1061883265 9:133578482-133578504 AGAGAGGGAGAGACGGGTAGGGG + Exonic
1061900023 9:133668278-133668300 AGGGAGGGAGAGGGAGGGAGAGG - Intronic
1061900027 9:133668288-133668310 AGGGAGGGAGAGGGAGGGAGAGG - Intronic
1061900400 9:133669304-133669326 AGGGAGGGTGAGGGAGGATGAGG - Intronic
1062054659 9:134464540-134464562 CGGCTGGGTGAGCCGGGCAGAGG - Intergenic
1062054674 9:134464597-134464619 AGGCTGGGTGAGCGGGGCAGAGG - Intergenic
1062054690 9:134464654-134464676 AGGCTGGGTGAGCGGGGCAGAGG - Intergenic
1062054707 9:134464711-134464733 AGGCTGGGTGAGCCGGGCAGAGG - Intergenic
1062054736 9:134464825-134464847 AGGCTGGGTGAGCGGGGCAGAGG - Intergenic
1062054781 9:134464996-134465018 AGGCTGGGTGAGCCGGGCAGAGG - Intergenic
1062054796 9:134465053-134465075 AGGCTGGGTGAGCGGGGCAGAGG - Intergenic
1062054813 9:134465110-134465132 CGGCTGGGTGAGCCGGGCAGAGG - Intergenic
1062054828 9:134465167-134465189 AGGCTGGGTGAGCGGGGCAGAGG - Intergenic
1062054844 9:134465224-134465246 AGGCTGGGTGAGCGGGGCAGAGG - Intergenic
1062054861 9:134465281-134465303 CGGCTGGGTGAGCCGGGCAGAGG - Intergenic
1062054876 9:134465338-134465360 AGGCTGGGTGAGCGGGGCAGAGG - Intergenic
1062054892 9:134465395-134465417 AGGCTGGGTGAGCGGGGCAGAGG - Intergenic
1062054909 9:134465452-134465474 CGGCTGGGTGAGCCGGGCAGAGG - Intergenic
1062054924 9:134465509-134465531 AGGCTGGGTGAGCGGGGCAGAGG - Intergenic
1062054941 9:134465566-134465588 CGGCTGGGTGAGCCGGGCAGAGG - Intergenic
1062054956 9:134465623-134465645 AGGCTGGGTGAGCGGGGCAGAGG - Intergenic
1062054972 9:134465680-134465702 AGGCTGGGTGAGCGGGGCAGAGG - Intergenic
1062054989 9:134465737-134465759 CGGCTGGGTGAGCCGGGCAGAGG - Intergenic
1062055019 9:134465851-134465873 AGGCTGGGTGAGCCGGGCAGAGG - Intergenic
1062055063 9:134466022-134466044 AGGCTGGGTGAGCCGGGCAGAGG - Intergenic
1062055078 9:134466079-134466101 AGGCTGGGTGAGCGGGGCAGAGG - Intergenic
1062055095 9:134466136-134466158 CGGCTGGGTGAGCCGGGCAGAGG - Intergenic
1062055111 9:134466193-134466215 AGGCTGGGTGAGCCGGGCAGAGG - Intergenic
1062055126 9:134466250-134466272 AGGCTGGGTGAGCGGGGCAGAGG - Intergenic
1062055143 9:134466307-134466329 CGGCTGGGTGAGCCGGGCAGAGG - Intergenic
1062055158 9:134466364-134466386 AGGCTGGGTGAGCGGGGCAGAGG - Intergenic
1062055174 9:134466421-134466443 AGGCTGGGTGAGCGGGGCAGAGG - Intergenic
1062208167 9:135348632-135348654 AGGGAGGGGGGGGCGGGAGGTGG - Intergenic
1062255511 9:135618999-135619021 AGGGAGGCTGAGGGCAGCAGAGG - Intergenic
1062264081 9:135678855-135678877 AGGGAAGGCTGGGCGGGCAGAGG - Intergenic
1062315800 9:135966515-135966537 AGGGAGGCAGCGTCGGGCAGAGG - Intergenic
1062344585 9:136109047-136109069 AGGCAGGGCGGGGAGGGCAGAGG - Intergenic
1062394773 9:136348346-136348368 AGGAAGGGTGATCCAGGCAGAGG + Intronic
1062412087 9:136430725-136430747 AGCGAGGGTGCAACGGGCAGAGG + Intronic
1062431438 9:136528431-136528453 AGGGACGGTGAGGGGGGGATGGG + Intronic
1062501003 9:136852076-136852098 CGGCAGTGTGGGGCGGGCAGAGG - Intronic
1062578985 9:137221434-137221456 GGGGAGGGGGAGGCAGGCGGGGG + Intronic
1062599498 9:137313510-137313532 TGGGAGTGTGAGGGTGGCAGGGG + Intronic
1062630363 9:137460555-137460577 AGGGAGGGAGTGGCCGGCACAGG + Intronic
1062670308 9:137704950-137704972 AGGGAGGGAGGGGAGGGGAGGGG - Intronic
1062695082 9:137870688-137870710 AGGGAGGGAGGGGAGGGGAGGGG - Intergenic
1062698636 9:137887997-137888019 TGGGAGGGTGGCGGGGGCAGGGG + Intronic
1203362912 Un_KI270442v1:233255-233277 AGGGAGAGAGAGACAGGCAGAGG + Intergenic
1185431587 X:14564-14586 AGGGAGGGCGTGGAGGGCCGTGG + Intergenic
1185432851 X:19579-19601 AGGGAGGGCGTGGAGGGCCGTGG + Intergenic
1185440912 X:227283-227305 AGGGAGGGCGTGGAGGGCCGTGG + Intergenic
1185442203 X:232401-232423 AGGGAGGGCGTGGAGGGCCGTGG + Intergenic
1185511537 X:668031-668053 AGGGAAGGGGAGGAGGGGAGGGG - Intergenic
1185608536 X:1380652-1380674 AGGGAGGGGTAGGGGGGAAGGGG + Intronic
1185655552 X:1681970-1681992 AGGGAGGGAGAGGGAGGGAGAGG - Intergenic
1185706800 X:2273618-2273640 AGGTAGGGGGAGGGAGGCAGGGG - Intronic
1185957694 X:4509999-4510021 AGGGAGAGGGAGGGGGGCAAAGG - Intergenic
1186181729 X:6980154-6980176 AGGGAGGGAGGGGAGGGGAGAGG - Intergenic
1186463475 X:9766067-9766089 AGGGAGGAGGAGGAGGGAAGTGG + Intronic
1186506445 X:10096945-10096967 TGGGAGGCTGAGGTGGCCAGAGG + Intronic
1186599022 X:11016122-11016144 AGGGAGGGAGAGATGGGGAGAGG + Intergenic
1187317379 X:18208379-18208401 CGGGAGGCTGAGGCAGGCTGAGG + Intronic
1187393940 X:18904034-18904056 TGGGATGGTGAGGCTTGCAGGGG - Intronic
1187447665 X:19373113-19373135 AGGGAAGGTGAGGGGGACAGGGG + Intronic
1189279963 X:39814070-39814092 AGGGAGCGTGCGGCAGCCAGAGG - Intergenic
1189377099 X:40474651-40474673 CGGGCGGGGGGGGCGGGCAGAGG + Intergenic
1189667356 X:43370968-43370990 AGGGAGGGAGAGAAGGGGAGAGG + Intergenic
1189791281 X:44607768-44607790 TGGGAGGCTGAGGCAGGCTGAGG + Intergenic
1189833995 X:45002852-45002874 AGGGGGGGGGGGGCGGGGAGGGG - Intronic
1190367415 X:49709362-49709384 GGGGAGGGGGAGGGGGACAGGGG + Intergenic
1190597366 X:52062720-52062742 GGAGGGGGTGAGGCGGGCCGCGG - Intronic
1190611458 X:52191353-52191375 GGAGGGGGTGAGGCGGGCCGCGG + Intronic
1191255698 X:58278676-58278698 AGGGAGGTTGAGGCAGGCCTGGG - Intergenic
1191257292 X:58285154-58285176 AGGGAGGTTGAGGCAGGCCTGGG - Intergenic
1191707101 X:64104881-64104903 AGGGGGGGTGAGGGGGCGAGGGG + Intergenic
1192339307 X:70249619-70249641 TGGGAGGCTGAGGCAGGCAGAGG - Intergenic
1192359616 X:70431073-70431095 CGGGAGGCTGAGGGGGGCAGTGG - Exonic
1192467245 X:71366201-71366223 AGGGAGGGGGAAGTGGGGAGAGG - Intergenic
1192610069 X:72559047-72559069 GGGGAGGGGGAGGGGGGGAGGGG - Intronic
1193280667 X:79645375-79645397 AGGGAGGGTGTAGGGGGCAGGGG - Intergenic
1193600825 X:83507269-83507291 AGGGCGGGTGAGGAGGGTGGGGG + Intergenic
1194988730 X:100521355-100521377 AGGGAGAGTGAGGGAGGGAGAGG + Intergenic
1194992914 X:100564068-100564090 AGGGAGGGGGAGGAGAGAAGGGG + Intergenic
1195101217 X:101555618-101555640 AGTGAGGGTGAGGGTGTCAGGGG + Intergenic
1195299086 X:103509496-103509518 AGGGAGGGAGAGGGGAGGAGAGG - Intronic
1196402436 X:115330494-115330516 GGGGAGGGGGAGGTGGGCGGGGG + Intergenic
1196755223 X:119151463-119151485 ATGGAGGGAGAGGGGAGCAGAGG + Intergenic
1198246675 X:134838669-134838691 AGGGAGGGGGAGGGGGGAGGGGG - Intronic
1198737846 X:139807193-139807215 AGGGAACGTGGGGCGGGGAGGGG + Intronic
1198858370 X:141043259-141043281 AGGGAGGGAGAGGGAGGGAGAGG - Intergenic
1199511899 X:148631684-148631706 AGGCAGGGGGAGGAGGGCATGGG + Intronic
1199724628 X:150568534-150568556 CGGCACGGGGAGGCGGGCAGCGG + Intergenic
1200137763 X:153883286-153883308 AGGGAGGGCCAGGCAGGCAGAGG + Intronic
1200185222 X:154178262-154178284 TGGGAGGCCGAGGCGGGCGGAGG + Intergenic
1200190875 X:154215400-154215422 TGGGAGGCCGAGGCGGGCGGAGG + Intergenic
1200196626 X:154253202-154253224 TGGGAGGCCGAGGCGGGCGGAGG + Intergenic
1200202281 X:154290320-154290342 TGGGAGGCCGAGGCGGGCGGAGG + Intronic
1201146084 Y:11066447-11066469 AGGGAGGGAGAGGAAGGGAGAGG + Intergenic
1201146236 Y:11066934-11066956 AGGGAGGGAGAGGGAGGGAGAGG + Intergenic
1201146245 Y:11066962-11066984 AGGGAGGGAGAGGGAGGCAGAGG + Intergenic
1201146307 Y:11067151-11067173 AGGGAGGGAGAGGGAGGGAGAGG + Intergenic
1201335625 Y:12878108-12878130 AGGGAGAGGGAGAGGGGCAGGGG - Intergenic