ID: 1019357984

View in Genome Browser
Species Human (GRCh38)
Location 7:590917-590939
Sequence TCCGGCCCGCTCTCCGCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019357984_1019357988 -8 Left 1019357984 7:590917-590939 CCGAGAGCGGAGAGCGGGCCGGA No data
Right 1019357988 7:590932-590954 GGGCCGGATGCCCGGGGCAGTGG 0: 1
1: 0
2: 4
3: 30
4: 359
1019357984_1019357990 -4 Left 1019357984 7:590917-590939 CCGAGAGCGGAGAGCGGGCCGGA No data
Right 1019357990 7:590936-590958 CGGATGCCCGGGGCAGTGGCAGG No data
1019357984_1019357993 15 Left 1019357984 7:590917-590939 CCGAGAGCGGAGAGCGGGCCGGA No data
Right 1019357993 7:590955-590977 CAGGCGCAATGACCCAGCCCAGG 0: 1
1: 0
2: 3
3: 6
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019357984 Original CRISPR TCCGGCCCGCTCTCCGCTCT CGG (reversed) Intronic