ID: 1019357990

View in Genome Browser
Species Human (GRCh38)
Location 7:590936-590958
Sequence CGGATGCCCGGGGCAGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019357982_1019357990 -3 Left 1019357982 7:590916-590938 CCCGAGAGCGGAGAGCGGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 162
Right 1019357990 7:590936-590958 CGGATGCCCGGGGCAGTGGCAGG No data
1019357980_1019357990 -1 Left 1019357980 7:590914-590936 CCCCCGAGAGCGGAGAGCGGGCC 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1019357990 7:590936-590958 CGGATGCCCGGGGCAGTGGCAGG No data
1019357984_1019357990 -4 Left 1019357984 7:590917-590939 CCGAGAGCGGAGAGCGGGCCGGA No data
Right 1019357990 7:590936-590958 CGGATGCCCGGGGCAGTGGCAGG No data
1019357974_1019357990 30 Left 1019357974 7:590883-590905 CCCGTCGGCAGCAGAAAGTGCCG 0: 1
1: 0
2: 0
3: 1
4: 61
Right 1019357990 7:590936-590958 CGGATGCCCGGGGCAGTGGCAGG No data
1019357976_1019357990 10 Left 1019357976 7:590903-590925 CCGCGTGTCTGCCCCCGAGAGCG No data
Right 1019357990 7:590936-590958 CGGATGCCCGGGGCAGTGGCAGG No data
1019357981_1019357990 -2 Left 1019357981 7:590915-590937 CCCCGAGAGCGGAGAGCGGGCCG 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1019357990 7:590936-590958 CGGATGCCCGGGGCAGTGGCAGG No data
1019357975_1019357990 29 Left 1019357975 7:590884-590906 CCGTCGGCAGCAGAAAGTGCCGC No data
Right 1019357990 7:590936-590958 CGGATGCCCGGGGCAGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019357990 Original CRISPR CGGATGCCCGGGGCAGTGGC AGG Intronic