ID: 1019357993

View in Genome Browser
Species Human (GRCh38)
Location 7:590955-590977
Sequence CAGGCGCAATGACCCAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 159}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019357984_1019357993 15 Left 1019357984 7:590917-590939 CCGAGAGCGGAGAGCGGGCCGGA No data
Right 1019357993 7:590955-590977 CAGGCGCAATGACCCAGCCCAGG 0: 1
1: 0
2: 3
3: 6
4: 159
1019357976_1019357993 29 Left 1019357976 7:590903-590925 CCGCGTGTCTGCCCCCGAGAGCG No data
Right 1019357993 7:590955-590977 CAGGCGCAATGACCCAGCCCAGG 0: 1
1: 0
2: 3
3: 6
4: 159
1019357989_1019357993 -3 Left 1019357989 7:590935-590957 CCGGATGCCCGGGGCAGTGGCAG No data
Right 1019357993 7:590955-590977 CAGGCGCAATGACCCAGCCCAGG 0: 1
1: 0
2: 3
3: 6
4: 159
1019357991_1019357993 -10 Left 1019357991 7:590942-590964 CCCGGGGCAGTGGCAGGCGCAAT 0: 1
1: 0
2: 1
3: 17
4: 452
Right 1019357993 7:590955-590977 CAGGCGCAATGACCCAGCCCAGG 0: 1
1: 0
2: 3
3: 6
4: 159
1019357982_1019357993 16 Left 1019357982 7:590916-590938 CCCGAGAGCGGAGAGCGGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 162
Right 1019357993 7:590955-590977 CAGGCGCAATGACCCAGCCCAGG 0: 1
1: 0
2: 3
3: 6
4: 159
1019357980_1019357993 18 Left 1019357980 7:590914-590936 CCCCCGAGAGCGGAGAGCGGGCC 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1019357993 7:590955-590977 CAGGCGCAATGACCCAGCCCAGG 0: 1
1: 0
2: 3
3: 6
4: 159
1019357981_1019357993 17 Left 1019357981 7:590915-590937 CCCCGAGAGCGGAGAGCGGGCCG 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1019357993 7:590955-590977 CAGGCGCAATGACCCAGCCCAGG 0: 1
1: 0
2: 3
3: 6
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019357993 Original CRISPR CAGGCGCAATGACCCAGCCC AGG Intronic