ID: 1019359955

View in Genome Browser
Species Human (GRCh38)
Location 7:599622-599644
Sequence GGGTGTAAATGCTGCCCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 59}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019359955_1019359962 18 Left 1019359955 7:599622-599644 CCCGCGGGGCAGCATTTACACCC 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1019359962 7:599663-599685 TCTGGCGCCGAGCTCACACCTGG No data
1019359955_1019359960 0 Left 1019359955 7:599622-599644 CCCGCGGGGCAGCATTTACACCC 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1019359960 7:599645-599667 CACCATCACTGCAGCTTCTCTGG 0: 1
1: 0
2: 2
3: 18
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019359955 Original CRISPR GGGTGTAAATGCTGCCCCGC GGG (reversed) Intronic
903016109 1:20363145-20363167 GGGTTTGAATCCTGCCCCACTGG - Intergenic
907496426 1:54848244-54848266 TGGTGTAAATGCTCCCCCTGTGG + Intergenic
916512614 1:165486100-165486122 GGGTGTTAATGTGGCCTCGCAGG - Intergenic
1065928098 10:30454077-30454099 GGGTGTAAAAGCTGCCTCCTTGG + Intronic
1067052488 10:43030011-43030033 GCGTGTAAATGGTGCCCTGATGG - Intergenic
1067414748 10:46094687-46094709 GGGTGTAAATGGTGGCCCCCAGG + Intergenic
1067575699 10:47407059-47407081 GGGTGTAAACGGTGGCCCCCAGG - Intergenic
1068813436 10:61282599-61282621 TAGTGTAAATGCTGCCACGATGG - Intergenic
1069674002 10:70234080-70234102 GGGCGTAAATCCTCCCCCACTGG - Intergenic
1076618465 10:131771889-131771911 GGCTGGAAATGGTGCCCAGCAGG + Intergenic
1081708491 11:45201033-45201055 TGGTGTAAATGCTCCCCCCATGG + Intronic
1096263018 12:50104598-50104620 GGGTGGCAATGCAGCCCAGCTGG + Exonic
1096386831 12:51199746-51199768 GGCTGTACAAGCTGCCCCCCAGG - Exonic
1096612938 12:52814908-52814930 GGGTACCCATGCTGCCCCGCAGG + Intergenic
1102151980 12:110694914-110694936 GGGTGTAAATCCTGCCTCAATGG + Intronic
1102529279 12:113534178-113534200 GGTTGTAAATTCTCCCACGCAGG + Intergenic
1102792935 12:115662749-115662771 GGGTGTAAATTCTGCCCCCAGGG - Intergenic
1107224704 13:38033320-38033342 TGGTGTAAATTCTTCCACGCTGG - Intergenic
1112176858 13:97034446-97034468 TGGTCTAAATGCTGCCTCGGTGG - Intergenic
1116504896 14:45665819-45665841 TGGTTTAAATGCTGCCCCTCTGG + Intergenic
1118757390 14:68854677-68854699 TGGTGTAAATACTGCCCCCATGG - Intergenic
1121347448 14:93146617-93146639 TGGTGTAAATACTGCCCCCATGG + Intergenic
1121764553 14:96474876-96474898 GGGTGTAATTCCTGCCTTGCAGG - Intronic
1126216147 15:46157259-46157281 TGGTGTAAATGCTGCCTCCATGG - Intergenic
1129867701 15:78922049-78922071 GGGTGGAAATCCTGCCCTGGAGG - Exonic
1132107791 15:99076466-99076488 GGGTTTAAATATTGCCCCTCTGG + Intergenic
1140048590 16:71459306-71459328 GAGTCTTAAGGCTGCCCCGCTGG - Intronic
1142749387 17:1978159-1978181 GGGGTTAAATGCAGCCCAGCAGG - Intronic
1143572468 17:7768290-7768312 GGGTGTCCACTCTGCCCCGCTGG + Intronic
1151130545 17:71892422-71892444 GGGAGTAGAGGCTGCCCCCCAGG - Intergenic
1151658556 17:75507034-75507056 GGCTGTCAATGCCGCCTCGCTGG - Exonic
1153939319 18:9964206-9964228 GGGTGTCATTGTTGCCCGGCTGG - Intergenic
1155618927 18:27753565-27753587 GGGTGGAATTGCTGCCAGGCTGG + Intergenic
1163386723 19:17004560-17004582 GGGTGTCAAACCTGCTCCGCTGG - Intronic
1167473938 19:49689642-49689664 GGGTTTGAATCCTGCCCCTCTGG + Exonic
938928579 2:136066292-136066314 TTGTGTTAATGCTGCCCCTCAGG - Intergenic
944170904 2:196776426-196776448 GGATGCAAATGCTGCACAGCAGG - Exonic
1173133237 20:40414302-40414324 TGGTGTAAATGCTTCCACCCTGG - Intergenic
1175293896 20:57895756-57895778 GGGTGGAGATGCTGACCCCCAGG - Intergenic
1175972851 20:62695658-62695680 GGGAGTAAATGCTGCCCATCCGG - Intergenic
1176264415 20:64201634-64201656 TGGTGTAAATGCTCCCACGATGG - Intronic
953422101 3:42762135-42762157 TGGTTTAACTGCTGCCCAGCTGG + Intronic
971394761 4:26217676-26217698 GGGTGGAAATGCTGCCCAGTTGG + Intronic
974744704 4:66057173-66057195 GGGTGGAACTGCTGCCCCAGTGG - Intergenic
975102554 4:70531155-70531177 AGGTGTAAATCCTGCCACCCAGG + Exonic
983514481 4:168641788-168641810 GTTTGTAAATGTTGCCCAGCTGG - Intronic
999868788 5:155728964-155728986 GGGTATAAACGCTATCCCGCAGG - Intergenic
1003545990 6:7058884-7058906 GTGTGTAACTGCTGCTCCACAGG - Intergenic
1004020676 6:11773489-11773511 GGGTGCAAATGCTGCACTCCCGG - Intronic
1004367208 6:15022357-15022379 GGGGGTAAAAACTGCCCCACTGG - Intergenic
1017786359 6:157760289-157760311 TGGTGTAAATACTGCCCCCATGG - Intronic
1019359955 7:599622-599644 GGGTGTAAATGCTGCCCCGCGGG - Intronic
1025020495 7:55476141-55476163 GGGTGTGAGTGCAGCCCGGCTGG - Intronic
1029625529 7:101718272-101718294 GGGTGTTGAAGCTGCCCCTCCGG - Intergenic
1032002321 7:128273431-128273453 AGGTGTAAATGCTGCCCTACTGG - Intergenic
1047496738 8:125414114-125414136 CGGTGTAAATGCTCCCACCCTGG - Intergenic
1047938882 8:129808226-129808248 GGGTTTAAAGCCTGCCCTGCTGG + Intergenic
1049173420 8:141176382-141176404 GGGTGTAGGTGCCGCACCGCAGG + Intronic
1050563809 9:6861845-6861867 GGCTGTAACTGCTGCCTCCCAGG + Intronic
1055566658 9:77575964-77575986 GGGGGTAGAAGCTGCACCGCTGG + Intronic
1056569854 9:87805749-87805771 TGGTGTAAATGCTCCCACCCTGG + Intergenic
1056800207 9:89685813-89685835 GGGTATAAATGCTCCACCTCCGG + Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1061198541 9:129122428-129122450 GGGTGTAACTGCAGCCCAGCAGG + Intronic
1061490812 9:130943229-130943251 GGGTTCAAATTCTGCCCCACCGG - Intergenic
1062105261 9:134751640-134751662 AGGTGTAAACACTGCCCCGTGGG + Intronic