ID: 1019371466

View in Genome Browser
Species Human (GRCh38)
Location 7:664122-664144
Sequence GTGGAGAGAGGCCAGGCGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 0, 2: 1, 3: 67, 4: 455}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019371466_1019371480 22 Left 1019371466 7:664122-664144 CCCTTCGCCTGGCCTCTCTCCAC 0: 1
1: 0
2: 1
3: 67
4: 455
Right 1019371480 7:664167-664189 GGTGAATTCCTCACACCCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 61
1019371466_1019371471 1 Left 1019371466 7:664122-664144 CCCTTCGCCTGGCCTCTCTCCAC 0: 1
1: 0
2: 1
3: 67
4: 455
Right 1019371471 7:664146-664168 GACCCCCATCCCCAGCCAGCTGG No data
1019371466_1019371481 26 Left 1019371466 7:664122-664144 CCCTTCGCCTGGCCTCTCTCCAC 0: 1
1: 0
2: 1
3: 67
4: 455
Right 1019371481 7:664171-664193 AATTCCTCACACCCGCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019371466 Original CRISPR GTGGAGAGAGGCCAGGCGAA GGG (reversed) Intronic
900568821 1:3348396-3348418 GTGGAGAGAGGCCAGCGGTGGGG + Intronic
900849483 1:5130934-5130956 TTGGAGAGAGGGCAGGAGAGGGG - Intergenic
900956242 1:5887950-5887972 GGGGAGGCAGGCCAGGCCAAGGG + Intronic
901219426 1:7574750-7574772 GTAGAGAGAGGCCAGGTGTCAGG + Intronic
901403650 1:9031821-9031843 GTGGAGAGAAGCCAGGCAGTGGG + Intergenic
901974298 1:12932222-12932244 TTGGTGTGAGGCCAGGGGAAGGG - Intronic
902010877 1:13269546-13269568 TTGGTGTGAGGCCAGGGGAAGGG + Intergenic
902255567 1:15186796-15186818 GTGGAGAGAGGGCAGGCCAGGGG + Intronic
902388513 1:16089372-16089394 GTGGGTAGAGTCCAGGTGAAAGG + Intergenic
903101646 1:21035476-21035498 GTGGGGAGAGGCCAGGCAGCAGG - Intronic
903663826 1:24994971-24994993 GAGGAGCGAGGCCAGGAGATAGG - Intergenic
903740438 1:25555633-25555655 GTGGAGGGATGCCAGGCAGACGG - Intronic
904407957 1:30305921-30305943 GAGGAGAAAGGACAGGGGAAGGG - Intergenic
904420442 1:30387513-30387535 GTGGAGAGAGTCCAGGGAGATGG - Intergenic
904682778 1:32240677-32240699 GAGGAGAGAGGCCAGGTCTAGGG + Intergenic
904700984 1:32357947-32357969 ATGGGGAGGGGCCAGGCAAAGGG - Intronic
905435293 1:37951516-37951538 GTGGAGGGAGGCCATTGGAAGGG - Intergenic
905652938 1:39668595-39668617 GTGGATAGAGGCCAGGCTAGAGG - Intronic
906855232 1:49297322-49297344 GTGGTGAGAGGCCAGGAGGGAGG + Intronic
907043025 1:51280421-51280443 TTGGAGGGTGGCCAGGAGAAGGG + Intergenic
907133264 1:52116356-52116378 GTGGAGAAAGGAAAGGGGAATGG - Intergenic
907575606 1:55523100-55523122 TTGGAGAGAGGCTATGAGAAAGG + Intergenic
908032005 1:60010923-60010945 GTGGTGAGAGGCCAGTGGCACGG - Intronic
908259374 1:62327635-62327657 GTGGAGAGAGGCCAGGCAGTGGG + Intergenic
908613659 1:65892542-65892564 GTGGAGAGAAGCTAAGTGAAGGG - Intronic
909603122 1:77481238-77481260 GTTCAGAGAGGTCATGCGAAGGG - Intronic
910259782 1:85283957-85283979 GTGGGGAGAGACCAGGCAACAGG - Intergenic
911664107 1:100534910-100534932 AGGGAGAGAGGCCAGCCGAATGG + Intergenic
912663919 1:111561912-111561934 GTAGGGAGAGGCCAGGGGCAAGG - Intronic
912709924 1:111942931-111942953 CAGGAGAGAGGCCAGGTGTATGG - Intronic
915264725 1:154708731-154708753 ATTGAGAGAGGCCAGGCGCCTGG - Intronic
915299935 1:154946104-154946126 GTGGAAGGAGGGCAGGCCAAGGG - Exonic
915328490 1:155093680-155093702 GTGCAGAGAGGCCAGGCCTGGGG - Intergenic
915930308 1:160056544-160056566 GTGGAGAGAGCACTGGGGAAGGG - Intronic
916197259 1:162236165-162236187 GTGGAAAGAAGCCAGAGGAATGG - Intronic
917848903 1:179043313-179043335 GTGGGGAGAGGCCAGGCAGCAGG + Intronic
919165352 1:193885206-193885228 GTGGAGAGAGGCCAGGCAGTGGG + Intergenic
919666806 1:200300360-200300382 GTGGAGAGAGGCCTGGGAGAGGG - Intergenic
920122723 1:203670852-203670874 GAGGAGAGAGGGCAGGAGAAGGG - Intronic
920131856 1:203738237-203738259 GGAGAGAGGGGCCAGGGGAAAGG - Intronic
920269491 1:204752364-204752386 GTGGAGAGGGGCCAGGCAGCAGG - Intergenic
922554981 1:226526165-226526187 GTGGAGAGAGGCCCTGGAAAAGG - Intergenic
922808627 1:228403514-228403536 GAGGAGAGAGGCCTGGGGACAGG - Intronic
923091601 1:230745239-230745261 GTGCAGAGAGGATAGGGGAAAGG + Intergenic
923643010 1:235784743-235784765 GTGGAGAGTGCCTAGGAGAAAGG + Intronic
923755190 1:236785530-236785552 GTGGAGAGAAGCCAGGCAGAGGG - Intergenic
1062783994 10:245626-245648 GTGGAGAGATTCCAGGCAGAGGG - Intronic
1066190778 10:33053826-33053848 TTGGAGAGATGGCAGGAGAAAGG - Intergenic
1067296013 10:44975495-44975517 GTGGAGAGGGGACTGGAGAAGGG - Intronic
1068157780 10:53223256-53223278 GTAGAGAGAGGCCAGGCGGTGGG + Intergenic
1069614203 10:69796477-69796499 GAGTAGAGTGGCCAGGTGAATGG - Intergenic
1070825259 10:79386977-79386999 GTGGAGAGTGGCCAGGGAAGAGG - Intronic
1071263785 10:83945544-83945566 GTGGGGAGAGGCAAGGCCACAGG - Intergenic
1071956980 10:90770527-90770549 GTGGGGAGAGGCCAGGCAGCAGG - Intronic
1074301911 10:112240745-112240767 GTGGAGAGAGGCCAGGGAGCAGG + Intergenic
1074463143 10:113657075-113657097 CTGGAGAGAGGCCAGCCTAGAGG + Intronic
1074518796 10:114198206-114198228 GTGGAGAGAGGCCCGACTGAAGG + Intronic
1074766891 10:116706292-116706314 GTGAGGAGAGGCCAGGCGGGTGG - Intronic
1075310948 10:121412967-121412989 GGGGAGAGAGGTCAGGAGAGAGG - Intergenic
1075561860 10:123473950-123473972 GTGGAAAGAGGAAAGGGGAAGGG - Intergenic
1076413626 10:130269454-130269476 GAAGAGAGAAGCCAGGCAAAGGG - Intergenic
1076434313 10:130429670-130429692 GTGGAGAGAGGACATGGGTAAGG + Intergenic
1077115882 11:884471-884493 GTGGAGAGTGGCCAAGAGGATGG + Intronic
1077242449 11:1517717-1517739 GTGGAGAGATGGCAGGCGTTGGG - Intergenic
1077302068 11:1852021-1852043 CTGGAGAGAGGCCAGGGGTTGGG - Intergenic
1077338725 11:2016689-2016711 GTGGGGAGGGGCCAGGTGCAGGG - Intergenic
1078043715 11:7893574-7893596 GTGGGGAGAGGGTAGGAGAAAGG - Intergenic
1078091301 11:8266304-8266326 GTGGAGAGAGGCCATCAGATGGG - Intronic
1081565311 11:44257275-44257297 GTGTTGAGAGGACAGGGGAAGGG - Intergenic
1081771802 11:45654668-45654690 GTAGAGGGAGGCCAGGCCAGAGG - Intronic
1082238643 11:49850788-49850810 GTGGAGAGCGTCCTGGAGAAGGG + Intergenic
1083300565 11:61737801-61737823 GTGGGGAGAGGCCTGGAGGAGGG - Intronic
1083319852 11:61838900-61838922 GTGGAGAGAGCCAAGGAGCAAGG - Intronic
1083420809 11:62552032-62552054 GTGGAGAGAAGGGAGGGGAAGGG - Intronic
1083639107 11:64135872-64135894 GGGGAGAGAGGGCAGGCGCGGGG - Intronic
1084179517 11:67439436-67439458 CTGGGGGCAGGCCAGGCGAAGGG - Intronic
1084371206 11:68745443-68745465 GTGGAGTGAGGACAGGACAAAGG - Intronic
1084450134 11:69231862-69231884 ATGGGGAGAGGCCAGGTGACAGG + Intergenic
1085241321 11:75058728-75058750 GTGGAGGGAGGACAAGGGAAGGG - Intergenic
1087160589 11:94944285-94944307 GTGGAGGGAATCCAGGCAAAGGG + Intergenic
1088786905 11:113190486-113190508 GTGGAGAGGGGAGAGGAGAAGGG - Intronic
1089602982 11:119626553-119626575 GTGGGGAGAGTGCAGGGGAAGGG + Intronic
1089619331 11:119713516-119713538 GTGGGGAGGGGGCAGGGGAAGGG - Intronic
1090620352 11:128555146-128555168 CTGGAGAGAAACCAGGCAAATGG + Intronic
1090836204 11:130455881-130455903 GTGGGGAGAGGCCTGGGGAGAGG - Intronic
1202821709 11_KI270721v1_random:71871-71893 GTGGGGAGGGGCCAGGTGCAGGG - Intergenic
1091460598 12:641437-641459 GTGGGGAGAGGCCATGAGGATGG + Intronic
1091719218 12:2800492-2800514 GAGGTGAGAGGCCAGTCGAAGGG - Exonic
1091910583 12:4227299-4227321 GTGGAGAGAGGCCAAGAGGAGGG - Intergenic
1092023484 12:5222027-5222049 GTGGGGAGAGGGCTGGGGAAGGG + Intergenic
1092211777 12:6651052-6651074 GTGGGGAGAGGGGAGGAGAAGGG + Exonic
1092284688 12:7121950-7121972 GTGGAGAAAGGGCAGGGGAGGGG - Intergenic
1092286264 12:7130668-7130690 GAGCAGAGAGGCCAGCAGAAGGG - Exonic
1092502906 12:9065388-9065410 GTGGAGAGAAGCCAGGCAGCCGG - Intergenic
1092508054 12:9124710-9124732 GAGGAGAAAGGCCAGGCAATGGG - Intergenic
1093677105 12:21956011-21956033 GTAGAGAGAAGCCAGGCCAAAGG - Intergenic
1093765046 12:22952948-22952970 GTGGGGAGAGGCCAGGCAGCAGG + Intergenic
1094496492 12:30992411-30992433 GTGGAGAGTGGGCAGGTCAAAGG - Exonic
1094511972 12:31102436-31102458 CAGGAGAGAGGCCAGGTGACAGG + Exonic
1095465532 12:42484180-42484202 GTGGAGATCGGCCAGGGGCACGG - Intronic
1095603129 12:44037332-44037354 GTGGGGAGAGGCCAGGCAGCAGG - Intronic
1095826012 12:46531105-46531127 GTGGGGAGAGGCCAGGCAGTGGG - Intergenic
1096177360 12:49531493-49531515 GTGGAGGGAGCACAGCCGAAAGG + Intergenic
1096666198 12:53167225-53167247 GTGGAAACAGTCCAGGCAAAGGG + Intronic
1097067056 12:56328362-56328384 GTGGGGAGAGGAAAGGCTAAGGG + Intronic
1097202350 12:57289894-57289916 GTGGAGAGGAGCCTGGCTAAAGG - Intronic
1097446966 12:59683362-59683384 TTGGAGAGAGGCCAGAAGATGGG + Intronic
1101315511 12:103625318-103625340 GTGGAGAAAGGGCAAGTGAAAGG + Intronic
1101345400 12:103881535-103881557 GAGGAGAGAGGGCAGGCAAAGGG + Intergenic
1101755477 12:107617863-107617885 TTGGAGAGAGGGCAGGCTGACGG + Intronic
1102328618 12:112011055-112011077 GTAGAGAGAGTCCAGGCGGTGGG + Intronic
1105794169 13:23834107-23834129 GTGGAGAGAGGCCACGCGCCCGG + Intronic
1106571969 13:30935167-30935189 GTGGAGAGAGGCCAGGCAGTGGG - Intronic
1108088235 13:46818268-46818290 GTGAAGAGAGGCCAGGCAGTGGG - Intergenic
1108461694 13:50673429-50673451 GTTAAGAGAGGCCAGGGGTAGGG - Intronic
1110168106 13:72468168-72468190 GAGGAGAGAGGACAGGGGTAGGG + Intergenic
1110416582 13:75260089-75260111 GTGGAGGGAGGGCATGTGAAAGG - Intergenic
1111347225 13:86974586-86974608 GTGGGGAGAGGCCAGGGAGAGGG - Intergenic
1111800526 13:92974934-92974956 GTGGAGAGAGACCAGGCAGTGGG + Intergenic
1113654184 13:112057831-112057853 GAGGAGGGAGGACAGGCGCACGG - Intergenic
1114380144 14:22194516-22194538 GTGGAGAGAGCCAAGTTGAAAGG - Intergenic
1114618740 14:24082345-24082367 GGGGACAGAGGGCAGGAGAAGGG - Intronic
1115059040 14:29168470-29168492 GTGGAGAGAAGCCAGGGAGACGG - Intergenic
1116159821 14:41253888-41253910 GTGAGGAGAGGCCAGGCAATGGG + Intergenic
1117268843 14:54120333-54120355 GTGGAGAAAGGTCAGGGGTAAGG - Intergenic
1117625625 14:57634787-57634809 GAGGAGAGAGTTCAGGTGAAAGG + Intronic
1118213629 14:63788181-63788203 GAGGAGAGAGGCCAGGCAGAGGG + Intergenic
1118325076 14:64775007-64775029 GAGGAGTGAGGCCAGGGGAGGGG - Intronic
1118332228 14:64823570-64823592 ATGGGGACAGGCCAGGGGAAGGG + Intronic
1118522237 14:66597544-66597566 GTGGGGAGAGGCCAGGCAGCAGG + Intronic
1119385253 14:74254119-74254141 GTGGGGAGAGGCCAGGCGTGGGG + Intronic
1119438090 14:74611179-74611201 GTGGAGAGGCGCCTTGCGAAAGG + Intronic
1119601674 14:75980903-75980925 GGGAAGAGAGGCCAGGGGGACGG + Exonic
1119618124 14:76112026-76112048 GTGGAGAGAGGCCAAGCCGCAGG - Intergenic
1120166466 14:81206827-81206849 GTGGAGAGAGGGAGGGAGAAGGG - Intronic
1120333348 14:83122118-83122140 GTGGAGAGAATTCAGGCTAAGGG - Intergenic
1121178093 14:91906222-91906244 GTGGGGAGAGGGCAGGGGATTGG - Intronic
1121333147 14:93060473-93060495 CAGGAGAGAGGCCAGGCTGAGGG + Intronic
1121438686 14:93935238-93935260 GTGCTGAGAGGCCAGGATAAGGG + Intronic
1121520908 14:94585641-94585663 ATGGAGAGAGCCCAGCAGAAAGG + Intronic
1121553431 14:94819380-94819402 GTGAAGAGAGGCCAGGCAGTGGG + Intergenic
1122500067 14:102191483-102191505 ATGGAAAGAGGACAGGCGAGTGG + Intronic
1122580541 14:102769020-102769042 GGGGAGAGCGCCCAGGCGGAGGG - Intergenic
1122955306 14:105067646-105067668 GTCCAGACAGGCCAGGAGAACGG - Intergenic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1123005832 14:105323369-105323391 GTGGACAGAGGCAGGGGGAAGGG - Intronic
1123023140 14:105411544-105411566 GTCGAGGGAGGCGAGGCGGAGGG - Intronic
1124665262 15:31586818-31586840 GTGGAGAGGGGGCAAGCCAAGGG - Intronic
1124857672 15:33406394-33406416 GTGGAGTGAGGCCAGAGGTATGG - Intronic
1124899089 15:33805938-33805960 GTGGAGAGAAGGGAGGGGAAGGG - Intronic
1125238937 15:37550580-37550602 GCTGAGAGAGGCCAGGCCATGGG + Intergenic
1125241482 15:37582108-37582130 GTGGGGAGAGGCCAGGCAGAAGG - Intergenic
1125435989 15:39645774-39645796 GCGGAGAGAGGCCAGGCAGTGGG - Intronic
1125926091 15:43564451-43564473 GTGGAAAGAGACTAGGGGAAGGG - Intronic
1125939235 15:43664002-43664024 GTGGAAAGAGACTAGGGGAAGGG - Intronic
1128212727 15:65913707-65913729 GAGGAGGGAGGCCAGGAGCATGG + Intronic
1128980439 15:72181489-72181511 ATGGAGAGAGATCAGGTGAAAGG + Intronic
1129183470 15:73891642-73891664 GTGGGGAGAGGCCAGGCAGTGGG - Intergenic
1129248025 15:74291823-74291845 GTTGAGACAGACCAGGCCAATGG - Intronic
1129871146 15:78942499-78942521 GTTGAGTGAGGCCAGGCGTGGGG - Intronic
1130042423 15:80415982-80416004 GTGGAGAGTGGGCAGGGGGAAGG - Intronic
1130253416 15:82315007-82315029 GTGGAGAGAGGCTAGGAGGGTGG - Intergenic
1130327753 15:82895366-82895388 GTCAAGAGAGGCCAGACGACAGG + Intronic
1131066777 15:89439650-89439672 ATGGAGAGGGGCCAGGTGAGTGG - Intergenic
1131340840 15:91599215-91599237 GTGCAGAGAGTCCAGGGGGAAGG - Intergenic
1131632557 15:94194706-94194728 GATGAGAGAGACCAGACGAAAGG + Intergenic
1132513153 16:353775-353797 GTGGAGACAGCCCAGGGGAAGGG - Intergenic
1132650803 16:1020712-1020734 GTGGAGGGAGGGCAGGCGGTGGG + Intergenic
1132716433 16:1292491-1292513 GTGGAGAGAGGAGAGGGGAGAGG - Intergenic
1134123606 16:11601300-11601322 GAGGAGGGAGGCCAGTGGAATGG - Intronic
1134196546 16:12163445-12163467 GTGGACAGAGGCCAGACCAGAGG + Intronic
1134224392 16:12380349-12380371 GTGGAGGGATGACAGGTGAAGGG - Intronic
1134332593 16:13264900-13264922 GAGGAGAAAGGCGAGGGGAAAGG - Intergenic
1135208168 16:20499868-20499890 GTGGGGAGAGGCCAGGCAGCAGG - Intergenic
1135210731 16:20523832-20523854 GTGGGGAGAGGCCAGGCAGCAGG + Intergenic
1136376864 16:29871086-29871108 CTGGAGAGAGGGCTGGGGAAAGG - Intergenic
1137357487 16:47780620-47780642 GTGGAGAGAGCCCAGCCTATGGG - Intergenic
1137416345 16:48285148-48285170 GTGGTGAGAGGACATGCGAAAGG - Intronic
1137489877 16:48923546-48923568 GAGAAGAGAGACCAGGAGAAAGG - Intergenic
1137692826 16:50441311-50441333 GTGGAGAGAGGCCAGACAGCAGG - Intergenic
1139462561 16:67134178-67134200 CTGGAGAGAAGCCAGGCCATGGG - Exonic
1139648967 16:68352237-68352259 GAGGAGAGAGACCTGGTGAATGG - Exonic
1139964823 16:70739479-70739501 GAGGAGAGGGGCCAGGCCATGGG - Intronic
1140419623 16:74807635-74807657 GAGGAGAGAGGCCAGGCAATGGG + Intergenic
1141158240 16:81611650-81611672 GTGGTGAGAGGCCTGGAGGAAGG - Intronic
1141355871 16:83346232-83346254 AAGGAGAGAGGGCAGGTGAAGGG + Intronic
1141614517 16:85202804-85202826 GTGGAGCCAGGCCTGGCCAAGGG + Intergenic
1141735264 16:85847936-85847958 GTGGCAAGAGCCCAGACGAACGG + Intergenic
1142666830 17:1468126-1468148 GGGGACAGAGGCCAGGCTGAAGG + Intronic
1142854438 17:2722002-2722024 CTGGGGGGAGGCCAGGCGGACGG + Intergenic
1143419147 17:6775792-6775814 GTGGATAAGGGCCAGGTGAAGGG + Intergenic
1143779844 17:9223656-9223678 GTGGAGAGAGGCCTGCCCCATGG - Intronic
1143965631 17:10754865-10754887 GTAGAGAGAGGCTAGGGGGAAGG + Intergenic
1144707520 17:17379460-17379482 GTGGAGAGAGGGCTGGCTGAGGG - Intergenic
1145009990 17:19362499-19362521 GTGGAGAGCGCCCAGGTGAGCGG - Exonic
1146492061 17:33290684-33290706 GGGGACGGAGGCCAGGTGAAGGG + Intronic
1147500219 17:40955842-40955864 GGGGTGAGAGGCAAGGAGAAAGG + Intergenic
1147908887 17:43842713-43842735 GTGGAGAGAGGCGTGGAGAGAGG - Intergenic
1148640477 17:49183764-49183786 GTGCAGAGAGGCCAGGCAGTGGG + Intergenic
1148696950 17:49566307-49566329 GTGGAGGGAGGGCAGAGGAAGGG + Intergenic
1148844302 17:50519778-50519800 GTGGAGACAGGTGAGGCGCAGGG + Exonic
1148850655 17:50553421-50553443 GTGGAGAGAGTTCAGGCATAGGG + Intronic
1148910541 17:50940116-50940138 GGGAAGAGAGGCCAGGGGACAGG + Intergenic
1148997146 17:51720757-51720779 GTGGAGAGAGGGAAGGAGAAAGG + Intronic
1149518162 17:57296387-57296409 GTGGAGAGAGGCCAGGGTGGTGG + Intronic
1150741044 17:67779201-67779223 GTGGAGAGGGGCCGGGTGATGGG + Intergenic
1151010142 17:70484269-70484291 GTGGAGAGAGGCCAGACTGTGGG + Intergenic
1151051852 17:70987105-70987127 GTGGAGAATGGCAAGGGGAAGGG - Intergenic
1151473707 17:74333191-74333213 GTGGAGAGTGGCTAGGGGAGGGG + Intronic
1151768045 17:76142124-76142146 CAGGAGGGAGGCCAGGGGAAGGG - Intergenic
1152347501 17:79762283-79762305 CTGGGGAGAGGCCAGGCCAGCGG - Intergenic
1153428054 18:4987914-4987936 GTGGGGAGAGGCCAGGCAACAGG + Intergenic
1153626452 18:7025991-7026013 ATGGTGAGAGGGCAGGCGCAGGG + Exonic
1154346677 18:13548587-13548609 GTGGGGAGAGGCCAGGCAGTGGG + Intronic
1155100411 18:22605137-22605159 TTGGACAGAGGCCAGACCAAAGG + Intergenic
1157339233 18:46764652-46764674 GTGGAGAGAGGAGAGGAGAGGGG + Intergenic
1157509911 18:48263568-48263590 GTGGAGAGAGGCCAGGAAGGAGG - Intronic
1157836840 18:50911658-50911680 CTGGAGAGAGTGCAGGCAAATGG + Intronic
1158632946 18:59132093-59132115 GTGGAGAGAGGCCAGGCAGCAGG - Intergenic
1158787959 18:60739518-60739540 GTGGAGAGAGGCCAGGCAGCGGG - Intergenic
1158829265 18:61260020-61260042 GTGGACAGACACCAGGAGAAGGG - Intergenic
1159964056 18:74579139-74579161 GAGGAGAGAGGGCAGGAGAGAGG - Intronic
1160083656 18:75754143-75754165 GTGGGAAGAGGCCAGGCAGAGGG + Intergenic
1160241880 18:77131137-77131159 GTGGAGGAAGGCCAGGGGAAGGG - Intronic
1161236051 19:3198792-3198814 GTGGATAGAGAGCAGGGGAATGG - Intronic
1161256276 19:3311592-3311614 GTGGGGAGGGGCGAGGGGAAGGG - Intergenic
1161326333 19:3665956-3665978 GTGGAGGGAGGGCAGGGGCAGGG - Intronic
1162198054 19:9000632-9000654 GTGGGGACAGGCCAGGCCAGTGG - Intergenic
1162855894 19:13468444-13468466 GTAGAGAGAGACCAGGGAAATGG - Intronic
1162969173 19:14169830-14169852 GAGGAGAGAGGGCAGGAAAAAGG + Intronic
1163614758 19:18320156-18320178 TTGGAGAGAGGTCAGAGGAAGGG + Intronic
1164508385 19:28877897-28877919 GTGGAGAGAAGCCTGGAGCATGG - Intergenic
1165404006 19:35619047-35619069 GTGGTGAGAGGCTAGGCCCAGGG + Exonic
1166070831 19:40386638-40386660 GCTGAGAGAGGCCAGGTGCAGGG - Intronic
1166769409 19:45271858-45271880 CTGCAGTGAGGCCAGCCGAATGG + Intronic
1167606846 19:50485771-50485793 GAGGTGAGAGGCCACGCGGAGGG - Exonic
1167660141 19:50791623-50791645 GTGGAGAGAGGGCACGCGGGGGG - Intronic
1167959097 19:53091501-53091523 GTGCAGAGAGGCCAGGAGTTGGG + Exonic
1167971984 19:53193398-53193420 GTGGGGAAAGGCCAGGCGTTGGG + Intergenic
1168062107 19:53898797-53898819 GGGGGGCGTGGCCAGGCGAAGGG + Intronic
1168258477 19:55179874-55179896 GGAGACAGAGGCCAGGCGATAGG - Intronic
1202653000 1_KI270707v1_random:23750-23772 GTGGAGAGATGCCAGGTGGTGGG - Intergenic
925778513 2:7357688-7357710 GAGCAGAGAGGCCAGGCCCAGGG - Intergenic
927460638 2:23295523-23295545 GGAGAGAGAGGCCAGGTGTATGG - Intergenic
928309294 2:30196260-30196282 GTGGAGAGATTCATGGCGAAGGG + Intergenic
928723723 2:34148033-34148055 GTGGAGAGAGGCCAGGCAGTGGG + Intergenic
929437572 2:41940097-41940119 GTGCAGAGAGGCCAGGGGAAGGG - Intronic
929546176 2:42856438-42856460 CTGGAGAGAGTCCAGGGGATTGG + Intergenic
929570066 2:43017162-43017184 GTGGAGAGAGGCAAGGGGATGGG - Intergenic
929666708 2:43839072-43839094 GAGGAGAGAGGGCTGCCGAAAGG + Exonic
929761907 2:44814094-44814116 GTGAACAGCAGCCAGGCGAATGG + Intergenic
930419484 2:51133424-51133446 CTGGAAAGAGACCAGGAGAATGG + Intergenic
930680982 2:54256174-54256196 GTGGGTAGAGGCCAGGCCAGAGG + Exonic
931734022 2:65177848-65177870 GTGGGGAGAGGCCAGGCAGTGGG + Intergenic
932091386 2:68809195-68809217 GTGGAGAGAGGGCAGAAAAAGGG - Intronic
932447075 2:71787632-71787654 GTGGGGACAGGCCAGGAGAGAGG + Intergenic
932452887 2:71827039-71827061 GAGGAGATAAGCCAGGCGAAAGG + Intergenic
932522353 2:72427425-72427447 GTGGGGAGAGGCCAGGTAATGGG - Intronic
932706854 2:74032643-74032665 GTGGACAGAGGCCAGCCGGGAGG - Intronic
933219314 2:79670004-79670026 GAGGAGAGAGGCCAGGCTGTGGG + Intronic
933893314 2:86789980-86790002 CGGGAGAGAGGCCAGGTGCAGGG - Intronic
934526794 2:95057030-95057052 GTGGACAGATGCCAGGTGAAAGG + Intergenic
936105862 2:109623850-109623872 GTGGGGAGAGGAAAGGAGAAGGG + Intergenic
937307519 2:120881495-120881517 GTGGGGAGAGGGCAGGTCAAGGG + Intronic
937880305 2:126859546-126859568 CTGGAGAGAGGCAAGGCCATCGG - Intergenic
937980839 2:127614435-127614457 GAGGAGAGAGGACAGGAGATGGG - Intronic
938263224 2:129909746-129909768 ATGGAGTGTGGCCAGGAGAAGGG + Intergenic
938462833 2:131509137-131509159 GTGGGGAGAGGCGAGGCGGAGGG - Intergenic
938722156 2:134076532-134076554 GTGGGGAGAGGCCAGGCAGCAGG + Intergenic
939837605 2:147150049-147150071 GTGGGGAGAGGCCAGGCAGCAGG - Intergenic
940423866 2:153509153-153509175 GTGGGGAGAGGCCAGGCAGCGGG + Intergenic
940763153 2:157760889-157760911 GTGGGAAGTGGCCAGGCGGATGG - Exonic
941404735 2:165074509-165074531 GTGGGGAGAGGCCAGACAACAGG - Intergenic
941758921 2:169219490-169219512 GTGGAGAGAGGCCAGGGCCAGGG - Intronic
941932400 2:170955192-170955214 GTGCAGAGAAGTCAGGTGAAAGG + Intronic
942053566 2:172162746-172162768 GTGGAGAGAGGCCAGGCAGTGGG + Intergenic
943198321 2:184784977-184784999 GGGGAGACAGCCAAGGCGAAGGG - Intronic
944586612 2:201178785-201178807 GTGAAGAGAGGCCAGGCAGCGGG - Intergenic
945028039 2:205637940-205637962 GTGGAGAGAGGCTGGGAGGAAGG - Intergenic
946127000 2:217571592-217571614 GTGGAGAGAGGCCTGAGGAAAGG + Intronic
946166404 2:217866774-217866796 GAGGGGAGAGGCCAGCCCAAGGG - Intronic
946253630 2:218428395-218428417 GCGGGGAGAGGCCTGGGGAAAGG - Intronic
946789422 2:223285315-223285337 GTGGAGAGAGGCCAGGCAGTGGG + Intergenic
947025513 2:225733687-225733709 GAGGAGAGAGGCCGGGGGAAGGG - Intergenic
948529899 2:238597806-238597828 GGGGAGAGAGGCCTGGGGAGAGG - Intergenic
948741948 2:240054014-240054036 GTGGAGGGAGGGGAGGGGAAGGG - Intergenic
1169390446 20:5186326-5186348 CTGGAGAGAGGCCATGGGGAAGG - Intronic
1170300769 20:14881867-14881889 GGGGAGACAGGCCAGGCAAGAGG - Intronic
1170989213 20:21286844-21286866 GGAGAGAGGGGCCAGGAGAAGGG - Intergenic
1171298073 20:24036188-24036210 GTGGAGAGAAGGCAGGCTTAGGG + Intergenic
1172230108 20:33330683-33330705 GTGGACAGGGGTCAGGGGAATGG + Intergenic
1172590733 20:36116172-36116194 GAGGAGAGAGGTCAGGGAAAGGG + Intronic
1172788599 20:37486900-37486922 GTTGAGGGAGGCCAGGCCACTGG - Intergenic
1172948036 20:38703615-38703637 GTGGAGTGAGGACAGGAGCAGGG - Intergenic
1173704018 20:45096939-45096961 GAAGAGGGAGGCAAGGCGAACGG - Intronic
1173818108 20:46003022-46003044 ATGGAGAGAGCCCTGGGGAATGG - Intergenic
1175531038 20:59674448-59674470 GAGAAGAGAGGACAGGAGAAGGG - Intronic
1175687474 20:61041990-61042012 GTGGAGAGAGGCCTGGCTACAGG - Intergenic
1175824570 20:61930069-61930091 GTGGAAAGGGGCCAGGCCATGGG - Intronic
1175911305 20:62406744-62406766 CTGGACAGAGGCCAGGACAAAGG - Intronic
1176031755 20:63016224-63016246 ATGGAGAGAGGCCACGTGGAGGG + Intergenic
1176273428 20:64248347-64248369 GGCGAGAGAGACCAGGCGTAAGG + Intergenic
1176273900 20:64252736-64252758 GTGGAGAGATGCAAGGGGATAGG + Intergenic
1177212507 21:18087980-18088002 GGAGAGAGAGGACAAGCGAAGGG + Intronic
1177344721 21:19854249-19854271 GTGGGGAGAGGCCAGGCAGTGGG + Intergenic
1177357902 21:20032018-20032040 GTGGGGAGAGGCCAGGCAGCAGG + Intergenic
1177994331 21:28077014-28077036 GGGGGAAGAGGCCAGGCAAATGG + Intergenic
1178244301 21:30936352-30936374 GTGGGGAGAGGCCAGGCAGCGGG - Intergenic
1178518205 21:33266332-33266354 GTGGGGAGGGGCCGGGCGACCGG - Intronic
1178819515 21:35962466-35962488 GTGGCCAGAGGCCAGGAGAGGGG - Intronic
1179184422 21:39073825-39073847 GAGGAGAGGTGCCAGGCCAAAGG - Intergenic
1179568459 21:42263754-42263776 GTGGGGAGGGGCCAGGCGGCTGG + Intronic
1179831979 21:44002589-44002611 GAGGAGAGGCGCCAGGCTAAAGG + Intergenic
1179919387 21:44499420-44499442 CTGGCGAGAGGCCAGCCGCAGGG + Exonic
1179957579 21:44749993-44750015 GTGTAGAGAGGCCAGCCAAGTGG - Intergenic
1180367858 22:11957055-11957077 GTGGAGAGATGCCAGGTGGTGGG - Intergenic
1180419276 22:12799000-12799022 GTGGAGAGATGCCAGGTGGTGGG - Intergenic
1180583707 22:16866699-16866721 GGGGAAAGAGTCCAGGCCAAAGG - Intergenic
1180910418 22:19446457-19446479 ATGGAGAGAAGCCAGCCGAAAGG - Intronic
1181113054 22:20613079-20613101 GTGGGGAGAGGCGAGGCGGAGGG + Intergenic
1182502522 22:30757750-30757772 GTGGGAAGAGGCCAGGAGAGAGG - Intronic
1183361291 22:37384640-37384662 GTGGGGAGAGGCCAGGGGTCGGG - Intronic
1183404748 22:37624933-37624955 GAGGGGAGAGGCCAGGCTGAAGG - Intronic
1184408499 22:44313478-44313500 GTGGGGACAGGCCAGGGGTAGGG - Intergenic
1184648784 22:45910200-45910222 GTGGGGAGAGTCCGGGCGGAGGG + Intergenic
1184789964 22:46694378-46694400 GCGGAGATATGCCAGGTGAAAGG + Intronic
1184902770 22:47457852-47457874 GGGGAGAGAGGCTTGGGGAACGG + Intergenic
1185127271 22:49018118-49018140 GTGGAGGGAGGCCTGGGGCATGG - Intergenic
1185219898 22:49624019-49624041 CTGGGGAGAGGCCAGGAGAGTGG - Intronic
949358028 3:3202325-3202347 GAGGAGAGAGGCTGGGAGAAAGG + Intergenic
950522549 3:13505504-13505526 GTGGGGAGAGGGCAGAAGAAGGG + Exonic
952905868 3:38138756-38138778 GTTGAGAGCAGCCAGGGGAAGGG - Exonic
953025610 3:39143192-39143214 GTGGAGACAGGCCAGGCAGGGGG + Exonic
953079066 3:39598436-39598458 GTGGAGAGAAGCTAGTCCAAGGG - Intergenic
953474230 3:43192473-43192495 GTGGAGAGAGGCTGGAAGAATGG + Intergenic
953602983 3:44386593-44386615 GTGGAGAGAGGCCAGGGAGTGGG - Intronic
953772308 3:45787201-45787223 ATGGAGAGAGGCCAGCGGCAGGG - Intronic
954135967 3:48582361-48582383 GTGGAGAGAGGATAGGAGCAGGG + Intronic
954433741 3:50484981-50485003 ATGGAAAGAAGCCAGGGGAAGGG - Intronic
955069402 3:55559707-55559729 GTGGAGAGAGGCCAAAGGCAAGG - Intronic
955228939 3:57082212-57082234 ATGGAGAGGGGCCAGGGCAAGGG + Intergenic
955862421 3:63345599-63345621 GAGAAGAGAGGCTAGGCGAGAGG - Intronic
956109419 3:65855616-65855638 GAGGAGAGAGGGGAGGGGAAGGG + Intronic
956436283 3:69237428-69237450 TTGGCCAGAGGCCAGGAGAAAGG - Intronic
957287775 3:78239165-78239187 GTGCAAAGAGGGCAGGCGCATGG + Intergenic
957417783 3:79929070-79929092 GTGGGGAGAGGCCAGGGAACAGG - Intergenic
960690531 3:120342067-120342089 CTGGAGAGAGGCCAGGCAGCGGG - Intronic
961545198 3:127628800-127628822 GTGGACAGAGGCCTGGGGTAAGG - Intergenic
962203171 3:133416245-133416267 GAGGAGAGAGGACAGGGGAGAGG - Intronic
962456368 3:135568819-135568841 CTGGAGAAAGGCCATGGGAAAGG + Intergenic
962763912 3:138543450-138543472 GTGAAGAGAGGCCAGGCAGTGGG + Intronic
963274256 3:143314641-143314663 GTGGGGAGAGGCAGGGCCAAAGG - Intronic
964590807 3:158360736-158360758 GTGGAGAGAGGCCAGGCAGCAGG + Intronic
964627906 3:158776739-158776761 GGGGAGAGCGGCCTGGGGAAGGG + Intronic
965061415 3:163788967-163788989 GTGGGGAGAGGCCAGGCAGTGGG + Intergenic
965118705 3:164522517-164522539 GTGGAGAGAGGCCAGGCAGTGGG + Intergenic
965206241 3:165721182-165721204 GTGGGGAGAGGCCAGGCGTGGGG + Intergenic
965601490 3:170458843-170458865 TTGGAGAGAAGCAAGGGGAAGGG + Intronic
966254100 3:177898552-177898574 GTGGAAAGAGGCCAGGGAATGGG - Intergenic
966450247 3:180050833-180050855 GTGTAGAGAGGCCAGGGAACTGG - Intergenic
966491430 3:180531902-180531924 GTGGAGAGAGGTCAGGCAGCAGG - Intergenic
967100287 3:186210441-186210463 GGGCAGAGAGGCCAGGCGCCAGG - Intronic
967106935 3:186261698-186261720 GTGGAGGGAGACAAGGAGAAAGG - Exonic
968545045 4:1194164-1194186 GTGGAGGGAGGCCGGCCGGAGGG - Intronic
968731979 4:2273478-2273500 GTCGAGAGAGATCAGGGGAAGGG + Intronic
968931391 4:3581417-3581439 GTGCAGAGAGGCCTGGGGAGAGG + Intronic
969504954 4:7579940-7579962 GTGGAGTGAGTCCAGGCAGAGGG + Intronic
970434682 4:16022077-16022099 GGGGAGAGAGGGAAGGAGAAAGG + Intronic
970959570 4:21856771-21856793 GTGGGGAAAGGCCAGGCAGAAGG - Intronic
971728851 4:30349902-30349924 GTAAAGAGAGACCAGGCGCAGGG - Intergenic
972203856 4:36747792-36747814 GTGGAGAGAGGCCAGGCAGCAGG - Intergenic
972645753 4:40966581-40966603 GTGGGGAGAGGCCAGGCAGCAGG - Intronic
972831613 4:42820505-42820527 GGGGAAGGAGGCCAGGAGAATGG - Intergenic
973041061 4:45471470-45471492 GTGGGGAGAGGCCAGGCAGTGGG - Intergenic
973362510 4:49178273-49178295 GTGGAGAGATGCCAGGTGGTGGG + Intergenic
973398591 4:49618588-49618610 GTGGAGAGATGCCAGGTGGTGGG - Intergenic
973714000 4:53657034-53657056 CTTGAGGGAGGCCAGGAGAATGG - Intronic
974023355 4:56711217-56711239 GTGGGGAGAGGCCAGGCAGTGGG - Intergenic
976680030 4:87745968-87745990 GTGGGGAGAGGCCAGGCAATGGG + Intergenic
977238264 4:94535098-94535120 GTGGAGAGAGACCAGAGGCAGGG + Intronic
980007512 4:127559076-127559098 GCAGAGAGAGGCCAGGTGGAGGG - Intergenic
980253705 4:130349740-130349762 GTGGGGAGAGGCCAGGCAGTAGG + Intergenic
980731015 4:136824215-136824237 GTGGGGAGAGGCCAGGCAGTAGG + Intergenic
980892875 4:138833512-138833534 GTGGAGAGAGAGCAGGAGAGAGG - Intergenic
982918953 4:161250083-161250105 GTGGGGAGAGGCCAGGCAGCAGG + Intergenic
984255140 4:177381880-177381902 GTGGGGAGAGGCCAGGCAGTAGG + Intergenic
985583711 5:714964-714986 ATGGAGAGAGAGGAGGCGAAGGG - Intronic
985597219 5:799261-799283 ATGGAGAGAGAGGAGGCGAAGGG - Intronic
986105168 5:4652750-4652772 GTTTAGAGAGGCCAGTAGAAAGG - Intergenic
986215142 5:5712840-5712862 GTGGAGAGAGGCCAGGCAGCAGG + Intergenic
986979832 5:13434585-13434607 GGGGAGACAGGCCAGGTGGAGGG + Intergenic
989095405 5:37777106-37777128 GTGGCGAGAGGCAAGGAGAGGGG + Intergenic
992907030 5:81356846-81356868 AGGGAGAGAGACCAGGCGAAAGG - Intronic
993375083 5:87141162-87141184 AGGGAGAGAGGGCAGGCGAATGG + Intergenic
993384921 5:87252095-87252117 GTGGGGAGAGGCCAGGCAGCTGG + Intergenic
993618119 5:90137238-90137260 GTGGGGAGAGGCCAGGCAGTGGG + Intergenic
993977097 5:94496077-94496099 GTGGTGAGAGGCTAGGGGAGAGG + Intronic
995214043 5:109574253-109574275 GTGGAGAGAGGGCAAGAGAGAGG + Intergenic
998011631 5:138699886-138699908 GTGGAGAACAGCCAGGAGAAAGG + Intronic
998168767 5:139859838-139859860 GTGGAGAGGGGCCACGCAGATGG + Intronic
999171232 5:149597049-149597071 GTGGAAATAGCCCAGGCGATGGG + Intronic
999370521 5:151052373-151052395 ATGGGGTGAGGCCAGGCAAAGGG - Intronic
999624076 5:153501731-153501753 GGGGACAGAGGCCAGGGGAAAGG + Intronic
999737914 5:154526475-154526497 GTGGTGGGAGCCCAGGGGAAAGG + Intergenic
1000616924 5:163437672-163437694 GAGGAGAGAGGCCCGGGGAGGGG - Exonic
1001395506 5:171416948-171416970 GTGGAAAAAGGCTAGGCGACTGG - Intergenic
1002874486 6:1199537-1199559 GTGGAGAGAGACCCAGGGAAGGG + Intergenic
1003312040 6:4977800-4977822 GTGGAAAGAGGGAAGGAGAAAGG - Intergenic
1003614823 6:7645440-7645462 GTGGAGAGAGAACAAGAGAATGG - Intergenic
1004290318 6:14361053-14361075 GAGGAGAGAGCCCAGGGGAGGGG - Intergenic
1005043529 6:21620645-21620667 GTGGAGAGAGGCCAGGCAGCAGG + Intergenic
1005719837 6:28590228-28590250 GAGGCGAGATGCCAGGCGAACGG - Intronic
1006347907 6:33498093-33498115 GAGGAGAGAGGCCAGGCAGTGGG - Intergenic
1006463882 6:34179449-34179471 GTGGGGAGAGGCCAGGCAGTGGG + Intergenic
1006787911 6:36680131-36680153 GTGGAGGGAGGCAAGGAGAGGGG - Intronic
1006867675 6:37222373-37222395 TTGGAGAGAGGCCAGGCAGCGGG + Intronic
1006967574 6:38004157-38004179 ATGCAGAGAGGCCATGGGAAGGG + Intronic
1007272014 6:40645048-40645070 GTGTAGAAAGGACAGGAGAATGG + Intergenic
1007324338 6:41048716-41048738 GAGCAGAGAGGCCAGGAGCAGGG - Intronic
1007472600 6:42100513-42100535 GGGGAGAAAAGCCAGACGAAGGG + Intergenic
1008330738 6:50241093-50241115 GTGGGGAGAGGCCAGGCAGTGGG + Intergenic
1008644137 6:53496013-53496035 GGGGAAAGAGGCCAGGGGGAGGG - Intergenic
1008916829 6:56797266-56797288 AGGGAGAGAGGCCAGGGGTATGG - Intronic
1012889847 6:104885638-104885660 GTGGGGAGAGGCCAGGCAGCCGG - Intergenic
1013016490 6:106164709-106164731 ACGAAGAGAGGCCAGGGGAAGGG + Intergenic
1013236107 6:108198922-108198944 GTGGAGAGAGGCCAGTCAGTGGG + Intergenic
1014801790 6:125786856-125786878 GTGAAAATAGGCCAGGCGCAGGG + Intronic
1015455704 6:133424479-133424501 GCAGAGAGAGGCCAGGCAACGGG + Intronic
1015525791 6:134174945-134174967 GGGGCGAGGGGCGAGGCGAAGGG - Intronic
1015903577 6:138092877-138092899 GTGGAGGGAGGGCAGGGGGAAGG + Intronic
1016339727 6:143049699-143049721 GAGGAGAGAGGCCAGGCAGTGGG + Intergenic
1017881816 6:158567321-158567343 GTGGAGAGATGCTAGGCAAGGGG - Intronic
1018529838 6:164751024-164751046 ATGGAGAGAGGCCGGGGGAGTGG - Intergenic
1018964498 6:168474022-168474044 GTGGAGAGTGGAGAGGCGAATGG - Intronic
1019317137 7:391951-391973 GTGCAGAGAGGCCCTGGGAAGGG - Intergenic
1019371466 7:664122-664144 GTGGAGAGAGGCCAGGCGAAGGG - Intronic
1021500852 7:21330382-21330404 GGCGAGAGAGGCCAGGCGGCAGG + Intergenic
1022711347 7:32853887-32853909 GTAGAGAGAGGCTGGGCCAACGG + Intergenic
1023740749 7:43278621-43278643 GTGGAGAGAGAGGAGGGGAAGGG - Intronic
1023789068 7:43737584-43737606 GTGGAGAGAGGCCAGGCAGCAGG - Intergenic
1023836550 7:44072044-44072066 GTGGGGAGAGGCCAGTCCAAAGG + Intergenic
1024220254 7:47281472-47281494 GAAGAGAGAGGCCAGGAGATAGG + Intronic
1024251147 7:47506564-47506586 GTGGAGAGAGGGCAGGAGCAGGG - Intronic
1024279608 7:47708786-47708808 GTTGAGATAGGCCAGGCGCAAGG - Intronic
1024786282 7:52911385-52911407 GTGGAGAGAAGCCAGGCAGTGGG + Intergenic
1025046518 7:55696642-55696664 GTGAAGAAAGGCCTGTCGAATGG + Intergenic
1025161741 7:56667170-56667192 GTGGAGACAGACCAGGCACAAGG - Intergenic
1025710025 7:63900243-63900265 GAGGGGAGAGGCCGGGCCAAGGG + Intergenic
1026574755 7:71562784-71562806 GTATAGAGTAGCCAGGCGAAAGG + Intronic
1026677620 7:72441267-72441289 GTGGGAAGAAGCCAGGAGAAAGG + Intronic
1027228284 7:76258388-76258410 GCGGAGATAGGCCAGGAGGAAGG + Intronic
1027267906 7:76504196-76504218 GTGGAGGGAAACCAGGGGAAAGG - Intronic
1027319717 7:77004058-77004080 GTGGAGGGAAACCAGGGGAAAGG - Intergenic
1028111692 7:86949649-86949671 GTGGGGAGAGGCCAGGCAGGGGG - Intronic
1028233263 7:88330399-88330421 GTGGAGAGAGGCCAGGCAGTGGG - Intergenic
1029254485 7:99260359-99260381 TTGGAGAGAGGCCAGGGCCAAGG + Intergenic
1030132710 7:106216583-106216605 GGGGATAAAGGCCAGGGGAAGGG + Intergenic
1030170646 7:106599380-106599402 TGGGAGAGAGGCCAGCCAAACGG - Intergenic
1031820897 7:126500215-126500237 GGGGAGAGAGGACAGGAAAAGGG - Intronic
1031837111 7:126691341-126691363 GTGGGGAGAGGCCAGGCAGAGGG + Intronic
1032591281 7:133194253-133194275 GTGGGGAGAGGCCAGGCAGTAGG + Intergenic
1032858691 7:135858323-135858345 GTGGAGAGAAGCCAGGCAGTGGG + Intergenic
1034267096 7:149786322-149786344 GTGGAGGGAGACCAGGAGGAGGG - Intergenic
1034351054 7:150415012-150415034 TTGGTGAGAGGCCAGGCCAGAGG + Intergenic
1034351263 7:150416324-150416346 GGGGAGACAGGCGAGGGGAAGGG - Intergenic
1035027313 7:155834505-155834527 GTTGGGAGAGGCCGGGGGAAGGG - Intergenic
1035455732 7:159007444-159007466 GTGCAGAGGGGCCAGGCGAGAGG + Intergenic
1035812596 8:2505045-2505067 GAGGACAGAGGCCAGGCCAGCGG - Intergenic
1037118819 8:15258395-15258417 GGGGAGAGAGGCGAGGGGAGGGG - Intergenic
1037817136 8:22118274-22118296 GAGGAGAGAGTCCAGGGGTAAGG - Intronic
1038350092 8:26768315-26768337 GAGGAAAGAGGCCAGGCAAATGG + Intronic
1039212936 8:35236285-35236307 GGGGAGAGGGGCCAGGTGATGGG + Intronic
1039475481 8:37837378-37837400 GGGAACAGAAGCCAGGCGAAGGG - Intronic
1039921870 8:41898601-41898623 GTGGAGGGTGGACAGGCGGATGG - Intergenic
1041190808 8:55352192-55352214 GGGGAGAGAGGCCAAGGGAGAGG + Intronic
1041956268 8:63560209-63560231 GTGGGGAGAGGCCAGGCAGAGGG + Intergenic
1042396008 8:68292715-68292737 GTGGAGAGAGGCCAGACAGTGGG - Intergenic
1043765721 8:84129758-84129780 GTGGAGAGAGGAGAGAAGAATGG - Intergenic
1044419408 8:91976062-91976084 TTGTAGAGAAGCCAGGAGAATGG - Intronic
1045037187 8:98184758-98184780 GTGGTGAGAGCCCAGGGGATGGG + Intergenic
1045064155 8:98430738-98430760 CTGGGTAGAGGCCAGGAGAAAGG + Exonic
1046673909 8:117088035-117088057 ATGGAGAGAGGGAAGGAGAAAGG + Intronic
1047104745 8:121720219-121720241 GTGGGGAGAGGCCAGGCAGTGGG + Intergenic
1047327918 8:123857775-123857797 GAGGAGAGAGGGCAGTGGAAGGG - Intronic
1048147789 8:131862506-131862528 AGGGAGAGAGTCCAGGCCAAGGG - Intergenic
1048468009 8:134683627-134683649 GTGGAAAGAGGACAGGTTAAAGG + Intronic
1049552395 8:143266676-143266698 GTGCAGAGAGCCGAGGCGAGGGG - Intronic
1049846162 8:144802825-144802847 GTGGAAAGAGCCCAGGCCTAAGG - Intronic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1053076560 9:35139098-35139120 GGGGAGAGAGGCCAGGAAATGGG - Intergenic
1053603293 9:39631987-39632009 GAGGTGAGAGGCCAGTCGAAGGG - Intergenic
1054250245 9:62710438-62710460 GAGGTGAGAGGCCAGTCGAAGGG + Intergenic
1054458734 9:65450514-65450536 GTGCAGAGAGGCCTGGGGAGAGG - Intergenic
1054564353 9:66744966-66744988 GAGGTGAGAGGCCAGTCGAAGGG + Intergenic
1056462092 9:86818228-86818250 GTGGAGAGAGGCCAGGCAGTAGG - Intergenic
1056821348 9:89844223-89844245 GTGGAGGGAGGCCAGGCTGAGGG + Intergenic
1056974033 9:91234144-91234166 GTGGAGAGAGGGGTGGCCAAAGG - Intronic
1057408403 9:94794356-94794378 GTGGAGAAAGCCCAGGGTAATGG + Intronic
1058876908 9:109252421-109252443 TTCGAGAGAGGCCAGGGGATGGG - Intronic
1059650341 9:116310276-116310298 GTGGAAGGAGGAAAGGCGAAGGG + Intronic
1060265516 9:122109541-122109563 GTGGAGGCAGCCCAGGAGAATGG - Intergenic
1060851575 9:126881070-126881092 GGGGAGGGAGGGCAGGGGAAAGG - Exonic
1060983269 9:127805781-127805803 GTGGAGAGTGGCCAAGCAGAAGG - Intronic
1061079385 9:128361036-128361058 GTGGGGAGAGGCCAGGGGCGTGG - Exonic
1061882226 9:133574168-133574190 GGGGAGAGAGGGAAGGGGAATGG + Intronic
1062720635 9:138041491-138041513 TTGGAGAAAGGCTAGGAGAAAGG - Intronic
1203691638 Un_GL000214v1:47961-47983 GTGGAGAGACGCCAGGTGGTGGG + Intergenic
1203644657 Un_KI270751v1:56230-56252 GTGGAGAGACGCCAGGTGGTGGG - Intergenic
1185691480 X:2158750-2158772 GTGGAGAGTGGCCATGGGATGGG - Intergenic
1186223734 X:7375703-7375725 GTGGGGAGAGGCCAGGCAGTTGG + Intergenic
1187413489 X:19071584-19071606 GTGGTGAGAAGTCAGGAGAAGGG + Intronic
1187454140 X:19426455-19426477 GTGGTGGGAGGCGAGGGGAATGG - Intronic
1188756425 X:33969079-33969101 GTGGAGAGAGGCCAGGCAGCAGG - Intergenic
1188859954 X:35244463-35244485 GTGGAGAGAAGCCAGGCAGTGGG + Intergenic
1189360138 X:40343785-40343807 GTGGAGAGAGGCCAGGCAGTGGG - Intergenic
1190417957 X:50199765-50199787 GGGGAGAGAGGGGAGGGGAAGGG - Intronic
1192547859 X:72028524-72028546 GGGGAAGGAGGCCAGGCGGAAGG - Intergenic
1196820768 X:119698541-119698563 AAGGAGAAGGGCCAGGCGAAGGG - Intergenic
1197035565 X:121870096-121870118 GTGGAGAGAGGCCAGGCAGCAGG - Intergenic
1197102325 X:122670996-122671018 TTGGAGATAGTCCAGGTGAAGGG - Intergenic
1198189399 X:134287739-134287761 GTGGGGAGAGGCCAGGCAGTGGG - Intergenic
1199092247 X:143705641-143705663 GTGGGGAGAGGCCAAGCAACAGG - Intergenic
1201593239 Y:15637950-15637972 GTGGTGAGAGGCCAGGCAGTTGG + Intergenic
1201720302 Y:17089604-17089626 GTGGAAAGAGGCCAGGCAGTGGG - Intergenic