ID: 1019371517

View in Genome Browser
Species Human (GRCh38)
Location 7:664357-664379
Sequence CATGAACACAGCCTCTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019371512_1019371517 10 Left 1019371512 7:664324-664346 CCAGTGCTGCACCAGGGCTTAGC 0: 1
1: 0
2: 0
3: 19
4: 139
Right 1019371517 7:664357-664379 CATGAACACAGCCTCTGCCCTGG No data
1019371514_1019371517 -1 Left 1019371514 7:664335-664357 CCAGGGCTTAGCCTCAGGCCTGC 0: 1
1: 0
2: 6
3: 39
4: 353
Right 1019371517 7:664357-664379 CATGAACACAGCCTCTGCCCTGG No data
1019371507_1019371517 29 Left 1019371507 7:664305-664327 CCCCGACACAGCACAGTGGCCAG 0: 1
1: 0
2: 2
3: 17
4: 205
Right 1019371517 7:664357-664379 CATGAACACAGCCTCTGCCCTGG No data
1019371508_1019371517 28 Left 1019371508 7:664306-664328 CCCGACACAGCACAGTGGCCAGT 0: 1
1: 0
2: 1
3: 15
4: 206
Right 1019371517 7:664357-664379 CATGAACACAGCCTCTGCCCTGG No data
1019371509_1019371517 27 Left 1019371509 7:664307-664329 CCGACACAGCACAGTGGCCAGTG 0: 1
1: 0
2: 1
3: 27
4: 223
Right 1019371517 7:664357-664379 CATGAACACAGCCTCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019371517 Original CRISPR CATGAACACAGCCTCTGCCC TGG Intronic
No off target data available for this crispr