ID: 1019371923

View in Genome Browser
Species Human (GRCh38)
Location 7:666533-666555
Sequence AGGTGCCGTCCCAGGGGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 99}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019371913_1019371923 17 Left 1019371913 7:666493-666515 CCTGCCCTGGGAGCTACTCAACT 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1019371923 7:666533-666555 AGGTGCCGTCCCAGGGGATAAGG 0: 1
1: 0
2: 0
3: 4
4: 99
1019371915_1019371923 12 Left 1019371915 7:666498-666520 CCTGGGAGCTACTCAACTCTGCA 0: 1
1: 0
2: 1
3: 17
4: 113
Right 1019371923 7:666533-666555 AGGTGCCGTCCCAGGGGATAAGG 0: 1
1: 0
2: 0
3: 4
4: 99
1019371911_1019371923 25 Left 1019371911 7:666485-666507 CCCTGGGGCCTGCCCTGGGAGCT 0: 1
1: 0
2: 7
3: 62
4: 467
Right 1019371923 7:666533-666555 AGGTGCCGTCCCAGGGGATAAGG 0: 1
1: 0
2: 0
3: 4
4: 99
1019371912_1019371923 24 Left 1019371912 7:666486-666508 CCTGGGGCCTGCCCTGGGAGCTA 0: 1
1: 0
2: 2
3: 29
4: 317
Right 1019371923 7:666533-666555 AGGTGCCGTCCCAGGGGATAAGG 0: 1
1: 0
2: 0
3: 4
4: 99
1019371910_1019371923 28 Left 1019371910 7:666482-666504 CCACCCTGGGGCCTGCCCTGGGA 0: 1
1: 0
2: 10
3: 78
4: 606
Right 1019371923 7:666533-666555 AGGTGCCGTCCCAGGGGATAAGG 0: 1
1: 0
2: 0
3: 4
4: 99
1019371914_1019371923 13 Left 1019371914 7:666497-666519 CCCTGGGAGCTACTCAACTCTGC 0: 1
1: 1
2: 6
3: 36
4: 200
Right 1019371923 7:666533-666555 AGGTGCCGTCCCAGGGGATAAGG 0: 1
1: 0
2: 0
3: 4
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019371923 Original CRISPR AGGTGCCGTCCCAGGGGATA AGG Intronic
900476060 1:2876914-2876936 AGGGGCCGTCCCAGGGGTGCTGG + Intergenic
900634321 1:3654584-3654606 AGGTGCCGTCCGAAGGGCTTGGG + Intronic
902810175 1:18883564-18883586 AGGTCCCATCCCAGGGGCTGAGG + Intronic
903299749 1:22370266-22370288 AGGAGCTGTCCCAGGTGTTAGGG + Intergenic
903929629 1:26854895-26854917 AGGGGGCAGCCCAGGGGATATGG - Exonic
904247192 1:29196119-29196141 AGCTGTCGTGCCAGGGGATGTGG + Intronic
915167197 1:153954711-153954733 AGGTGCTGACGCAGGGGCTATGG + Intronic
916071308 1:161171687-161171709 TGGTGCCGTGCTAGGGGGTAGGG - Exonic
918311966 1:183291393-183291415 AGGTGCGCTCCCAGGGCACAGGG - Intronic
921160179 1:212466907-212466929 AGGTGTCTTCCCAGGGGAAGTGG + Intergenic
922695994 1:227731381-227731403 ACGTGCCGTCCCTGTGGATTCGG + Exonic
923416067 1:233761687-233761709 AAATGGCTTCCCAGGGGATAGGG - Intergenic
1076175088 10:128362284-128362306 ATGAGCCTTCTCAGGGGATATGG - Intergenic
1076547770 10:131257289-131257311 TGCTGCCCTCCCAGGGGATGGGG - Intronic
1076584387 10:131535214-131535236 AGGTGTGGTCCCAGGGGAGCCGG + Intergenic
1076778950 10:132713574-132713596 AGGGGCGGTCAGAGGGGATAAGG - Intronic
1077273606 11:1693295-1693317 AGCTGCCGACCCCGGGGCTAGGG + Intergenic
1079158196 11:17968379-17968401 AGGTGCTGTCCTAGGTGCTAGGG + Intronic
1081669986 11:44937411-44937433 AGCTGCCATCCCTGGGGATCTGG - Intronic
1083143125 11:60737984-60738006 ATTTGACTTCCCAGGGGATATGG - Intronic
1083587988 11:63874213-63874235 AGGTGCAGTTCCAGGGCAGAGGG - Intronic
1084180251 11:67442511-67442533 AGGTGCTGTCCCAGGTAACACGG + Exonic
1090251746 11:125256418-125256440 AGGTGCCTGCCCAGGGTTTAGGG - Intronic
1090733247 11:129589937-129589959 AGCTGTGGTCCCAGGGGATAAGG + Intergenic
1091918251 12:4284457-4284479 AGAGGCCGTCCCAGGGCCTAGGG - Intronic
1096954921 12:55516432-55516454 AGATGCCCTCCTGGGGGATAGGG + Intergenic
1098747892 12:74263988-74264010 AGGTGCCACCCCAGGGGGTCTGG - Intergenic
1101128600 12:101665610-101665632 AGATGGTGTCCCAGGGGATGAGG - Intronic
1104860348 12:131920189-131920211 AGGTCCCGTCCCAGTGGAGACGG - Intronic
1106603790 13:31209143-31209165 AGGTGCTGTCCCATGGTAGATGG + Intronic
1111976124 13:94968403-94968425 TGCTGCCGTCCCCGGGGAAAGGG + Intergenic
1118013150 14:61630537-61630559 AGGTGCTGTGCTAGGGGATGGGG - Intronic
1119300297 14:73566470-73566492 AGCTGCCTTCCCACGGGAAAGGG - Intergenic
1119388675 14:74275619-74275641 TGGTGCTGTCCCAGGGGACCTGG - Intergenic
1119690106 14:76664957-76664979 AGGTGTCTTCCCAAGGGAAAAGG + Intergenic
1122273157 14:100577463-100577485 AGCTGCAGCCCCAGGGGAGAAGG - Intronic
1122289823 14:100674583-100674605 TGGTCCCGTCCCAGTGGAGAAGG + Intergenic
1123024155 14:105416061-105416083 AAATGCCCTGCCAGGGGATATGG - Intronic
1123827810 15:24101270-24101292 AGGAGCCTCCCCAGGGGACAGGG - Intergenic
1123842266 15:24260681-24260703 AGGAGCCTCCCCAGGGGACAGGG - Intergenic
1123857293 15:24426743-24426765 AGGAGCCTCCCCAGGGGACAGGG - Intergenic
1129236357 15:74225946-74225968 AGGCCCCGTCCCAGGGAAGATGG + Intergenic
1130507466 15:84558705-84558727 ACGTCCCTTCCCAGAGGATAGGG + Intergenic
1132427800 15:101734098-101734120 ATGTCCCTTCCCAGAGGATAGGG + Intergenic
1132550372 16:551539-551561 AGCTGCCGTTCCAGGAGAAACGG - Exonic
1137734141 16:50711678-50711700 AGGTGTCGTGCCAGGGAGTACGG + Exonic
1137752714 16:50878972-50878994 AGGTGAGTGCCCAGGGGATATGG - Intergenic
1138009181 16:53361977-53361999 AGGTGGGGTCCCAGGGGATGGGG + Intergenic
1141789694 16:86226235-86226257 AGGTGTCTTCCCAGGGCACATGG + Intergenic
1143140202 17:4738308-4738330 ATGTGCGGCCCCAGGGGAAAAGG + Intronic
1147948206 17:44092375-44092397 AGGTGCCGGGCCTGGGGGTAAGG - Exonic
1148346805 17:46908692-46908714 AGGTGCTGACCCTGGGGATGTGG - Intergenic
1154492169 18:14930715-14930737 AGGAGCCATCCTAGTGGATAGGG - Intergenic
1156046524 18:32883660-32883682 AGGTTTTGTCCCAGGAGATAAGG - Intergenic
1158295134 18:55988313-55988335 GGGTGCTGTCCCAGGGAATGGGG - Intergenic
1160107925 18:75995308-75995330 AGGTGACTTCCCAGGTGGTAAGG - Intergenic
1167339723 19:48907971-48907993 AGGTGACATTCCAGGGGAGATGG - Intronic
1167344703 19:48937929-48937951 AGGTGACATTCCAGGGGAGACGG - Intronic
1167528335 19:49999572-49999594 AGCTGCCTTCCCAGTGGATGGGG + Intronic
926558259 2:14385980-14386002 AGGTGCAGACCCTGAGGATATGG + Intergenic
929167738 2:38900669-38900691 AGGAGCAGTCCCATAGGATATGG + Intronic
932237975 2:70136302-70136324 AGGTTGTGTCCCAGGAGATAAGG - Intergenic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
933367348 2:81370087-81370109 AGGTGTTTTCCCAGGGAATAGGG - Intergenic
936059352 2:109284156-109284178 AGGGGCGGTCCCAGGGGAAGGGG + Intronic
940784591 2:157968051-157968073 AGCTGCCTTCCCACGGGACAGGG - Intronic
946360355 2:219215976-219215998 AGGTGCCGCCCCAGTGGAAAGGG - Exonic
949031352 2:241798898-241798920 GGGTGCCGGCCCATGGGCTAGGG - Intronic
1173672803 20:44810060-44810082 GGGCGCCTTCCCAGGGGATTGGG + Intronic
1175068376 20:56310238-56310260 AGGTGCATTTCCAGGGGATGTGG - Intergenic
1175389437 20:58617189-58617211 AGGTGCATTCCCAGGAGAAATGG - Intergenic
1175714511 20:61246621-61246643 AGATGCTGTCCCAGGTGCTAGGG + Intergenic
1176110148 20:63407406-63407428 AGGGCCCGTCCCAGGAGATGTGG + Intronic
1182353706 22:29712772-29712794 AGGTGCCTTCCTAGGGGGTGGGG - Intergenic
1183362381 22:37389455-37389477 AGGTCTCGGCCCAGGGGATGGGG - Intronic
949877928 3:8638816-8638838 GGGGGCCATCCCAGGGGACAGGG - Intronic
950929416 3:16773940-16773962 AGCTGCCTTCCCATGGGACAGGG + Intergenic
960864134 3:122183589-122183611 AGGCACCGTGCCAGGGGCTAGGG + Intergenic
961011225 3:123437415-123437437 AGGTACATGCCCAGGGGATATGG + Intronic
969056875 4:4407759-4407781 AGGTGTCGTCCCATGTCATAGGG + Intronic
969467573 4:7366682-7366704 AGGTGCCGGGGCAGGGGACATGG - Intronic
972676382 4:41263796-41263818 AGATGCAGTCTCTGGGGATAGGG - Intronic
977724877 4:100284473-100284495 AGGTGCAGTCTCAGGGAATGGGG - Intergenic
981749661 4:148081859-148081881 AGGGGCCTTCCCAGGGTGTAAGG + Intronic
983780743 4:171667197-171667219 TGGTGCCACCCAAGGGGATAAGG + Intergenic
1007769493 6:44181194-44181216 AGAAGGCATCCCAGGGGATAGGG - Intronic
1011870065 6:91882029-91882051 AGCTGCCTTCCCAGGGGGCAGGG - Intergenic
1019371923 7:666533-666555 AGGTGCCGTCCCAGGGGATAAGG + Intronic
1019466859 7:1194474-1194496 AGGTGCCGTGCTAGGGTACAGGG + Intergenic
1019550578 7:1600210-1600232 AGGAGCCGTCCCCGTGCATAGGG + Intergenic
1027144094 7:75681908-75681930 AGGTGCCAGTCCAGGGGAGATGG - Intronic
1030141297 7:106306710-106306732 AAGTGCCGTGCAAGGGGCTAGGG + Intergenic
1032566704 7:132954249-132954271 AGGTGCTGTGTCAGGAGATAGGG - Intronic
1035818054 8:2562093-2562115 AGGAGCCGTCGCAGGCGAGAAGG - Intergenic
1036619658 8:10416094-10416116 AGGTGCCGTGCCAGGTGCTGGGG - Intronic
1037656366 8:20887653-20887675 AGGTCCCTTCTCAGGGGACATGG - Intergenic
1039560657 8:38510138-38510160 AGCCGCAGTCTCAGGGGATAAGG - Intergenic
1048770061 8:137885665-137885687 AGATCCCGTCGCAGGTGATAGGG - Intergenic
1056453611 9:86739727-86739749 AGGCGCTGTCCTAGGGGATTAGG + Intergenic
1058452978 9:105114234-105114256 AGGTTCTGTCCCAGGGAAAAGGG + Intergenic
1186191993 X:7075554-7075576 AGGTGCCCTCCCTGGAGATGAGG - Intronic
1186475807 X:9856883-9856905 ATGTGCGGTCCCAGCGGATGGGG - Intronic
1188168514 X:26892517-26892539 ATGTGCCATCCCAGGGCATGAGG + Intergenic
1198100000 X:133415174-133415196 AGGCGCCGGGCCAGGGGAGAAGG + Exonic