ID: 1019373277

View in Genome Browser
Species Human (GRCh38)
Location 7:674810-674832
Sequence GGTGCCCAGTTACCCCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019373277_1019373285 19 Left 1019373277 7:674810-674832 CCTGCTTGGGGTAACTGGGCACC 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1019373285 7:674852-674874 CCTGAACCAGCCACATGCTCTGG 0: 1
1: 0
2: 1
3: 21
4: 167
1019373277_1019373289 30 Left 1019373277 7:674810-674832 CCTGCTTGGGGTAACTGGGCACC 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1019373289 7:674863-674885 CACATGCTCTGGATAAGATAGGG No data
1019373277_1019373288 29 Left 1019373277 7:674810-674832 CCTGCTTGGGGTAACTGGGCACC 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1019373288 7:674862-674884 CCACATGCTCTGGATAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019373277 Original CRISPR GGTGCCCAGTTACCCCAAGC AGG (reversed) Intronic
901435487 1:9245021-9245043 GGTCCCCAGTTGCTCCCAGCAGG - Exonic
901680647 1:10910766-10910788 GGTGCCAAGGGACACCAAGCAGG + Intergenic
903853186 1:26320531-26320553 GATGTCCAGTAACCACAAGCAGG - Intergenic
912278059 1:108281518-108281540 GGCTCCCAGTGACCCCAACCAGG - Intergenic
912290167 1:108412839-108412861 GGCTCCCAGTGACCCCAACCAGG + Intronic
912996887 1:114539358-114539380 GTTGCCCAGTTATGCCCAGCTGG + Intergenic
915128105 1:153679582-153679604 GGGGCCCAGCTACGCCAAGCTGG + Exonic
915528806 1:156491647-156491669 GCTGCTCAGTAACCACAAGCAGG - Intronic
922902531 1:229147926-229147948 GGTGCACACTTGCCCCAGGCCGG - Intergenic
923631010 1:235649649-235649671 GGCGCCCACTTACCCGGAGCGGG + Exonic
1076834267 10:133013152-133013174 GGTGCCCAGCAACCCCAGGCAGG - Intergenic
1076914985 10:133418942-133418964 GGTGCCTAGTCAGCCCATGCTGG + Intronic
1077539705 11:3140752-3140774 GGTACCCACATACCCCAAGGAGG - Intronic
1077841757 11:5982899-5982921 GGTGCTCAGCAACCCCATGCAGG + Intergenic
1085731259 11:79001358-79001380 GGTGCTCAGTAGCCCCATGCAGG - Intronic
1085787580 11:79468679-79468701 TGTTCTCAGTTACCACAAGCTGG + Intergenic
1089094312 11:115906185-115906207 GCTGCCCAGCTCCCCCAAACTGG + Intergenic
1089570183 11:119402652-119402674 GGTCCCCAAGTACCCCCAGCTGG + Intergenic
1096111763 12:49033184-49033206 GGTGCTCAGTTCCCCCCAGCTGG - Exonic
1101089446 12:101270212-101270234 GATGGGCAGGTACCCCAAGCTGG - Intergenic
1105417697 13:20227548-20227570 GGTGCTCAGTGACCCTGAGCTGG + Intronic
1118473451 14:66095323-66095345 TGTGCTCAGACACCCCAAGCAGG - Intergenic
1119110637 14:71970762-71970784 GTTCCCCATTTACCCCCAGCTGG - Intronic
1121558127 14:94854004-94854026 GATGCCCAGGTAACCCCAGCTGG + Intergenic
1122290807 14:100679517-100679539 GGGCCTCAGTTTCCCCAAGCTGG - Intergenic
1123716153 15:23034034-23034056 AGAGCTCAGTTACCACAAGCTGG - Intronic
1124654605 15:31498201-31498223 GGTGCCCAGTTACACAGAGAGGG - Intronic
1129016869 15:72475470-72475492 GGTGTACAGTTGCCCCAAGTGGG + Intronic
1131076518 15:89498725-89498747 GATACCCTGGTACCCCAAGCTGG - Intergenic
1137334782 16:47537428-47537450 GGGGCCCAGTTTCCCTGAGCTGG - Intronic
1138431728 16:56973182-56973204 TGTACCCAGTTTCCCCCAGCGGG - Intronic
1143924218 17:10355599-10355621 GGTGCCCAGTGCTCCCAAGCTGG + Intronic
1144660329 17:17063909-17063931 GTTGCCCAACTGCCCCAAGCGGG - Intronic
1146106203 17:30039567-30039589 GGTACCAAGATACCCCAAGTTGG + Intronic
1148152532 17:45405052-45405074 GCTGACCAGTTACCCCGAGGAGG - Exonic
1152091699 17:78250952-78250974 GGGGCCCAGTGCCCCCCAGCTGG - Intergenic
1160832455 19:1110140-1110162 GGTGCTGGGTGACCCCAAGCAGG + Intronic
1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG + Intronic
1168652167 19:58098176-58098198 GCTGCGCAGCTACCCCAGGCCGG + Intronic
925059458 2:879892-879914 TGTGGCCAGTTACCCAAAACAGG - Intergenic
926313889 2:11695622-11695644 GGGGCCCAGCTACCCTAAGCTGG - Intronic
926897478 2:17710109-17710131 GGTGCCAAGTAACCAGAAGCAGG + Intronic
936280457 2:111135677-111135699 GGTGCCCAGACACCCAAGGCTGG + Intronic
937012074 2:118571965-118571987 GCTGCCAATTCACCCCAAGCAGG + Intergenic
1169253947 20:4083190-4083212 GGTGCTCCGTTACCACCAGCTGG + Intergenic
1172025149 20:31943355-31943377 GGTGCCCAGTGACTCCAAGTAGG - Exonic
1172696858 20:36828948-36828970 GCTGCCCATTTCCCACAAGCGGG + Intronic
1173463197 20:43260477-43260499 GGTGGCCTGGTACCCCAAGATGG - Intergenic
1173553517 20:43949497-43949519 GGTGCCCAGCTCCCCCAGGTGGG - Intronic
1174008754 20:47431788-47431810 GGTGCCCAGCTTGCCCAGGCTGG + Intergenic
1175109233 20:56634869-56634891 GGGGCCCCTTTACCCCAACCTGG + Intronic
1175239191 20:57534076-57534098 GTTGCTCAGACACCCCAAGCTGG + Intergenic
1175775599 20:61651594-61651616 GTTGCCCTGTTACCTCAGGCAGG + Intronic
1178247937 21:30972238-30972260 GGTTCCCAGCTCCCCCAAGATGG + Intergenic
1178680542 21:34669662-34669684 GGTGCCGAGGTGCCCCAAGGAGG + Exonic
1180142936 21:45903276-45903298 CGTGGCCAGTTGCCCCATGCAGG + Intronic
1181039140 22:20183779-20183801 TGTGCCCAGGTGCCCCAGGCAGG - Intergenic
1181498290 22:23300725-23300747 GGTGCCCACATAACCCAGGCTGG + Intronic
1185344672 22:50306072-50306094 CGTGTCCAGTCACCCGAAGCGGG - Intronic
953023889 3:39133884-39133906 GGTGCCCTGTATCCCCATGCAGG - Intronic
953246571 3:41199308-41199330 GGTGCCCAGGCACCCCACCCCGG + Intronic
958048599 3:88317448-88317470 GCTGCCCAGTGACACCAAACTGG + Intergenic
964723553 3:159791484-159791506 GGTTGCCAGATGCCCCAAGCAGG - Intronic
965329334 3:167351488-167351510 AGGTCCCAGTGACCCCAAGCAGG - Intronic
968558733 4:1264975-1264997 GGGGCCCAGTCAACCCAAGCCGG + Intergenic
968967701 4:3777386-3777408 GGGGCCCAGTGAGACCAAGCAGG - Intergenic
969595589 4:8147809-8147831 GGTCACCAGTGACCACAAGCTGG - Intronic
971995221 4:33955789-33955811 GTGGCCCTGTTACTCCAAGCAGG + Intergenic
975591223 4:76001936-76001958 GGTGCCCAGTTAGCCTCTGCAGG - Exonic
980862964 4:138521637-138521659 GGTGTTCAGGTACCCCATGCAGG - Intergenic
982331595 4:154187154-154187176 TGTGCCCAGTAACACCATGCAGG + Intergenic
993799754 5:92318454-92318476 GGTGAGCAGTTTCCCCATGCTGG + Intergenic
996265480 5:121534691-121534713 GGTGCTCACTAACCCCATGCAGG - Intergenic
999783015 5:154866116-154866138 GATGCCCAGTTAAACAAAGCAGG - Intronic
1000992471 5:167925091-167925113 GCTTCTCAGTAACCCCAAGCTGG + Intronic
1003802884 6:9691224-9691246 CATGCTTAGTTACCCCAAGCAGG - Intronic
1005670883 6:28105028-28105050 GGAGCCCAGCTCCCCCACGCGGG + Intergenic
1008005102 6:46402191-46402213 AGTGCCCAGTGACTCCATGCCGG - Intronic
1009702283 6:67200617-67200639 GGCTCCCAGCAACCCCAAGCTGG - Intergenic
1014671799 6:124313720-124313742 GGTGGCCGGTTTCCCCATGCTGG + Intronic
1018170796 6:161141520-161141542 GGTGCCCTGTGGCCCCAACCTGG - Intronic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1020715686 7:11673147-11673169 GGTGCTCAGTGACTCCAGGCAGG - Intronic
1021531126 7:21646636-21646658 GGTGCCCAGTGAGCTCCAGCAGG + Intronic
1022179855 7:27908668-27908690 GGGGCCCAGTTTACCTAAGCTGG + Intronic
1023884627 7:44344560-44344582 GATACTCAGTAACCCCAAGCAGG - Intergenic
1034280479 7:149850487-149850509 AAAGCACAGTTACCCCAAGCAGG - Intronic
1036604844 8:10295692-10295714 GGTGCCAAGTGACCACAGGCTGG - Intronic
1038292650 8:26263718-26263740 GGGGCCCAGTTTCCCCATGCTGG + Intergenic
1048162162 8:132031566-132031588 ACTGCCCAGCTACCCCAAGAGGG - Intronic
1049619954 8:143593580-143593602 GGTGCCCAGTTCCTCCCTGCAGG - Intronic
1049696966 8:143989000-143989022 GGTTTCAAGTTACCCCCAGCTGG - Intronic
1056816467 9:89804995-89805017 GGTGCCCTGGTAGCCGAAGCTGG + Intergenic
1057958560 9:99432989-99433011 GGTGCCCAGTCACCCAACCCAGG + Intergenic
1061178972 9:129013021-129013043 TGAGCCAAGTTACCCAAAGCAGG + Intronic
1062400832 9:136371916-136371938 GGTGCTCAGCGACCCCAACCTGG - Exonic
1190912621 X:54786879-54786901 GGTGCCCAGTGAGCCCCAGCGGG + Intronic
1190918342 X:54826525-54826547 GGTGCTCAGTGAGCCCCAGCGGG - Intergenic
1192919333 X:75689951-75689973 TGTGCTCAGTAACCCCATGCAGG - Intergenic
1193470264 X:81892597-81892619 GGTGCTTATTTACCCCAAGGTGG + Intergenic
1197730587 X:129806031-129806053 TGAGACCAGTGACCCCAAGCAGG + Exonic