ID: 1019373285

View in Genome Browser
Species Human (GRCh38)
Location 7:674852-674874
Sequence CCTGAACCAGCCACATGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019373279_1019373285 -2 Left 1019373279 7:674831-674853 CCCTGGACCCAAAGTATCCAGCC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 1019373285 7:674852-674874 CCTGAACCAGCCACATGCTCTGG 0: 1
1: 0
2: 1
3: 21
4: 167
1019373280_1019373285 -3 Left 1019373280 7:674832-674854 CCTGGACCCAAAGTATCCAGCCT 0: 1
1: 0
2: 1
3: 14
4: 208
Right 1019373285 7:674852-674874 CCTGAACCAGCCACATGCTCTGG 0: 1
1: 0
2: 1
3: 21
4: 167
1019373281_1019373285 -9 Left 1019373281 7:674838-674860 CCCAAAGTATCCAGCCTGAACCA 0: 1
1: 0
2: 2
3: 10
4: 106
Right 1019373285 7:674852-674874 CCTGAACCAGCCACATGCTCTGG 0: 1
1: 0
2: 1
3: 21
4: 167
1019373277_1019373285 19 Left 1019373277 7:674810-674832 CCTGCTTGGGGTAACTGGGCACC 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1019373285 7:674852-674874 CCTGAACCAGCCACATGCTCTGG 0: 1
1: 0
2: 1
3: 21
4: 167
1019373282_1019373285 -10 Left 1019373282 7:674839-674861 CCAAAGTATCCAGCCTGAACCAG 0: 1
1: 0
2: 1
3: 8
4: 146
Right 1019373285 7:674852-674874 CCTGAACCAGCCACATGCTCTGG 0: 1
1: 0
2: 1
3: 21
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019373285 Original CRISPR CCTGAACCAGCCACATGCTC TGG Intronic
901451672 1:9339868-9339890 CCTGAACCAGCCACATCTAGAGG - Intronic
902633359 1:17719025-17719047 CCAGAAGCAGCCACAGGCTCAGG - Intergenic
904093048 1:27958499-27958521 CCTGAGCCAGGCGAATGCTCAGG + Exonic
906200713 1:43958466-43958488 CCTGCATCAGCCACATGCACTGG - Exonic
906519568 1:46459096-46459118 CCTGCATCAGCCACCAGCTCTGG - Intergenic
906671558 1:47658688-47658710 CCTGACCCTAGCACATGCTCAGG + Intergenic
907770645 1:57460172-57460194 CCTGAATGAGCTACATCCTCTGG - Intronic
908596529 1:65694184-65694206 TCTGTGCCAGCAACATGCTCTGG + Intergenic
910868512 1:91809932-91809954 CCTGTAACTGCCACAAGCTCTGG - Intronic
911345411 1:96691108-96691130 CCAGCAGCAGCCACACGCTCAGG + Intergenic
913181297 1:116324726-116324748 CCTGAACCACCATCACGCTCTGG + Intergenic
913496855 1:119435288-119435310 ACTGAATCATCTACATGCTCAGG - Intergenic
915044253 1:152998772-152998794 CCTGAGCCAGCCTCATGCCTGGG + Intergenic
923042305 1:230327869-230327891 CCTGCACGGGCCACATGCTGTGG - Intronic
923136554 1:231125032-231125054 GCTGAACCTGACACCTGCTCTGG - Intergenic
923783411 1:237044801-237044823 TCTGAACCACCAACATTCTCAGG - Intronic
924038360 1:239958252-239958274 CCTGCACCAGCCACCAGCCCTGG + Intergenic
1066482055 10:35806200-35806222 CCTGAAGCAGGCCCATGGTCTGG - Intergenic
1067219140 10:44330121-44330143 CCAGAACCAGCCAGATTCCCAGG + Intergenic
1074407572 10:113192329-113192351 CCTAAACCAGCCCCAGGGTCAGG + Intergenic
1075261837 10:120970123-120970145 ACTGAAGTAGCCACAAGCTCAGG + Intergenic
1075506539 10:123027830-123027852 CCTGATCCAGCCCCAAGCTCAGG - Intronic
1076724755 10:132408131-132408153 CCGGGACCAGCCCCCTGCTCTGG + Intronic
1076784909 10:132745030-132745052 CCTGAGCCAGCCACTGGCTCGGG - Intronic
1076813090 10:132899235-132899257 CCTGAGCAAGCCACATGCCCAGG - Intronic
1079075870 11:17385270-17385292 GCTGAATCAGCTACATGCTGAGG - Intergenic
1079241947 11:18727702-18727724 CCTGGCCCTGACACATGCTCTGG - Intergenic
1080958067 11:37124546-37124568 CCTGAGTCAGCAACATGCTGAGG - Intergenic
1081881669 11:46458110-46458132 CCAGAACCAGGCATATGCTGTGG + Intronic
1084597171 11:70123744-70123766 CATTAACCACCCACATGCGCGGG + Intronic
1085404416 11:76253451-76253473 GCTGATCCAGCCACCTTCTCTGG - Intergenic
1085521805 11:77143538-77143560 CGTGAACCAGCCACCTTCTCCGG - Intronic
1089554765 11:119310306-119310328 CCAGAGCCTGCCACATCCTCAGG - Intronic
1089601551 11:119618523-119618545 CCTGAACCAGTCACATCTTCTGG - Intergenic
1090922686 11:131220696-131220718 CATGATCAAGCCTCATGCTCAGG + Intergenic
1092284863 12:7122887-7122909 ACTGATCCTACCACATGCTCTGG - Intergenic
1094141824 12:27189250-27189272 CCTGAAGCAGGAGCATGCTCAGG - Intergenic
1096497681 12:52047828-52047850 GTTGAACCAGCCTCAAGCTCAGG - Intronic
1103699478 12:122841406-122841428 CCTGCACCAGCCACCTACCCTGG + Intronic
1104297684 12:127532234-127532256 CCTGAACCACACGCATCCTCCGG + Intergenic
1104481040 12:129108551-129108573 CCTGAGCCAGCCACAGCCTTTGG - Intronic
1104815331 12:131642375-131642397 CCTGAGCCAATCACGTGCTCTGG - Intergenic
1110257289 13:73445809-73445831 CCAGAAGCAGCAACCTGCTCGGG - Intergenic
1116500992 14:45621758-45621780 GCTGACCCAGGCAGATGCTCAGG - Intergenic
1121485153 14:94309071-94309093 CCTGCACCAGCCCCTTGCTTGGG + Intronic
1121618838 14:95332266-95332288 CCTGAGCCGGGCAGATGCTCAGG + Intergenic
1123198386 14:106638989-106639011 CCTGACCCGGCCTCATGCTCTGG + Intergenic
1125573266 15:40737424-40737446 ACTGAATCAGCCACATGGTTGGG - Intronic
1125719536 15:41838738-41838760 CCTGAACCAGCCACCTGTCCAGG - Exonic
1125726545 15:41871202-41871224 GCTGAGCCCGCCACAGGCTCTGG - Intronic
1126709906 15:51443824-51443846 CCTGCAGCAGCCCCAGGCTCTGG - Intergenic
1131443140 15:92473877-92473899 GCAGAACCAGCGACAGGCTCAGG + Intronic
1131710304 15:95047030-95047052 CCAGCAGCAGCAACATGCTCTGG - Intergenic
1132734908 16:1380468-1380490 CCTGCACTAGCCACAGGCACTGG - Intronic
1133103081 16:3490930-3490952 CCTGCACCAGCCACCAGCTGCGG - Intergenic
1133142956 16:3761605-3761627 TCTGAAGCAGCCACGTGCCCTGG - Intronic
1136630134 16:31485145-31485167 CCTGCACCAGCCACTGCCTCTGG + Intronic
1139359922 16:66391195-66391217 TCTGAACCAGCCCCATGCTGGGG + Intronic
1139514563 16:67445603-67445625 CCTGACCCAGCCTCCTGTTCAGG - Intronic
1140758507 16:78090210-78090232 CATGAACCAGCCACACACCCTGG - Intergenic
1141855254 16:86676862-86676884 CCTGGACCAGCCATATTCTCAGG + Intergenic
1141884209 16:86880633-86880655 CCTGCACCGGCCTCATGCTCAGG + Intergenic
1142672259 17:1492632-1492654 GCTGGACCAGCCACATCCCCTGG - Exonic
1143560137 17:7688811-7688833 GCTGAGCCAGCCACAGGATCTGG - Exonic
1146065644 17:29632651-29632673 CCTGAACTAGCCAAAGACTCAGG - Exonic
1146968571 17:37054078-37054100 CCTGTACCACCCAGCTGCTCAGG + Intronic
1147493996 17:40898338-40898360 CCTGACCTAGCCTCAAGCTCAGG + Intergenic
1148772719 17:50076439-50076461 CCTCAACCAGGCACAGGCTCTGG + Exonic
1151736159 17:75941622-75941644 CATGATCCATTCACATGCTCTGG + Exonic
1151947005 17:77325331-77325353 GCTGGTCCAGCCTCATGCTCTGG + Intronic
1155204226 18:23543783-23543805 GCTGAGCCAGCCACATTATCAGG + Intronic
1156352531 18:36313154-36313176 CCCTATCTAGCCACATGCTCTGG + Intronic
1157610273 18:48951396-48951418 CCTAAACCACCCAGATGCGCAGG - Intergenic
1158273350 18:55740268-55740290 CCTGAACCAGCTTCAGGCTGTGG - Intergenic
1160554406 18:79716646-79716668 CCTGGCCCAGCTCCATGCTCAGG - Intronic
1160558507 18:79741240-79741262 CCTCACCCAACCACAGGCTCAGG - Intronic
1162131528 19:8529037-8529059 CCTGATCCACCCACCTGCTTTGG - Intronic
1164423188 19:28115897-28115919 CATGAACCAGGCACATGGACTGG - Intergenic
1164726677 19:30470035-30470057 CTTGAAGCAGCCACAGGCTCTGG - Intronic
1167264220 19:48475392-48475414 CCTGGATCAGCCAAGTGCTCTGG - Intronic
1168407239 19:56117063-56117085 CAGGAACCAGCCACATGACCTGG + Intronic
926213822 2:10891259-10891281 GCTGACCCAGGCACACGCTCAGG + Intergenic
926680484 2:15659647-15659669 CCTGAAGCAGCCACAGTATCTGG + Intergenic
927980941 2:27374737-27374759 CCTGAACCTGCTTTATGCTCAGG + Exonic
929559693 2:42948321-42948343 CCTGAACCAGTCACTTGGCCGGG - Intergenic
937626808 2:124053055-124053077 ACTGAACCAGCCACATTATTCGG + Intronic
937757433 2:125557188-125557210 CCTGGACCACACACATGGTCTGG + Intergenic
938589970 2:132727099-132727121 CCTGCACTAGCCCCATGCACTGG - Intronic
939880536 2:147625742-147625764 CCTGAACCAACCATATGCCAAGG + Intergenic
941648352 2:168066459-168066481 CATTAACCAGCCAGAGGCTCTGG + Intronic
943358770 2:186893338-186893360 GCTCAGCCAGCCACATGCTGAGG - Intergenic
944490504 2:200253794-200253816 CCTGAGCTCTCCACATGCTCAGG + Intergenic
947337315 2:229100850-229100872 CCTGGACAAGCCAGATGCTCAGG + Intronic
948223726 2:236292918-236292940 CCTGAACCAGACTCCTACTCGGG - Intergenic
948800756 2:240432445-240432467 CCTTCATCAGCCACATGCTGGGG + Intergenic
1168943519 20:1732801-1732823 CCGGCACCAGTCACAGGCTCGGG - Intergenic
1169206125 20:3741211-3741233 CCTAGAAAAGCCACATGCTCAGG - Intronic
1171349207 20:24490110-24490132 CCTGTTCCATCCACATGCTGTGG + Intronic
1172875755 20:38163511-38163533 CCCAAAGCAGCCACTTGCTCTGG - Intronic
1174034510 20:47660115-47660137 CTTGATCCTGCCACATCCTCGGG - Intronic
1174739176 20:52995407-52995429 CCTGAACCAATCACTTTCTCTGG + Intronic
1175222099 20:57422981-57423003 CCCAAACTAGCCTCATGCTCAGG - Intergenic
1175468709 20:59210459-59210481 GCTGACACAGCCTCATGCTCAGG - Intronic
1179000530 21:37453558-37453580 CCTGGACCAAACACCTGCTCGGG - Intronic
1181713041 22:24703398-24703420 CCTGCACCAGGCCCGTGCTCTGG - Intergenic
1182379966 22:29880022-29880044 CCTTAACCAGTCATCTGCTCAGG - Intergenic
1183715093 22:39528826-39528848 CCGGACCCAGCCACCTGCACTGG + Intergenic
1184103250 22:42352613-42352635 CCTGGTCCAGCCACATCCCCTGG - Intergenic
1184863499 22:47190249-47190271 GCTCAACAAGCCACAGGCTCCGG - Intergenic
949141321 3:636914-636936 CCTCAACCAGACAAATTCTCAGG + Intergenic
949938349 3:9134893-9134915 CCTGGCCCTGCCACATGCTCAGG + Intronic
950111239 3:10420085-10420107 ACTGACTCAGCCACATCCTCGGG - Intronic
953782621 3:45884893-45884915 TGAGAACCAGCCAGATGCTCTGG - Intronic
955321625 3:57978706-57978728 CCTGCACCTGCCACAAGCTCAGG - Intergenic
960352267 3:116607702-116607724 CTGGAACCAGCCAAATGCTTTGG - Intronic
961557613 3:127707295-127707317 CCTCAGCCATCCACATACTCAGG - Intronic
961792950 3:129389721-129389743 CCTGTCCCAGGCCCATGCTCTGG + Intergenic
961793670 3:129394167-129394189 GCTGTCCCACCCACATGCTCAGG - Intergenic
961809907 3:129515614-129515636 GCTGTCCCACCCACATGCTCAGG - Intronic
962330406 3:134472993-134473015 CCTGGACCAGCTAGCTGCTCAGG - Intergenic
962346782 3:134624566-134624588 CCTGCACCTGAGACATGCTCAGG + Intronic
962604854 3:137024619-137024641 TCTGCACCAGCTAAATGCTCTGG + Intergenic
962814718 3:138987781-138987803 CCAGAACCAGCCAGCTGGTCTGG + Intergenic
965902062 3:173653903-173653925 CCTGTACAAGCCACATGAACAGG + Intronic
968871671 4:3245775-3245797 CCTGTTGCAGCCACATCCTCTGG + Intronic
968932559 4:3588954-3588976 CCTGAACATGCCACATGCAGAGG + Exonic
969244037 4:5921070-5921092 CCTGGACCAGCTGCTTGCTCAGG - Intronic
969570883 4:8007609-8007631 CCTGAACGAGGCACAGCCTCAGG - Intronic
969886566 4:10220485-10220507 CCTGAACCAGACACAAGCATCGG - Intergenic
972571470 4:40314248-40314270 CAGGAACCGGCCACATGGTCAGG + Intergenic
977111805 4:92966024-92966046 CCTGAATCTGCCACATAATCTGG - Intronic
977574623 4:98663067-98663089 CTTAAAGCAGCCACATGCTCTGG + Intergenic
977835245 4:101638141-101638163 CCAGCAGCAGCAACATGCTCAGG - Intronic
980598250 4:134984769-134984791 CCTGAAACAGTCACATTCTAAGG - Intergenic
982132723 4:152244896-152244918 CCTGATCCAGTCTGATGCTCTGG + Intergenic
985785357 5:1890396-1890418 CCTGAAGCAGCCAGGAGCTCAGG - Intergenic
986747726 5:10759307-10759329 ACTGCAGCAGCCACCTGCTCTGG - Intronic
988117712 5:26919219-26919241 CTTGCACCAGCCACATGGTGAGG + Intronic
990351716 5:54923943-54923965 CCTGACCACGCCACAGGCTCTGG - Intergenic
993031104 5:82706850-82706872 CCTGAACCTCCCACATGCCTGGG + Intergenic
996424995 5:123304814-123304836 CCTGACCCAGCCACACCCTAAGG - Intergenic
997772095 5:136564712-136564734 CCAGAAGCAGCAACCTGCTCAGG + Intergenic
999371948 5:151061155-151061177 CCTGAACCAGCCATTAGCTCTGG + Intronic
1000064659 5:157684093-157684115 GCAGAACCAGCCATATTCTCTGG + Intergenic
1000433402 5:161179263-161179285 CCAGGAACAGCCACATGCTATGG + Intergenic
1002298377 5:178243858-178243880 GCTGAACCAGCTGCAGGCTCTGG - Intronic
1003258722 6:4496732-4496754 TCTAAACCAGGCAAATGCTCTGG - Intergenic
1006254076 6:32815335-32815357 CATGAACCAGCCCCCTCCTCTGG + Intronic
1006277261 6:33015338-33015360 CCTGCACCAGCCTCCTGCCCTGG + Intergenic
1008586253 6:52952721-52952743 CCAGAACCAGCCAAGTGCCCAGG + Intergenic
1010059555 6:71606858-71606880 ACTGTCCCAGCCACAGGCTCAGG + Intergenic
1011438732 6:87366036-87366058 CCTGACCCAGCCCCCAGCTCAGG - Intronic
1014013286 6:116501189-116501211 GCTGAGCCAGTCACAGGCTCGGG - Intronic
1015579505 6:134708135-134708157 CCTGATCCACACACATCCTCAGG + Intergenic
1017879278 6:158548517-158548539 CCAGAATCAGCCAGCTGCTCTGG + Intronic
1019221333 6:170475165-170475187 CCTGCACCAGTCACAGGCCCAGG - Intergenic
1019373285 7:674852-674874 CCTGAACCAGCCACATGCTCTGG + Intronic
1019452196 7:1105153-1105175 CATGGACAAGCCACAGGCTCTGG + Intronic
1019804444 7:3112979-3113001 CCTGAACCAGCCCAAAGCTGTGG - Intergenic
1021117130 7:16756479-16756501 GCTGAACTGTCCACATGCTCTGG + Intronic
1021387033 7:20044198-20044220 CCTACACAGGCCACATGCTCTGG + Intergenic
1021899046 7:25264769-25264791 CATGAGCCAGCTTCATGCTCAGG - Intergenic
1021995925 7:26178441-26178463 CCTCAACCAGCCACATGCACAGG + Intronic
1024043136 7:45570269-45570291 CCTGCACCACCCCCATGATCTGG + Intergenic
1024083192 7:45872876-45872898 CCTCAACCAACCTCTTGCTCGGG + Intergenic
1026382973 7:69817754-69817776 CCTGGACCACCCACATCCCCGGG - Intronic
1030865005 7:114690785-114690807 ACAGAAGCAGCCACATGCTTTGG + Exonic
1031385117 7:121140271-121140293 CCTGAAACTGCTCCATGCTCAGG - Intronic
1031935843 7:127735044-127735066 CCTGGGCCAGGCACATACTCAGG - Intronic
1033757554 7:144407524-144407546 CCTGAGCCAGGCACGTGCTCAGG + Intronic
1036215137 8:6873208-6873230 CTTTGACCAGCTACATGCTCTGG - Intronic
1036640851 8:10582591-10582613 CCTGACCCAGCGCCCTGCTCAGG - Intergenic
1038486540 8:27939322-27939344 TCTGACCCAGCCACTTGCACTGG - Intronic
1039092132 8:33843606-33843628 CCAGAAACAGCGACAAGCTCAGG - Intergenic
1042325415 8:67522789-67522811 CCTGGTCCAGCCACAGGCTGTGG + Intronic
1045255910 8:100521087-100521109 CCTGAAGCAGCCAGTTACTCAGG + Intronic
1045858926 8:106793910-106793932 CCAGCAGCAGCAACATGCTCGGG + Intergenic
1048450198 8:134526736-134526758 CCTGAATCTGGCACTTGCTCAGG + Intronic
1049621485 8:143600157-143600179 CCTGCACCAGTCACATGCACTGG + Exonic
1049813250 8:144585712-144585734 CCACAACCAGCGACATCCTCGGG - Intronic
1050360259 9:4823460-4823482 CCTGAATCAGGCATGTGCTCTGG + Intronic
1050605286 9:7295160-7295182 TCTGAACCAGCCACTGTCTCAGG - Intergenic
1051091588 9:13416205-13416227 TCTGATCCAGCCAAATTCTCTGG + Intergenic
1053345990 9:37378645-37378667 CCGGAACCAGCCACATTGTGGGG - Intergenic
1059853205 9:118366517-118366539 CCTGATCCAGCCTCCAGCTCTGG + Intergenic
1185678075 X:1865071-1865093 CCTGTACCAGCCACATCAGCAGG + Intergenic
1190904375 X:54711249-54711271 CCTTAAACATCCACATTCTCAGG + Intergenic
1195002388 X:100654489-100654511 CCTAAAGCAGCAACATGCTGTGG - Intronic
1195120215 X:101742156-101742178 CCTGAACCAGTCTTATGGTCAGG + Intergenic
1196427212 X:115582955-115582977 CCTGAACCTCCCCCAGGCTCAGG - Intronic