ID: 1019373289

View in Genome Browser
Species Human (GRCh38)
Location 7:674863-674885
Sequence CACATGCTCTGGATAAGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019373277_1019373289 30 Left 1019373277 7:674810-674832 CCTGCTTGGGGTAACTGGGCACC 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1019373289 7:674863-674885 CACATGCTCTGGATAAGATAGGG No data
1019373279_1019373289 9 Left 1019373279 7:674831-674853 CCCTGGACCCAAAGTATCCAGCC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 1019373289 7:674863-674885 CACATGCTCTGGATAAGATAGGG No data
1019373281_1019373289 2 Left 1019373281 7:674838-674860 CCCAAAGTATCCAGCCTGAACCA 0: 1
1: 0
2: 2
3: 10
4: 106
Right 1019373289 7:674863-674885 CACATGCTCTGGATAAGATAGGG No data
1019373280_1019373289 8 Left 1019373280 7:674832-674854 CCTGGACCCAAAGTATCCAGCCT 0: 1
1: 0
2: 1
3: 14
4: 208
Right 1019373289 7:674863-674885 CACATGCTCTGGATAAGATAGGG No data
1019373282_1019373289 1 Left 1019373282 7:674839-674861 CCAAAGTATCCAGCCTGAACCAG 0: 1
1: 0
2: 1
3: 8
4: 146
Right 1019373289 7:674863-674885 CACATGCTCTGGATAAGATAGGG No data
1019373283_1019373289 -8 Left 1019373283 7:674848-674870 CCAGCCTGAACCAGCCACATGCT 0: 1
1: 0
2: 0
3: 16
4: 213
Right 1019373289 7:674863-674885 CACATGCTCTGGATAAGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019373289 Original CRISPR CACATGCTCTGGATAAGATA GGG Intronic
No off target data available for this crispr