ID: 1019376727

View in Genome Browser
Species Human (GRCh38)
Location 7:696823-696845
Sequence CCATACACACAGGCCGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019376719_1019376727 25 Left 1019376719 7:696775-696797 CCCATCTTTGGCAGGTGAAGAAT 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1019376727 7:696823-696845 CCATACACACAGGCCGCTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 91
1019376720_1019376727 24 Left 1019376720 7:696776-696798 CCATCTTTGGCAGGTGAAGAATC 0: 1
1: 1
2: 0
3: 27
4: 265
Right 1019376727 7:696823-696845 CCATACACACAGGCCGCTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019376727 Original CRISPR CCATACACACAGGCCGCTTC AGG Intronic