ID: 1019380633

View in Genome Browser
Species Human (GRCh38)
Location 7:720732-720754
Sequence TGAAATTCCTTGGGAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 377}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019380633 Original CRISPR TGAAATTCCTTGGGAAAAAG AGG (reversed) Intronic
900807641 1:4778226-4778248 TGAGATTCCCTGGGCAAAAAGGG - Intronic
901474692 1:9481383-9481405 TGAAATTCCTTTGGAAATTATGG + Intergenic
902191657 1:14767460-14767482 TAAAATCCCCTGGGAAAAAAAGG - Intronic
903001361 1:20268379-20268401 AGAAATTCATTGGGAAGATGGGG + Intergenic
904362436 1:29985115-29985137 TGAAATTAATCAGGAAAAAGGGG + Intergenic
904535933 1:31199421-31199443 AGAAATCCATTGGGAAAAGGGGG - Intronic
905140957 1:35844015-35844037 AGAAATTGCTGGGGGAAAAGTGG + Intronic
905326197 1:37153560-37153582 TTACAGTCATTGGGAAAAAGAGG + Intergenic
906043321 1:42806429-42806451 AGAAATTCCTTGGGAGTAGGGGG - Intergenic
907538807 1:55193001-55193023 TGAAAATATTTGGGAAAAAATGG + Intronic
907578358 1:55549621-55549643 AGAAAATGCATGGGAAAAAGAGG - Intergenic
910657233 1:89632211-89632233 TGAAATTGGGTGGGAAAATGGGG + Intergenic
910899339 1:92102817-92102839 TCCAATTACTTGGGAAAAACTGG - Intronic
910950883 1:92647110-92647132 TAAAGTTCCTTGGAAAAAGGTGG - Intronic
911308101 1:96256774-96256796 TGAAATTACTTTGGAGAAAATGG - Intergenic
913451684 1:118997167-118997189 TCAGATTCCTTGTGAGAAAGGGG + Intergenic
915104633 1:153526056-153526078 TGAAATTTATTGAGCAAAAGAGG + Intergenic
916031201 1:160878954-160878976 TGAGATTCCTTGAGAAACACAGG - Intronic
916888108 1:169090072-169090094 TGTTATACCTTGGAAAAAAGGGG - Intergenic
917204619 1:172559688-172559710 AGAAATTTCTAGGGAAAAGGTGG + Intronic
918700838 1:187604902-187604924 GGAAATTCAATGGGAAAAACTGG - Intergenic
918779490 1:188679729-188679751 TAAAATTGCTTGGCAAAAACTGG + Intergenic
919406180 1:197187184-197187206 TTAAATACCTTGGAAAACAGGGG - Intronic
919530142 1:198707066-198707088 GGAAATTCCTTGGAAACAAGTGG + Intronic
920062327 1:203236050-203236072 TAAAATTTCTTGAGAAATAGGGG + Intronic
920084976 1:203408761-203408783 TGAAAGTCCCTGGCAGAAAGTGG + Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
922566236 1:226603606-226603628 TGAAAGTGCTTGGGAAGTAGTGG + Exonic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
922898556 1:229119140-229119162 TGAAATTTCTGGGGTGAAAGGGG - Intergenic
923553031 1:234979393-234979415 TGAAAATCCATAGGAAAATGGGG - Intergenic
923587619 1:235288781-235288803 AGAAATTCCTTGGGAGAATTTGG - Intronic
923653313 1:235893916-235893938 TGAAAATCATTGCGAAAAATTGG - Intergenic
923930871 1:238695044-238695066 TGAAATTCCTAGAAAAAATGGGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924858791 1:247900185-247900207 TGAACCTCGCTGGGAAAAAGAGG - Intergenic
1062900851 10:1145196-1145218 TAAAATTACTAGGGATAAAGTGG - Intergenic
1063198194 10:3762590-3762612 CCAAATTCCCTGGGAAAAAAAGG + Intergenic
1064043890 10:11993629-11993651 TGAAATTCCTTGGGTCACAAAGG + Intronic
1064485166 10:15780473-15780495 TGAAGTTCTTTGTGAAAAATAGG - Intronic
1064679480 10:17795592-17795614 TGAAATTCCATGGGTAAAATCGG + Intronic
1064707854 10:18091320-18091342 TAAAATGCCTTGGTATAAAGGGG - Intergenic
1067268492 10:44768947-44768969 TAAAATCCGTGGGGAAAAAGTGG - Intergenic
1067533269 10:47089952-47089974 TAAAGTTCTTTGGGCAAAAGAGG - Intergenic
1068729673 10:60342812-60342834 TGAGATAACTTGTGAAAAAGGGG + Intronic
1069089235 10:64179377-64179399 TGAAGTCCCCTGGGAAGAAGAGG + Intergenic
1069212116 10:65774841-65774863 TGAAATTCCTTTCAAAGAAGAGG - Intergenic
1070704785 10:78629755-78629777 TGTGATTTCTTGGGAAGAAGTGG - Intergenic
1070918001 10:80167166-80167188 TGAAACTGCCTGGGAAATAGGGG + Intronic
1072555499 10:96511598-96511620 TAAAATTACTGGGGAAAATGAGG + Intronic
1074061229 10:109967672-109967694 AGAATTTCCTGGAGAAAAAGAGG - Intergenic
1074712164 10:116186204-116186226 TGACAGTCCTTGGGAAGGAGAGG + Intronic
1074885180 10:117687551-117687573 CCAAAATCCTTTGGAAAAAGTGG - Intergenic
1074963985 10:118472839-118472861 TGAAATTCCTTGGGATAATGAGG - Intergenic
1075344110 10:121669860-121669882 TGAAATACTATGGGATAAAGCGG + Intergenic
1076027473 10:127127897-127127919 TGACATTCATTTGGAAAATGAGG - Intronic
1077605190 11:3605557-3605579 TGAGATTCCTGAGGAAAGAGAGG + Intergenic
1080037979 11:27729266-27729288 TGAAATTTCAAGAGAAAAAGAGG + Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083112299 11:60423228-60423250 TGAAATTTCTAGGGATCAAGTGG - Intergenic
1083600433 11:63944155-63944177 TGTCATTCCTTGGAAAATAGTGG + Intronic
1084186161 11:67472994-67473016 AGAAATTTCTAGGGAAAGAGTGG + Intergenic
1084867554 11:72072057-72072079 GGAAATTCTTAGGGAATAAGAGG + Intronic
1084958251 11:72702912-72702934 TGGAATTCCTTCGGAACAACCGG - Exonic
1084988828 11:72903604-72903626 TTACATACCTTGGGAAAGAGTGG + Intronic
1085272091 11:75276413-75276435 TCCAACTCATTGGGAAAAAGGGG - Intronic
1085420725 11:76356573-76356595 TGAAAATGCTGGGGAAAAAATGG + Intronic
1086875051 11:92085642-92085664 AGAAATTCTTGGGGAAAAAATGG + Intergenic
1087462843 11:98466974-98466996 TGGAATTTATTGGGAAAAAAGGG - Intergenic
1088083163 11:105945111-105945133 TGGAGTTCCTTAGGAAGAAGGGG - Intronic
1088282609 11:108150798-108150820 TGAAAATTCTGGGGAAAAAATGG - Intergenic
1089020174 11:115205569-115205591 TGGAATCCTTTGTGAAAAAGTGG - Intronic
1089473793 11:118742072-118742094 TGAAATTCCTGGGGATCCAGTGG - Intergenic
1090548685 11:127794331-127794353 TAAAATTTCATGGGAAAAAAAGG + Intergenic
1091495710 12:971024-971046 TAAAATTCCATGGAAAAAAATGG - Intronic
1092488222 12:8921273-8921295 AGAAAATCCTGGGGAAGAAGAGG + Intronic
1093334267 12:17881865-17881887 AAAAATTCCATGGGTAAAAGAGG + Intergenic
1093892825 12:24544068-24544090 TTAAATTTCTTGGAAGAAAGGGG - Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094276298 12:28679802-28679824 TGGCTTTCCTTGGAAAAAAGTGG + Intergenic
1094290922 12:28849219-28849241 TAAAATACCATGGGGAAAAGTGG + Intergenic
1095741717 12:45614417-45614439 TGAAACTCTTGGGGAAAATGAGG - Intergenic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1099748593 12:86740839-86740861 TGAAATTACTTTTTAAAAAGTGG - Intronic
1101318257 12:103649701-103649723 TGGGATGCCTTGGGAAAAATGGG - Intronic
1103247086 12:119467013-119467035 AGAAATTTCTAGGGAAAAGGTGG - Intronic
1104330327 12:127838620-127838642 TGAAATTGCCTGGGAGAAGGTGG + Intergenic
1105885731 13:24639545-24639567 TGGAATTCATTGGGTAAAAAGGG + Intergenic
1106139831 13:27002931-27002953 AGAAATTCCATGGAAAAATGGGG + Intergenic
1107455905 13:40554271-40554293 AGAAAATTATTGGGAAAAAGCGG - Intergenic
1108000318 13:45900260-45900282 TGGAATTTTTTGGGCAAAAGGGG + Intergenic
1108232357 13:48360531-48360553 TGAAATTGCATGGGGAAGAGTGG + Intronic
1110094458 13:71499048-71499070 TGAAATTTCTTGGAAAAAAATGG + Intronic
1111051680 13:82890519-82890541 TGAAATTACTCTGAAAAAAGAGG + Intergenic
1111875174 13:93884223-93884245 TAAAATTCTATGGGGAAAAGAGG - Intronic
1112569327 13:100579692-100579714 GGAAATTCATTTGGAAAAAAGGG - Intronic
1112962109 13:105139399-105139421 TGCAATTCCTTGGGGAAGTGAGG - Intergenic
1113024751 13:105928543-105928565 TGAACTTCCCAGAGAAAAAGTGG - Intergenic
1113103236 13:106743937-106743959 TTAATATCCTTGAGAAAAAGTGG + Intergenic
1113520978 13:110940714-110940736 TTAATTTCCTAGGGGAAAAGGGG + Intergenic
1114697484 14:24640474-24640496 TGAAATTTCTGGAGAGAAAGAGG - Intergenic
1114941493 14:27616711-27616733 TTATGTTCCCTGGGAAAAAGAGG + Intergenic
1115631284 14:35248243-35248265 TGAATCTCTTTGGGAAAAAATGG - Intronic
1115694194 14:35878766-35878788 TCAAAATCGTTTGGAAAAAGGGG - Intronic
1116201188 14:41799309-41799331 TCAAATTCCCAGGCAAAAAGTGG - Intronic
1116226894 14:42164185-42164207 TGAAATTTCTTGAGAACCAGTGG - Intergenic
1117314194 14:54557853-54557875 TGAAATTGCTTGGAAAGAAAGGG + Intergenic
1118040352 14:61909630-61909652 TGAGCTTACTTGGGAAAAAGGGG - Intergenic
1118400409 14:65374352-65374374 TCAAATGTCCTGGGAAAAAGGGG + Intergenic
1118671457 14:68132549-68132571 TGAACTAGCTTGGTAAAAAGAGG + Intronic
1119426820 14:74540974-74540996 TAAATCTCCTTGGGAGAAAGTGG + Intronic
1119717761 14:76870756-76870778 TTAAATTCCTTGAGAAACTGGGG + Intergenic
1120516473 14:85476791-85476813 GGAAAATGCATGGGAAAAAGTGG + Intergenic
1120606497 14:86584582-86584604 TAAAATTCCCTGGCAAAATGTGG + Intergenic
1121796873 14:96742580-96742602 TGAAACTCCCTGGGGAACAGGGG - Intergenic
1121877436 14:97466247-97466269 TGGATTTCCTTGGGTCAAAGTGG + Intergenic
1125371515 15:38983322-38983344 TGCATTTCCTTGGGCACAAGGGG + Intergenic
1125708912 15:41767551-41767573 ATAAATTCCTTGGGTAAGAGGGG - Exonic
1126637628 15:50794665-50794687 TGAAAATATTTGGGAAAAAAAGG + Intergenic
1126872898 15:53008723-53008745 TGAAATTCCTGTGATAAAAGGGG + Intergenic
1126887590 15:53167393-53167415 TGAAAATACTTGGGAGAATGTGG + Intergenic
1127480604 15:59373343-59373365 TGAATTTCCTTGGAAAACAAAGG + Intronic
1128079927 15:64850909-64850931 TGAAATACCTGGGGAAGAATTGG + Intronic
1129078603 15:73019852-73019874 TGAAAATTCCTGGAAAAAAGTGG + Intergenic
1130624687 15:85501918-85501940 TGGAATTTGTTGGGAAGAAGGGG + Intronic
1130664624 15:85859451-85859473 TGAAATTCCTAGGCACAGAGTGG - Intergenic
1131570994 15:93535833-93535855 GGTATGTCCTTGGGAAAAAGTGG - Intergenic
1131755154 15:95551514-95551536 TGAAACTCTTTGGGAAGAAAAGG + Intergenic
1131772557 15:95754853-95754875 TGAAATTCATATGGAAAATGTGG - Intergenic
1131986589 15:98048099-98048121 TCAAATACCTAGGGAAAAAAGGG - Intergenic
1132184892 15:99795439-99795461 TGAAATTCCTTGGCTCAATGAGG - Intergenic
1133193885 16:4154628-4154650 GGAAATTTCCAGGGAAAAAGAGG + Intergenic
1133805410 16:9122805-9122827 TGAAGTTCCCTGGGGAAAAGGGG + Intergenic
1134026856 16:10960971-10960993 GGCAATTCATTGGGAAAAAAGGG - Intronic
1135740408 16:24970352-24970374 TGAGACTCCTTGGGAGAAAGTGG - Intronic
1135892878 16:26373344-26373366 GGAAATACCTTAGGCAAAAGAGG + Intergenic
1136554194 16:30998047-30998069 TGAATTCCCCTGGGAAAGAGGGG - Intronic
1138050867 16:53775999-53776021 TCTACTTGCTTGGGAAAAAGGGG + Intronic
1138618807 16:58196256-58196278 TGAAAGTTCATGGGAAAATGGGG + Intronic
1138949311 16:61891771-61891793 TGAAATTCTTTAGGAAAACATGG - Intronic
1138961885 16:62037139-62037161 AGAACTTGCTTGGGAAATAGGGG + Intergenic
1142701863 17:1667390-1667412 AGAAATTCCTGGGGGATAAGGGG + Intronic
1147915720 17:43884075-43884097 TGAAATACTTTGGGGTAAAGTGG - Intronic
1148283560 17:46368313-46368335 TGAAAGAACTTGGGAAAGAGAGG + Intergenic
1148305778 17:46586238-46586260 TGAAAGAACTTGGGAAAGAGAGG + Intergenic
1149100428 17:52899798-52899820 TGAATTTTCTGGTGAAAAAGAGG + Intergenic
1149102325 17:52921867-52921889 TGGAATTTATTGGGAAAAAAAGG + Intergenic
1149790611 17:59473688-59473710 TGAAATGCTTGGGGAAAAATTGG - Intergenic
1149840606 17:59961506-59961528 TATAAATCATTGGGAAAAAGAGG - Intronic
1150022013 17:61626357-61626379 TGAAATTACCAGGAAAAAAGAGG - Intergenic
1153692575 18:7608199-7608221 TGAGATGACTTGGGAAAAAGAGG + Intronic
1153705632 18:7742115-7742137 TGGAATTACGTGGGAAAAGGTGG + Intronic
1153713772 18:7825114-7825136 GGAAATTCCCTAGGAAGAAGTGG + Intronic
1155131927 18:22944292-22944314 AGAAAATCCTTGGGAAACAGGGG - Intronic
1155495219 18:26436048-26436070 TGAGAGCCCTTAGGAAAAAGAGG - Intergenic
1155895109 18:31315528-31315550 TTCAATGCCTTGTGAAAAAGAGG + Intergenic
1156319494 18:36005490-36005512 GGAAAATTCTTAGGAAAAAGAGG + Intronic
1157006927 18:43594300-43594322 TGAAAATCATTTAGAAAAAGAGG - Intergenic
1157245709 18:46052516-46052538 TGCAATTTCTTGGGATAAAGAGG - Intronic
1157762009 18:50272373-50272395 AGAAATTCCTTAGGAAAATAGGG + Intronic
1157844474 18:50990188-50990210 AGATCTTCCTTGGCAAAAAGAGG - Intronic
1158683053 18:59586224-59586246 TGATACTCCCTGGGAAGAAGAGG + Intronic
1159313650 18:66742060-66742082 TGAAATTCCAAAGGAAAAAAAGG - Intergenic
1159847588 18:73483160-73483182 TGAAATTCATTGGCAAGAACTGG + Intergenic
1159855806 18:73586284-73586306 TGAAATCCTTAGGGACAAAGAGG - Intergenic
1160213460 18:76904405-76904427 TGAAATAGCTTTGGAAAAACTGG - Exonic
1160856036 19:1218403-1218425 TGAATTTCCCTGGGACAGAGAGG - Exonic
1161092078 19:2366064-2366086 TGAAACTGCTTGGAAAAAAAGGG + Intergenic
1163834006 19:19562478-19562500 TGAGACTCGGTGGGAAAAAGGGG + Intronic
1165143577 19:33717580-33717602 GAAAATTCCTGGGAAAAAAGTGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166472375 19:43089379-43089401 TGTGATTCCATGGGAGAAAGTGG + Intronic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167410622 19:49341691-49341713 TCACATTCCCTGGGTAAAAGGGG + Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168183579 19:54681623-54681645 TGAAAATCTTTGGGAACTAGAGG + Intronic
925120305 2:1413131-1413153 TTAAATACCCTGTGAAAAAGGGG - Intronic
926585114 2:14677152-14677174 AGAAATTCCCATGGAAAAAGTGG + Intergenic
926738461 2:16091889-16091911 TTAAAATCCTTTTGAAAAAGAGG - Intergenic
927407727 2:22791104-22791126 TGAAATTCCTTTTTTAAAAGTGG - Intergenic
928248985 2:29658138-29658160 TGTAATTCCATGGGAAACAAAGG + Intronic
929305152 2:40353114-40353136 TGAAATTACTTGGGAATCAAAGG + Intronic
930267462 2:49216636-49216658 TTATATTCCTGGGTAAAAAGGGG - Intergenic
931034892 2:58228878-58228900 TGAAATAGCATGGGAAAAAATGG - Intronic
931651447 2:64472450-64472472 TGATAATCCTTGGGAAACATAGG - Intergenic
933189603 2:79319697-79319719 AGAAATTCCTGGGAAAAAATGGG - Intronic
934950138 2:98570534-98570556 TGACAGTCTTTGGGACAAAGTGG - Intronic
935959576 2:108411370-108411392 TGAAAATATTTGGGAAAAAATGG + Intergenic
938247171 2:129786864-129786886 TGAAATCCTTTTGGAAAAAAGGG - Intergenic
938801839 2:134771013-134771035 TGAAAATTCCTGGGAAAAGGTGG - Intergenic
939766204 2:146252600-146252622 TGGAAATGCTTGGGAGAAAGAGG + Intergenic
941163452 2:162060802-162060824 AAAAATCCCTTGGGAACAAGAGG - Intronic
941545157 2:166841153-166841175 CGAAAGACATTGGGAAAAAGAGG + Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941663341 2:168217781-168217803 TGAAAATACTTGGAAAAAAATGG - Intronic
941727006 2:168871668-168871690 TGAAATTCTTTGAGCAAAAAAGG + Intronic
942702743 2:178731944-178731966 TTAAATTCCTTGGTAAAATAAGG + Exonic
943387335 2:187218042-187218064 TCAAATTCCTTTTGAAAAATAGG - Intergenic
943736934 2:191366538-191366560 CTAAATGCCTTGGGAAAAGGAGG - Intronic
943817524 2:192275415-192275437 TGAATTAACTTGGGTAAAAGTGG + Intergenic
944899353 2:204198509-204198531 TGGCATCCCTTGGGGAAAAGGGG - Intergenic
945083448 2:206108760-206108782 TGCATTCCCTTGGGAAAATGGGG - Intergenic
945442020 2:209890969-209890991 TGAAATTCATTGGAAAAACATGG - Intronic
945988520 2:216373338-216373360 AGAAACTCCTTGAGAAAAATAGG - Intergenic
946769060 2:223069604-223069626 TGAAAACCCTTGAGGAAAAGAGG - Intronic
946772252 2:223100636-223100658 TAAAATTCATTGGCAAAATGAGG - Intronic
947002129 2:225468620-225468642 AGAAAATCATTGAGAAAAAGAGG + Intronic
947003534 2:225485751-225485773 TCAAATGACTTGGGCAAAAGAGG + Intronic
947696118 2:232190830-232190852 GGAAATTTCTTAGGAAAAGGTGG + Intronic
1170269607 20:14510441-14510463 TGAAATTCCTTGTGAAAGTGAGG - Intronic
1170512601 20:17094264-17094286 TTAACTTCCTTTGAAAAAAGGGG - Intergenic
1170956567 20:20985382-20985404 TGAAAAGCCTTGGGAGAGAGGGG - Intergenic
1171442156 20:25173829-25173851 TGGAACTCCTTGAGAAAAATAGG - Intergenic
1172531963 20:35637586-35637608 AGAAAATCCTTGGGGAAAACAGG - Intronic
1173717474 20:45221621-45221643 AGAAATTTGTTGGGAAAAGGTGG + Intronic
1178044318 21:28676756-28676778 TGGAATTTATTGGGCAAAAGGGG - Intergenic
1178084414 21:29098479-29098501 TTAAATTTCTTGAGAAAAAAAGG + Intronic
1179862923 21:44200384-44200406 AGAAAGACCTTGGTAAAAAGGGG - Intergenic
1181873777 22:25923923-25923945 TGCATGTTCTTGGGAAAAAGTGG + Intronic
1182959629 22:34460078-34460100 TGGAATTCCTGGGGGAAAAGAGG - Intergenic
1183826285 22:40390338-40390360 TGAAAATACTTGTTAAAAAGGGG - Intronic
1184540155 22:45117162-45117184 TGAAACTCCGAGGGAGAAAGTGG + Intergenic
1185028530 22:48429461-48429483 TGAAAGTTCTCGGGAGAAAGAGG + Intergenic
1203289916 22_KI270735v1_random:26367-26389 TCAAATTCCTAAGGACAAAGTGG + Intergenic
949123040 3:411075-411097 TGAAAATCCTTGGGAGAATATGG + Intergenic
951037266 3:17947561-17947583 TTAAGTTCTTTGGGAAAAAAGGG + Intronic
951129160 3:19021087-19021109 TTAAAGTCCCTGGCAAAAAGAGG + Intergenic
951562615 3:23983182-23983204 TTAAATTCCTTGTGAAATTGAGG + Intergenic
951752111 3:26048099-26048121 TGAACTTTCTTAGAAAAAAGAGG + Intergenic
954999437 3:54913461-54913483 TGAAATTATTTGAGAAAAATGGG - Intronic
955114967 3:55988985-55989007 GGAAGTTTCTTGGGAAAAAAAGG - Intronic
955221265 3:57025344-57025366 TGAAATTCCTTGGTAAATCGTGG - Intronic
955519680 3:59762935-59762957 TGAAACTCCTTCTGAAAAGGAGG + Intronic
955933733 3:64082681-64082703 TGATAGTGCTTGGGAAAAGGAGG - Intergenic
957662041 3:83170212-83170234 AGAAATTCTTGGGGAAAAAAAGG + Intergenic
957726247 3:84071137-84071159 GGGGATTCCTTGGGAAAAATAGG - Intergenic
957952125 3:87141048-87141070 TGTAATTACTTGGAAATAAGAGG + Intergenic
958744926 3:98121964-98121986 TGAAATTCCTTTCAAAAAACTGG + Intergenic
959101518 3:102015487-102015509 TGAAATTTGTAAGGAAAAAGTGG + Intergenic
959896481 3:111612387-111612409 TGTAATTGCTAGGGAAAAAATGG - Intronic
961097862 3:124173456-124173478 TGAAGTTACTTGGGAGATAGAGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
963158817 3:142128851-142128873 TGGAATTCCAAAGGAAAAAGAGG + Intronic
963256420 3:143149014-143149036 TGAAATTCCTTGAGCAAAAAAGG + Intergenic
963463966 3:145653943-145653965 TGAAATTCCTTTGTAAAATCAGG + Intergenic
964086869 3:152829411-152829433 TGAAATTCTTTTGGAAAAGCTGG - Intergenic
964295565 3:155229156-155229178 TGAAATTCCTTTGTCATAAGAGG + Intergenic
964337453 3:155670919-155670941 TGATATTCCTTGGAATAAATGGG - Intronic
964753069 3:160069871-160069893 TAAGAATCCTTGGGAAAAATAGG - Intergenic
966749869 3:183311743-183311765 TGAAATTACTTGGAAAGCAGGGG - Exonic
967157287 3:186705140-186705162 TCCATTTCCTTGGGAAAAGGTGG + Intergenic
970090488 4:12401587-12401609 TCAAATTCCTTGGGCACAGGAGG + Intergenic
971148393 4:24004974-24004996 GGAAAGCCCTTGGGAAAAAAGGG - Intergenic
971241731 4:24895545-24895567 AGAAATGCCTTGGGTAACAGTGG - Intronic
971312909 4:25541157-25541179 TGAAATTCCTAGTGAAATAATGG + Intergenic
971804355 4:31336074-31336096 TGAAATGCCCTTGGCAAAAGAGG + Intergenic
971883779 4:32415374-32415396 TAAAAATGCTTGGGAAAAATTGG + Intergenic
972312925 4:37898293-37898315 TAAAACACCTTGGAAAAAAGAGG + Intronic
972614482 4:40685125-40685147 TGGCCTTCCTTGGGAAAAAGTGG - Intergenic
972788815 4:42351228-42351250 TTGAATTGCCTGGGAAAAAGAGG - Intergenic
973090686 4:46132569-46132591 TGAAATTCAATGGGAACAATGGG + Intergenic
974290796 4:59927381-59927403 GGAAGTTCGATGGGAAAAAGAGG + Intergenic
974529205 4:63085279-63085301 TGACATTCCTGAGGAAGAAGGGG - Intergenic
975109964 4:70612037-70612059 TGAATTTCAATGGGAAAAATAGG - Intergenic
975662096 4:76698410-76698432 TGTCATTCATTGGGAAAAAATGG - Intronic
976368324 4:84257034-84257056 TGAAAGCCCTTGGGACAAAATGG + Intergenic
977519924 4:98069023-98069045 TGAAATTCAGTGGCATAAAGTGG - Intronic
980103873 4:128568254-128568276 TGACATTATTTGGGAAAAGGGGG - Intergenic
980533559 4:134086541-134086563 TGAGATTTCTTTTGAAAAAGAGG - Intergenic
980642689 4:135599986-135600008 TGAAAAACCTTGTGAATAAGTGG - Intergenic
981204248 4:142019976-142019998 GAAGATTGCTTGGGAAAAAGAGG + Intergenic
981574300 4:146188271-146188293 TAACATTTCTTAGGAAAAAGAGG - Intronic
982217742 4:153096697-153096719 TGAGAATCCTGGGGAAACAGAGG + Intergenic
983269133 4:165540239-165540261 TGAAATTCCTTAGGAACTATCGG - Intergenic
984046316 4:174803883-174803905 TGAAATTGCTTTAGCAAAAGAGG + Intronic
984126566 4:175817631-175817653 TGAAATTAGATGGGAAAAAAGGG + Intronic
985315039 4:188649079-188649101 TGAACTTCCTTGAGAAGAATCGG - Intergenic
1202758434 4_GL000008v2_random:86877-86899 TTAAAGTCCTTGAGGAAAAGGGG + Intergenic
986525991 5:8676171-8676193 TGAAATTCCTTTTTAAAAAGCGG - Intergenic
986548038 5:8920530-8920552 TTAAATTCCTTTGGATTAAGGGG + Intergenic
988239621 5:28592782-28592804 TTAAATTTCTAGGGAATAAGTGG + Intergenic
988849356 5:35163204-35163226 TGAAATTTATTGGGCAAAAATGG - Intronic
989212725 5:38872186-38872208 AGGACTTCCTTGGGAAATAGTGG - Intronic
990046284 5:51435902-51435924 AGAAATTCCTTAGGTAAAAAAGG - Intergenic
990551151 5:56880618-56880640 TGTAATGCCTTGTGAAAAAGTGG - Intronic
991271880 5:64793525-64793547 TCAAATACCTTGGTAAGAAGAGG + Intronic
991933927 5:71783239-71783261 TGACATTCCTTGGGTTAAATGGG + Intergenic
992002268 5:72447315-72447337 TGAATTTGCTTGGGCAATAGAGG + Exonic
992208927 5:74458478-74458500 AGAAATTCCCTGGGAAACACTGG + Intergenic
992328713 5:75692256-75692278 TCAAATTCCTTTGAAATAAGAGG + Intronic
993190673 5:84675485-84675507 TGAAAGACCTTGGGCAAGAGAGG + Intergenic
993241930 5:85400362-85400384 TGAAATTATTGGGGATAAAGAGG + Intergenic
993357545 5:86933219-86933241 TCAATTTGCTTGAGAAAAAGAGG - Intergenic
994575233 5:101569415-101569437 TGAGATCCCTTGGGAAAGGGAGG + Intergenic
995862360 5:116654452-116654474 AGAAGTTCATGGGGAAAAAGTGG - Intergenic
996081615 5:119264029-119264051 TCACATTCCCTGGGAAAATGGGG - Intergenic
996088278 5:119326025-119326047 TGACATTCAGTGGGAAAAAGCGG - Intronic
996403023 5:123083747-123083769 TTAAATTCCTGGGGAAAGGGTGG + Intergenic
996752088 5:126899101-126899123 TGAGATTGTTTGGGATAAAGCGG - Intronic
998692733 5:144605199-144605221 TTAAATACCTTGGGAATAAGGGG - Intergenic
998708300 5:144790651-144790673 TGAAAATATTTGGGAAAAAATGG - Intergenic
998890426 5:146739960-146739982 TGAAAATACTTGGAAAAATGTGG + Intronic
1000414047 5:160964961-160964983 TGAAATTCTTATGCAAAAAGAGG - Intergenic
1001531540 5:172465738-172465760 TTAAATCCCTGGGGTAAAAGAGG + Intergenic
1002158301 5:177300096-177300118 TGAAACTCCTAGTGAAAAAGAGG + Exonic
1002929666 6:1624533-1624555 AGAAAGTCCTAGGGAAGAAGAGG + Exonic
1005662837 6:28017194-28017216 TGAAATATCTAGGAAAAAAGAGG + Intergenic
1006976922 6:38111279-38111301 TGAAAATATTTGGGAAAAAATGG + Intronic
1007000126 6:38303696-38303718 TCAAACTCTTTGGGAAAAAAAGG + Intronic
1008432488 6:51435411-51435433 TGAAATTACTTGGGGAATATTGG + Intergenic
1008737133 6:54558599-54558621 TTATCTTACTTGGGAAAAAGAGG + Intergenic
1009400169 6:63245236-63245258 TCTAATTCCTCGGGAGAAAGGGG + Intergenic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1009995851 6:70894300-70894322 TAAGTTTCCTTAGGAAAAAGAGG + Intronic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1011017450 6:82772772-82772794 TGAGTTTCCTTAGGAAATAGTGG - Intergenic
1012026546 6:94001097-94001119 TGTTATTCTTTGGGAAAAAAAGG - Intergenic
1012493433 6:99808680-99808702 CGAGAGTGCTTGGGAAAAAGAGG - Intergenic
1014675281 6:124356792-124356814 TGGAATTCCTTTGAAGAAAGTGG - Intronic
1014683740 6:124468483-124468505 TGAAATATAATGGGAAAAAGTGG + Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015517333 6:134096380-134096402 TCAAATACCTTGGGAAAATCAGG + Intergenic
1016297016 6:142584289-142584311 TAAATCTCCTTGGGAAAAACTGG + Intergenic
1016758392 6:147711630-147711652 TTAAATTTCTTGGAAAATAGTGG + Intronic
1016798476 6:148143571-148143593 AGATATTCCATGGGAAAAGGGGG + Intergenic
1017149362 6:151264233-151264255 TGACATTCCTTGAGGACAAGAGG + Intronic
1017376160 6:153771309-153771331 TGAAATTTCTTGTGGAAAACAGG - Intergenic
1018607245 6:165610723-165610745 TTAAATGCCTTAAGAAAAAGTGG + Intronic
1019380633 7:720732-720754 TGAAATTCCTTGGGAAAAAGAGG - Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1021407833 7:20294114-20294136 TGAATTTCCAAGGGAAAAGGAGG - Intergenic
1023247365 7:38219447-38219469 TGAAATACCTTTAGAAAAAGAGG - Intronic
1023583686 7:41707048-41707070 TGAAATTCATTGAGAACAACAGG + Intergenic
1024405660 7:48976417-48976439 AGAAATTTCTAGGGAAAGAGTGG + Intergenic
1025261537 7:57423204-57423226 TGGACTTCCTTGGGGAAATGAGG + Intergenic
1026347985 7:69491488-69491510 TGAAGTTCCTTGTGTTAAAGTGG - Intergenic
1028469809 7:91193090-91193112 GGAAATTCCTTTTGAACAAGGGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031688606 7:124763135-124763157 GAAAATTTCTTGGGAAGAAGGGG - Intronic
1031709777 7:125031023-125031045 TTAATTTCCTTAGGAAAAAATGG + Intergenic
1032831032 7:135626076-135626098 TGAAAATCCTAGGAAGAAAGCGG + Intronic
1032897714 7:136269937-136269959 TGAAAGTATTTGGGAAAAAATGG + Intergenic
1033383760 7:140851013-140851035 GGAAATTCCTTGAGAGAAAAGGG + Intronic
1035217801 7:157382622-157382644 TGAAATTCTTAGTTAAAAAGGGG + Intronic
1035434759 7:158850874-158850896 TTAGAGTCCTGGGGAAAAAGAGG - Intergenic
1036551950 8:9823821-9823843 TGAAATTCAATGGCAACAAGAGG - Intergenic
1037420788 8:18700005-18700027 TAAAATTCCTGGGAAAAAATTGG + Intronic
1038040721 8:23722220-23722242 TGTTTTTCCTTGGTAAAAAGTGG + Intergenic
1038380033 8:27084320-27084342 TGAATTTCCGTGGGAAGTAGTGG + Intergenic
1038864970 8:31429775-31429797 TGAAATTTATTGGGCAAAAAGGG - Intergenic
1039536089 8:38314512-38314534 TGAAATACCTTTGGGAAGAGAGG + Intronic
1040695234 8:49988172-49988194 CAAAATGCCTTGGGATAAAGGGG + Intronic
1041377791 8:57220263-57220285 TGACATTCCTTCGGAAAACAGGG - Intergenic
1041714400 8:60921213-60921235 TGCAAATTCTTGGGAAACAGTGG - Intergenic
1042619450 8:70688729-70688751 TGAAATTGATTGGAAAAAAAAGG + Intronic
1045099910 8:98833761-98833783 TGGAATCCCTTGGCCAAAAGCGG + Intronic
1045428003 8:102086369-102086391 TTAGATTCATTGGGAATAAGAGG - Intronic
1045682577 8:104678712-104678734 TGAAGTTACTTGGGAAAAGATGG - Intronic
1046550021 8:115704415-115704437 TGAAAATGCTCGGGAAACAGAGG - Intronic
1047448746 8:124943579-124943601 TGAAATGCATTGTGATAAAGGGG + Intergenic
1047723011 8:127659674-127659696 TGAAATTTGTTAGGAAGAAGTGG - Intergenic
1048162051 8:132030486-132030508 TTGAACCCCTTGGGAAAAAGTGG - Intronic
1048603887 8:135947531-135947553 TGAAGTTTCTTGGGGACAAGTGG + Intergenic
1048718886 8:137299674-137299696 TGTCCTTCCTTGGGAACAAGGGG - Intergenic
1050094975 9:2055001-2055023 TGAAAAACCTTGGGAACAAGTGG + Intronic
1050401601 9:5262007-5262029 TGGAACTCCTTGGGGAAAAGAGG - Intergenic
1050838080 9:10109775-10109797 TGAAACTCATGGGGAAAAATAGG + Intronic
1050845412 9:10211080-10211102 TAATATATCTTGGGAAAAAGGGG + Intronic
1052125628 9:24771193-24771215 AGAAATTTCTAGGGATAAAGTGG - Intergenic
1052743485 9:32416435-32416457 AGACACTCCTTGGGAAAAAAGGG - Intronic
1052803981 9:32996358-32996380 TCAACTTCCTTGGGCTAAAGTGG + Intronic
1053481608 9:38420414-38420436 TGACAAACCTTGGGAAAAACAGG + Intronic
1056101124 9:83301496-83301518 TAAAGATCCTTGGGACAAAGTGG + Intronic
1056346020 9:85695740-85695762 TGATGTTCTTTGGAAAAAAGTGG - Intronic
1057745105 9:97745193-97745215 TGAAATTCCTGTAGAAAAACAGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1060042922 9:120316304-120316326 TGAAATACCCTAGAAAAAAGTGG + Intergenic
1060536519 9:124393490-124393512 TTAAATTCATTGGGAATAAAAGG - Intronic
1060639110 9:125223796-125223818 TTAAATTCCTTGGGACACTGGGG + Intronic
1185830910 X:3302170-3302192 TGAAAAGCCTTGGGAAAACATGG - Intergenic
1186490571 X:9969178-9969200 TTAAAATACTTAGGAAAAAGAGG - Intergenic
1186570681 X:10712154-10712176 TGACATTCCTGGGGGTAAAGGGG - Intronic
1187604640 X:20870230-20870252 TTAAATTCATTGGGAATAATTGG + Intergenic
1188760692 X:34025971-34025993 TGATAGTCCTTGGTTAAAAGTGG - Intergenic
1188762849 X:34053883-34053905 TGAATTTATTTGGCAAAAAGGGG - Intergenic
1189419719 X:40846060-40846082 TGTCATTCCTTGGGTCAAAGGGG + Intergenic
1191004227 X:55693605-55693627 TGACATTAATTGGGAAAGAGGGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1191645057 X:63471103-63471125 TGAAATTTATTGGGCAAAAATGG + Intergenic
1194300266 X:92177975-92177997 GGAAATTCATGGGTAAAAAGTGG - Intronic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1195677378 X:107517382-107517404 TGAGATTTCTTGGGGAAAATGGG + Intergenic
1196474823 X:116069980-116070002 TGTAACTTCTTAGGAAAAAGGGG - Intergenic
1198506855 X:137309510-137309532 TGAATGACCTTGGGTAAAAGAGG - Intergenic
1199011875 X:142768152-142768174 TGAATTTCCTTGAGCAAAGGCGG + Intergenic
1199590102 X:149459727-149459749 TGTAATTCCTGGAGAAACAGAGG + Intergenic
1199740818 X:150734521-150734543 TGTAATTCCTTGGGATATGGTGG - Intronic
1200860078 Y:7981938-7981960 TGAAATTTCTTGTGGAACAGAGG + Intergenic
1202302964 Y:23437238-23437260 TGTGGCTCCTTGGGAAAAAGAGG - Intergenic
1202338334 Y:23833124-23833146 TTAAAGTCCTTGAGGAAAAGGGG - Intergenic
1202532432 Y:25836947-25836969 TTAAAGTCCTTGAGGAAAAGGGG + Intergenic
1202567847 Y:26233356-26233378 TGTGGCTCCTTGGGAAAAAGAGG + Intergenic