ID: 1019381342

View in Genome Browser
Species Human (GRCh38)
Location 7:725953-725975
Sequence AGGGAGAGGGCAGTGCTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 6, 3: 76, 4: 406}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019381342_1019381354 20 Left 1019381342 7:725953-725975 CCAATAAGCACTGCCCTCTCCCT 0: 1
1: 0
2: 6
3: 76
4: 406
Right 1019381354 7:725996-726018 ATCCTTAGATGACCCATCTCAGG 0: 1
1: 0
2: 1
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019381342 Original CRISPR AGGGAGAGGGCAGTGCTTAT TGG (reversed) Intronic
902206731 1:14873798-14873820 AGGGAGAGAGCAGTGCAAAGTGG + Intronic
903046689 1:20569758-20569780 AGGGAGTGGGAAGTATTTATGGG - Intergenic
903051800 1:20606585-20606607 AAGGAGAGAGCAGTGCTGAGTGG - Intronic
904030745 1:27532147-27532169 AGGGAGAGGGAAGTGATGGTAGG - Intergenic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906108163 1:43307001-43307023 AGGCAGAGGGCAGAGGTTGTGGG + Intronic
906394060 1:45445216-45445238 AGGGATTGGGGAGTGCTGATTGG - Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909472124 1:76040626-76040648 AGGGAGAGGACTGTGCTTACTGG + Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910163809 1:84301313-84301335 AGTGAGAAGCCAGTGCTTATGGG - Intronic
910440112 1:87243044-87243066 AGGGAGAAAGCAGTGCCTAACGG - Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910604516 1:89068358-89068380 GGGGAGTGGGGAGTGCTGATTGG + Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
911191860 1:94956323-94956345 AGGAAGAGGGCATTGTTCATAGG + Intergenic
911481985 1:98454884-98454906 AGGTAGAGGTCAGCGGTTATTGG + Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
913261285 1:117000220-117000242 AGGGAGTGGGGAGTGCTGATTGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
915931710 1:160064829-160064851 AGGGAGAATGCAGTGCTAAGAGG + Intronic
916586210 1:166152588-166152610 AGGGAGAGGGCACAGGTTAAAGG - Intronic
916900842 1:169221373-169221395 AGGGACAGGGCAGATCTCATAGG - Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
917727363 1:177840376-177840398 AGGGAATGGGGAGTGCTGATTGG - Intergenic
918003448 1:180520085-180520107 AGAGAGAGGCCAGTGCTTCCTGG + Intergenic
921329396 1:214020400-214020422 AAGGAGGGGGCAGTGGTTTTGGG - Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922272077 1:224043621-224043643 AGGGAGGAGGGAGTGCTTATGGG - Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922531565 1:226349134-226349156 TGGGAGAGGACAGTGCTTTGTGG + Intergenic
922543605 1:226437271-226437293 AGGGAGGGGGCAGAGCTGACGGG - Intergenic
923678733 1:236102204-236102226 AGGGACAGGGGAGTGCTTGGGGG - Intergenic
1064483858 10:15765618-15765640 AGGGTGAGGGAAGTGCTTGGGGG + Intergenic
1064846015 10:19654151-19654173 AGGTAGATGGCAGTGCTTATGGG - Intronic
1065007739 10:21395308-21395330 AGGGAGTGGGGAGTGCTAATTGG - Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1068151726 10:53140853-53140875 AAGGAGTGGGGAGTGCTGATGGG - Intergenic
1068265818 10:54647896-54647918 AGCAAGAGGGCAGTGGTAATAGG - Intronic
1068667316 10:59690610-59690632 TTGGAGAGGGCAGTTCTTACAGG + Intronic
1069037390 10:63659762-63659784 TGGGAGAGGGGTGTGGTTATGGG - Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1070464134 10:76702878-76702900 AAGGAGAGTGCAGTGATCATGGG + Intergenic
1071250005 10:83808378-83808400 AAGGAAAGGGCAGTGCCTGTCGG - Intergenic
1071586948 10:86832571-86832593 AGGTAGAAGGCAGTGATTGTGGG - Intronic
1071697543 10:87892724-87892746 AGTGAGTGGGCAGAGATTATTGG + Intronic
1072434196 10:95400634-95400656 AGGGAGATGGCAGAGCTCAGTGG + Intronic
1072551066 10:96478064-96478086 AGGGAGAAGGCAGGGCTGCTGGG + Intronic
1072844398 10:98813484-98813506 ATGGAGAAGGCAGTGATTTTGGG - Intronic
1073253353 10:102135252-102135274 AGGAAGAGAGCATGGCTTATTGG + Intronic
1074165623 10:110871855-110871877 GGCGAGAGGGCGGCGCTTATTGG - Exonic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075283434 10:121161533-121161555 AGGGAGAGGGAAGATCATATAGG - Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075542864 10:123330180-123330202 AGGGAAAGGGGAGTCCTGATGGG - Intergenic
1076188922 10:128469415-128469437 AGGGACTGGTCAGTGCTTACTGG - Intergenic
1076363468 10:129906545-129906567 AGGGAGAGGACAGTCCCTATGGG + Intronic
1076497059 10:130904276-130904298 TGTCAGAGGACAGTGCTTATTGG + Intergenic
1077321066 11:1942153-1942175 AGGGAGAGGGAGGGGCTGATGGG + Intergenic
1077355877 11:2116750-2116772 AGGATGAGGCCAGTGCTTAATGG + Intergenic
1080268738 11:30427777-30427799 AGGGAGAGGGGAAAGATTATGGG + Intronic
1081395807 11:42585081-42585103 AGGGAGTGGAGAGTGCTGATTGG + Intergenic
1081488556 11:43549455-43549477 AGGGAGTGGGGAGTGCTGATTGG - Intergenic
1082036956 11:47652750-47652772 GGGGAGAGGGAAGTGCTTCCAGG - Intergenic
1082250692 11:49976819-49976841 AAGGTGAGAGCAGTGCTTGTAGG + Intergenic
1083434416 11:62632925-62632947 AGGGAGATGGGTGTGCATATTGG - Intronic
1083849699 11:65357762-65357784 AGGGTGTGGGCACTGCTTGTGGG + Intergenic
1084010603 11:66346458-66346480 AGGGAGAGGGCAGGGGTAATGGG - Intronic
1084678993 11:70654688-70654710 AGGGAGGGGGCGGGGCTAATAGG - Intronic
1085308528 11:75501961-75501983 AGGGAGAGGTCAGGACTGATGGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1086407597 11:86511978-86512000 AGGGAATGGGCACTGCTGATTGG - Intronic
1087102734 11:94380843-94380865 AAGGAGAGGCCAGTGCTTCTTGG - Intronic
1087423603 11:97963894-97963916 AGGGAGGGGACTGTGCTTACTGG + Intergenic
1087870651 11:103289157-103289179 AGGAAGTGGGGAGTGCTGATTGG - Intronic
1088221746 11:107577255-107577277 GGGAAGAGGGGAGTGCTGATTGG - Intergenic
1088442687 11:109889169-109889191 AGGGAGAGGGCCATGCCGATGGG - Intergenic
1088773431 11:113058500-113058522 AGGGAGAAGTCAGTGCTTCATGG - Intronic
1088817534 11:113431972-113431994 AGGGAGTGGGCAGGCCTTCTGGG + Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1088946990 11:114524293-114524315 AAGGAGAAGGCAGTGAGTATTGG + Intronic
1089504357 11:118953643-118953665 AGGGAGAAGGGAGAGCTTAAAGG + Intronic
1090051203 11:123381330-123381352 AGGAAAAGGGAAGTGCTTAATGG + Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1091757411 12:3063356-3063378 AGGGATTGGGGAGTGCTGATTGG - Intergenic
1092497512 12:9011815-9011837 AGGAAGAGTGCTGTGATTATGGG + Intergenic
1092893448 12:12990983-12991005 GGGGAGTGGGGAGTGCTGATTGG - Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1095979404 12:47962700-47962722 AGGCAGTGGGGAGTGCTGATTGG + Intergenic
1098048548 12:66427957-66427979 AGGTAGAAGGCAGAGGTTATAGG - Intronic
1098307762 12:69118551-69118573 AGGAAGAAGGGAGTGCCTATGGG - Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099924835 12:89004628-89004650 AGGGAGAGGGTTCTGCCTATGGG - Intergenic
1101566366 12:105909707-105909729 TGGGAGAGGGGAGAGCTGATTGG - Intergenic
1101692557 12:107095077-107095099 AAGGAGATGGCAATTCTTATTGG + Intergenic
1102480765 12:113221660-113221682 AGGGAGAGGGCAGGGATCAGGGG + Intronic
1103063215 12:117875608-117875630 AGGGAGAAGGCAGCGATTATGGG - Intronic
1103273792 12:119695186-119695208 GGGGAGAGGGGAGTGGGTATGGG - Intronic
1104877314 12:132044713-132044735 AGGGAGAGGGCAGCACTCACCGG - Exonic
1105751505 13:23425576-23425598 AGGAAGAGGGCAGGGCCCATGGG - Intronic
1106229258 13:27809162-27809184 AGTGAGTGGGGAGTGCTGATTGG - Intergenic
1106475145 13:30092006-30092028 ATGGAAAGGGCTGTGCTTTTAGG - Intergenic
1106486793 13:30179542-30179564 AGGGAGGGGTCAGTGCTTGCTGG - Intergenic
1106576811 13:30982364-30982386 AGGGAGTGGGGAATGCTGATTGG - Intergenic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1107902956 13:45036045-45036067 AAGGAGAGGGGATTGTTTATAGG - Intronic
1107949157 13:45446294-45446316 AGGGAGTGGGGAGTCCTGATTGG + Intergenic
1108171284 13:47744710-47744732 AGGGAGGAGTCAGTGCTCATGGG - Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110538601 13:76681888-76681910 AGGGAGTGGGCAGTGGGTGTGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1112019945 13:95362883-95362905 AGGGAGTGGGGAGTGCTGATTGG - Intergenic
1112672798 13:101660272-101660294 AGGGAGTGGGGAGTGCTGATTGG + Intronic
1113103756 13:106750200-106750222 AGGGAATGGGGAGTGCTGATTGG + Intergenic
1113779995 13:112971046-112971068 AGGAAGAGGCCAGTGTTAATGGG - Intronic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1116073192 14:40074728-40074750 AGGGAGAGGGTACTGCATAGGGG - Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1116529044 14:45944664-45944686 AGTGAGGGCTCAGTGCTTATTGG - Intergenic
1116585439 14:46697428-46697450 GGGAAGAGGGGAGTGCTGATTGG - Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1118040011 14:61906198-61906220 AGGGAGAGGGCTGTGTCTACTGG + Intergenic
1118643872 14:67818784-67818806 AGGAAGTGGGGAGTGCTGATTGG - Intergenic
1119023538 14:71135144-71135166 AGGAAGTGGGGAGTGCTGATTGG - Intergenic
1119475569 14:74925441-74925463 AGGGAGGGGACAGTGTGTATGGG + Intergenic
1121197507 14:92087083-92087105 AGGGAGAGGAAAGTGCTTAAAGG + Intronic
1123157010 14:106236824-106236846 AGGGAGAGGCAAGTTCTTGTAGG + Intergenic
1123816365 15:23983416-23983438 AGGGAAAGGGGAATGCTGATTGG + Intergenic
1124003268 15:25777121-25777143 AGGGAGTGGGCAGTGCGGAACGG - Intronic
1124096518 15:26653483-26653505 AGAGAGTGGGGAGTGCTGATTGG - Intronic
1124439802 15:29677733-29677755 AGGGAGAGGAGACTGCTTCTGGG + Intergenic
1124693201 15:31842981-31843003 AGGAAGGGAGCAGTGCTTCTAGG - Intronic
1125845003 15:42843958-42843980 AGGGAATGGGCACTGCTGATTGG - Intronic
1126640149 15:50816273-50816295 AAGGAGTGGGCAGTGGTTTTAGG + Intergenic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1129205113 15:74032892-74032914 TGGGAGTGGGCCATGCTTATGGG - Intronic
1130740615 15:86595830-86595852 AGGGAATGGGCACTGCTGATTGG + Intronic
1131872285 15:96775397-96775419 AGAGAGAGGGCTGTGGTTAGGGG - Intergenic
1131973823 15:97920468-97920490 GGGGAGAGGGCAGTGTTGAGAGG + Intergenic
1132497596 16:271102-271124 GGGGAGAGGGCAGGGCTGTTGGG + Intronic
1133060915 16:3174187-3174209 AGCGAGAGGGGAGTGTGTATGGG - Intergenic
1133920699 16:10150502-10150524 AGAGAGAGGGCAGCTCTCATGGG - Intronic
1135777073 16:25266183-25266205 AGGGAGAGGGAATTCCTGATTGG + Intergenic
1137656696 16:50165566-50165588 AGGGAGTGGGGAGTGATAATGGG - Intronic
1137709928 16:50559576-50559598 AGGGAGTGGGCAGTGCCTGCTGG + Intronic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140466474 16:75187248-75187270 AGGGAGTGGGGTGTGCTGATTGG + Intergenic
1141590511 16:85065713-85065735 AGGGACAGGGCTGTGGTTAGAGG + Intronic
1142014323 16:87736178-87736200 CGGGAGAGCCCAATGCTTATAGG + Intronic
1144846387 17:18221842-18221864 TGGGAGAGGACAGTGCACATGGG - Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145797068 17:27661809-27661831 AGGGAAAGTGCAGGGCTTCTCGG - Intergenic
1147120596 17:38333122-38333144 AGGGAGAGGGCAGGTCTTGGAGG + Intronic
1147235747 17:39056172-39056194 AGGGAGTGGGAAATGCTGATTGG - Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1150507341 17:65712850-65712872 AGGCAGAGAGCTGTGCTTATCGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151715331 17:75828120-75828142 GGGGAGAGGGCAGTGCCTGGTGG + Intronic
1152227256 17:79098203-79098225 AGGCAGTGGGGAGAGCTTATGGG - Intronic
1152317289 17:79588627-79588649 TGGGGGAGGGCTGTGCTTAAGGG - Intergenic
1152643255 17:81457843-81457865 AGGGGGAGGGCAGGGGTTGTTGG + Intronic
1153676977 18:7464547-7464569 AGGGAGAGATCATTTCTTATTGG + Intergenic
1153952587 18:10069681-10069703 TGGGAGAGGGCAGTGCTCAGAGG + Intergenic
1153971572 18:10231880-10231902 AGGCAGGGGGCAGTGATTATAGG - Intergenic
1153998846 18:10466277-10466299 GGGGAGAGGGGACTGCTTACTGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155979515 18:32165927-32165949 AGAGAGAGGGAAGGGCTTGTAGG - Intronic
1156306264 18:35880595-35880617 AGGGAGAGGACTGTACTTACTGG - Intergenic
1157820082 18:50760713-50760735 AGGGAGGGGGCAGTTCTGTTGGG - Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1157911782 18:51623276-51623298 AGGCAGAGGGCAGTGCTAAAAGG - Intergenic
1158933003 18:62339281-62339303 AGGGAGAGGACAGAGCAAATGGG - Intronic
1159584591 18:70271717-70271739 AAGGAGTGGGGAGTGCTGATTGG - Intergenic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1159890477 18:73948586-73948608 AGGGAGAGGTCTGGGCTTGTTGG + Intergenic
1160201096 18:76796035-76796057 AGTGAGCCGGCAGTGCTGATTGG - Intronic
1160929536 19:1563665-1563687 AGGGAGACGCCTGTGCTTTTGGG + Intronic
1162998391 19:14350720-14350742 GGGGAGAGGGCAGAGCCTCTTGG + Intergenic
1163157683 19:15448376-15448398 AGAGAGAAGGAAGTGCTTAGGGG + Intronic
1163614990 19:18321881-18321903 AGGAAGTGGGGAGTGCTGATTGG - Intronic
1163882821 19:19942050-19942072 AGGCAGAGGCCAGACCTTATTGG + Intergenic
1163939367 19:20478193-20478215 GGGATGAGGGCAGTGCTTCTGGG + Intergenic
1164623529 19:29712080-29712102 AGGGAGAGGACTGTGCTTACTGG - Intronic
1165187622 19:34035671-34035693 AGGGAAAGGGCACTGCTGATTGG + Intergenic
1166347966 19:42178060-42178082 AGGGAGAGGGCAGGAAGTATAGG + Intronic
1167278187 19:48551597-48551619 AGGGAGAGGGCAGAGGGCATGGG - Intergenic
1167578840 19:50330516-50330538 TGGGAGAGGGCACTGCCTAAAGG + Intronic
1168076969 19:53985880-53985902 AGGGAGAGGGAACTGGTTAGGGG + Exonic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
926320042 2:11743345-11743367 AGGGAGAGGACAGTGATCCTCGG - Intronic
926374836 2:12216228-12216250 AGGGAGAGGATAATGCTTATTGG + Intergenic
927640138 2:24840866-24840888 ATGGAGAGGGCAGTGCCTTCGGG + Intronic
928083091 2:28327193-28327215 AGGGACAGGGTAGTCCTAATGGG - Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930510413 2:52337252-52337274 AGGAAGTGGGGAGTGCTGATTGG - Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
931254786 2:60560908-60560930 ATGGAGAAGGTAGTGCTGATGGG + Intergenic
931472581 2:62553861-62553883 AGGGAAAGGGCAGTGGGAATGGG - Intergenic
931598348 2:63975651-63975673 AGTGAGCCGGCAGTGCTGATTGG - Intronic
932366003 2:71153972-71153994 AGGGAGGGGGCAGAGCGTACGGG + Intergenic
933918856 2:87024392-87024414 AGGGAGAGGGCACTTTTTACTGG + Intergenic
934004138 2:87745524-87745546 AGGGAGAGGGCACTTTTTACTGG - Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
936062497 2:109304571-109304593 AGGGTGAGGGCAGTGCCGACGGG - Intronic
936191530 2:110338779-110338801 AGGTAGAGGGCAGGGCCTTTGGG + Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937121838 2:119445707-119445729 CGGGAGAAGCCAGTGATTATAGG - Intronic
939726535 2:145727477-145727499 AGGAAGTGGGGAGTGCTGATTGG - Intergenic
940468568 2:154064074-154064096 ATGGAGAGGCCAGTGATTATAGG + Intronic
940864935 2:158808360-158808382 AGGAAGAGTGCACAGCTTATAGG + Intronic
941722811 2:168829825-168829847 AGGGAAGGGGCAGTGGTTAAGGG + Intronic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943375015 2:187065888-187065910 AGGAAGAGGGAAGTGCCTAATGG + Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945268712 2:207917030-207917052 AGGGAGAGGGAAGAGCTATTAGG + Intronic
945322095 2:208436306-208436328 AGTGAGAGGGCAGACCCTATGGG + Intronic
945555527 2:211270840-211270862 AGGGAGAGGGAAGTACTGATTGG - Intergenic
946422828 2:219574652-219574674 AGGGAGAGGGCAGCCCTGACTGG - Intronic
947350145 2:229235132-229235154 AGGGAGAGAGCTGTACTTGTAGG - Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168830721 20:844049-844071 AGGCAAAGGGCAGAGCTTATAGG - Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1172312652 20:33930282-33930304 AGGCACAGGGCAGTGCTCATAGG - Intergenic
1173258407 20:41411691-41411713 AGGAAAAGGGTAGTGCTTAGAGG + Intronic
1173584641 20:44173432-44173454 AGGGAGAGGGAAATGTTGATTGG - Intronic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1174216463 20:48920340-48920362 AGAGAGAGGTCAGTGCTTCCTGG + Intergenic
1174695409 20:52551828-52551850 AGGCAGAGTGCAGTGATGATGGG - Intergenic
1175280812 20:57803119-57803141 AGGGAGGTGGCTGTGGTTATAGG - Intergenic
1175410288 20:58763233-58763255 AGGGAGGGGCCGGTGCTGATGGG - Intergenic
1175483196 20:59326316-59326338 AGGGAGAGGGCACTGCTGGGGGG + Intergenic
1175483212 20:59326382-59326404 AGGGAGAGGGCACTGCTGGGGGG + Intergenic
1175483291 20:59326712-59326734 AGGGAGAGGGCACTGCTGGGGGG + Intergenic
1175485970 20:59346558-59346580 GAGGAGAGGGCTGTGCTTGTGGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1175789463 20:61732414-61732436 AGGGATGGGGCAGTGCCTGTGGG - Intronic
1176075305 20:63245547-63245569 AGGGAGAGGGGAGAGCTTTGGGG - Intronic
1177291586 21:19120097-19120119 AGGGAGTTGGGAGTGCTGATTGG + Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1178162842 21:29939246-29939268 AGGTGGAGGTCAGTGCTCATGGG - Intronic
1178284870 21:31317107-31317129 ATGGAGAGGACAGAGCTTACGGG - Intronic
1178748205 21:35274160-35274182 AGGGAGAGGCCATTGCTTGCAGG - Intronic
1179644649 21:42767926-42767948 AGGCACAGGGCAGTGCTTCAGGG + Intronic
1180945116 22:19688480-19688502 AGGGAGAGGGCAGTGGGCCTGGG - Intergenic
1180998049 22:19975246-19975268 AGGGACAGGGCAGTGCCTATTGG - Intronic
1181721196 22:24775827-24775849 AGGAAGTAGGGAGTGCTTATTGG + Intergenic
1182355786 22:29721672-29721694 AGGGTGAGGGCAGATCTTAGAGG + Intronic
1182559706 22:31150176-31150198 AGGAAGTGGGGAGTGCTGATTGG - Intergenic
1182722040 22:32410988-32411010 AGGGAGAGCGCAGTGGTTCATGG - Intronic
1183007428 22:34915076-34915098 AGGGAATGGGGAGGGCTTATAGG + Intergenic
1185425083 22:50764507-50764529 AGGGCTAGGGCATTGCTCATTGG - Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
952967914 3:38632442-38632464 ATGGAGAGGGCAGTGATCACTGG - Intronic
953019688 3:39105544-39105566 TAGGAGAGGGCAGTGGTTAGGGG - Intronic
953458237 3:43061036-43061058 AGGAAGAGGTCAGTGTTGATGGG - Intergenic
953575262 3:44108278-44108300 AGGGAAAGGGCAGTGTTCAGTGG + Intergenic
953753868 3:45630421-45630443 AGTGAGAGGGAAGTGTTTGTGGG + Intronic
954317066 3:49806962-49806984 GGGGAGAGGGCAGAGGTCATGGG - Intronic
954604236 3:51896299-51896321 GGGGAGAGGGCAGTGTTTCCAGG - Intronic
955329631 3:58036399-58036421 AGGAAGTGGGGAGTGCTGATTGG + Intronic
955489501 3:59468313-59468335 AGTGAGATGGGAGTGCTGATTGG + Intergenic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
955655704 3:61242720-61242742 AGGCAGTGGGGAGTGCTGATCGG + Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
960862915 3:122169500-122169522 AGGGAGAGTGCAGCAATTATGGG - Intergenic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
962414041 3:135166669-135166691 ATTCAGAGGGCAGTGCTGATGGG - Intronic
962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG + Intergenic
963019110 3:140855044-140855066 AGGGAGTGGGAAGTACTGATTGG + Intergenic
963977922 3:151503810-151503832 AGGGAGAGGGGAGTGCTGCTTGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
965014673 3:163141148-163141170 AGAGAGAGAGCAGTTATTATTGG - Intergenic
965080691 3:164026819-164026841 AGGCAGAGGGCAGTACTTTTCGG + Intergenic
965679022 3:171231204-171231226 AGGCAGTGGGCAGTTCTTGTTGG + Intronic
966749824 3:183311381-183311403 AGGGAGAGGGTAGTATTTACTGG - Intronic
967231685 3:187343554-187343576 TGGGAGAGGGCTGTGATTACAGG + Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
970235111 4:13950794-13950816 AGGAAGTGGGGAGTGCTGATTGG - Intergenic
970476482 4:16428953-16428975 AGGGAGAGGGCTGTTTTAATGGG + Intergenic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972419588 4:38874090-38874112 AGGCAGATGGCATTGCTGATAGG + Intronic
972621467 4:40751263-40751285 AGGGAGAGGGAAATGATCATTGG - Intronic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973805588 4:54523178-54523200 AGGGAGATGGGAGTTCTGATTGG + Intergenic
974703981 4:65487694-65487716 AGGGAATGGGGAGTGCTGATTGG - Intronic
975221913 4:71822154-71822176 AGGGAGTGGAGAGTGCTGATTGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979292364 4:118991915-118991937 GGGGAGAGGATAGTGCTTAATGG + Intronic
979387246 4:120081839-120081861 AGGAAGAGGGCAGTACTTTTGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979675328 4:123403068-123403090 AAGGAGAGGGCAGTGGTTAAAGG - Exonic
980932926 4:139198713-139198735 AGGGAGTGGGAAGTGCTGATTGG - Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
980972314 4:139578280-139578302 GGGGAGTGGGGAGTGCTAATTGG + Intronic
981632497 4:146836463-146836485 TGGGAGAGAGGAGTGCATATAGG + Intronic
982160848 4:152568047-152568069 AGGGAGAGGGCTGTGTATGTGGG - Intergenic
982932570 4:161428075-161428097 AAGGAGAGTGCAGTGGTTTTAGG + Intronic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
985427015 4:189841004-189841026 AGGGAATGGGGAGTGCTGATTGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
987486368 5:18532428-18532450 AGGGAGTGGGGAGTTCTGATTGG + Intergenic
987489047 5:18553811-18553833 AGGGAGTGGGGAGTGCTGATTGG + Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
988726108 5:33928036-33928058 AGGAAGTGGGGAGTGCTGATTGG + Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991611448 5:68453918-68453940 AGGGAGTGGGGAGTGCTGATTGG + Intergenic
991957401 5:72009124-72009146 AGGGAGAAGGCAGTGCTCAAGGG + Intergenic
992485286 5:77189016-77189038 AGGCAGAGGGAAGGGCTTAGGGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993857908 5:93098400-93098422 ATGGAGATGGCAGAGGTTATGGG - Intergenic
994213159 5:97108543-97108565 AGGGACAGTCCAGTACTTATGGG - Intronic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995416672 5:111920896-111920918 AAGGAGAGGGCTGTGCTTACTGG + Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
995720489 5:115127133-115127155 AGGGAGCGGGCAGTGATAACTGG + Intronic
1000089502 5:157917998-157918020 AGGGAGTGGGGAGTGCTGATTGG + Intergenic
1001180374 5:169514565-169514587 AGGCAAAGGGCAGGGCTCATGGG - Intergenic
1002276122 5:178105279-178105301 AAGGAGAGAGCGGTGCTTGTGGG + Intergenic
1003583893 6:7368302-7368324 AGGGTGAGGGCAGAGGTTCTTGG - Intronic
1004293567 6:14389888-14389910 AGGGAATGGGGAGTGCTGATTGG + Intergenic
1004504330 6:16235756-16235778 AGGGAGTGGGGAATGCTGATTGG + Intergenic
1005034383 6:21542361-21542383 AGTGAGTTGGCAGTGCTGATTGG + Intergenic
1005871195 6:29975345-29975367 AGGGAGAGGACAGGGCTTCAGGG + Intergenic
1006806853 6:36794310-36794332 AGGGAGAGGGTGGGGCTTACAGG - Intronic
1006938840 6:37738012-37738034 AGGGAGAGGGGAGTGAGTACAGG + Intergenic
1007010692 6:38414768-38414790 AGGGAGAGGGCCATGCATAAAGG - Intronic
1009039463 6:58159102-58159124 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009215355 6:60913942-60913964 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009583774 6:65569751-65569773 AGGGAGTGAGCATTGCTGATTGG - Intronic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1011513091 6:88123052-88123074 AGGAAGAGGGGAGTGCTGATTGG - Intergenic
1011970912 6:93221334-93221356 AGGGAGATGGCAGTGAGTGTAGG - Intergenic
1013160988 6:107544619-107544641 AGAGAGAAGGAAGAGCTTATTGG + Intronic
1013478865 6:110535081-110535103 AGGGAATGGGGAGTGCTGATTGG - Intergenic
1014473197 6:121840939-121840961 AGGGTGATGGCAGTGCATATGGG + Intergenic
1015907173 6:138129277-138129299 AGGGAGAGCGCAGTAGTTTTGGG + Intergenic
1016142505 6:140629667-140629689 AGAGAAATGGCAGTGCTTAAAGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016463845 6:144306554-144306576 GTGGAGAGGGCAGTGCATAAGGG + Intronic
1017823728 6:158066633-158066655 AGGGTGAGGGCAGTGACTTTGGG + Exonic
1017856792 6:158356743-158356765 AAGGAGAGGGCAGTGCTGTAAGG + Intronic
1018076991 6:160226239-160226261 AGTGAGCCGGCAGTGCTGATTGG - Intronic
1018925943 6:168207155-168207177 AGGTAGAGGGAAGAGCTTACTGG - Intergenic
1019051008 6:169183696-169183718 TGGGAGGGGGAAGTTCTTATAGG - Intergenic
1019381342 7:725953-725975 AGGGAGAGGGCAGTGCTTATTGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021884984 7:25129436-25129458 AGGGACAGGGCAGTGATTGCAGG - Intergenic
1022482453 7:30752860-30752882 ATGGGGAGGGCAGTGATCATCGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1024377092 7:48652381-48652403 AGAGAGAAGGCACTGCCTATGGG + Intergenic
1024947122 7:54819864-54819886 AAGGAGAGGAAAGTTCTTATGGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1026340285 7:69428831-69428853 AGGGTGAGGGCAGAGCTCCTGGG - Intergenic
1027362398 7:77422776-77422798 AGGGAGTGGGGAGTGCTGATTGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027561719 7:79739620-79739642 GGGCAGAGGGCAGCGCTCATCGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029435842 7:100563653-100563675 AGGGAGAGGGCAGGGTTGTTTGG + Intronic
1030472456 7:109982262-109982284 AGGGAATGGGAAGTGCTGATTGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031009409 7:116509910-116509932 AGAAAGATGGCAGTGATTATGGG - Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1032415865 7:131734959-131734981 ATGGAGGGGGCAGTGGTCATTGG - Intergenic
1032472262 7:132187150-132187172 AGGGAGTGGGGAATGCTGATTGG - Intronic
1033089228 7:138369857-138369879 AGGGAATGGGGAGTGCTGATTGG - Intergenic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034282148 7:149861921-149861943 AGGGAGAGGACAGTCCTGACGGG + Exonic
1034533264 7:151710563-151710585 AGGGAGAGGGCAGGGCTCCCGGG - Intronic
1034544060 7:151778162-151778184 AGGGAACGGGCACTGCTGATTGG - Intronic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1035235707 7:157496602-157496624 TGAGTGACGGCAGTGCTTATTGG + Intergenic
1036522561 8:9505496-9505518 AGGGAGAGGCCAGTAATTTTAGG - Intergenic
1039399107 8:37253566-37253588 AGTAAGAGGGCAGAGCTTGTAGG + Intergenic
1039802899 8:40975336-40975358 TGGGGGAGGGCAGTGCTCATGGG - Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1041852353 8:62405565-62405587 ACGGAGAGAGCAGTGATTATGGG - Intronic
1042148811 8:65759522-65759544 AGGGAGAGGCCACTGTTTTTTGG - Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043973099 8:86554642-86554664 TGGGGGAGGACAGAGCTTATAGG + Intronic
1044464849 8:92490919-92490941 AAGAAGAAGGCAGTGCTGATTGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1045095961 8:98798969-98798991 AGGCAGAGAGCAGCCCTTATTGG + Intronic
1045630907 8:104120822-104120844 GGGGTGAGAGCATTGCTTATAGG + Intronic
1045870233 8:106918284-106918306 AGGCAGAGGTCAGAGCTGATTGG - Intergenic
1046215617 8:111141604-111141626 AGAGAGAGTGAAGTGATTATAGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1046953979 8:120044581-120044603 AGGGGGAGGGCAGGGCATGTTGG + Intronic
1047719763 8:127628892-127628914 CGAGAGAGGGCAGGGCTAATAGG - Intergenic
1048185641 8:132238129-132238151 AGGGAAAGGAATGTGCTTATTGG - Intronic
1049241081 8:141537682-141537704 AGGGGGAGGGCAGGGCTGATGGG - Intergenic
1049922326 9:376948-376970 AGGGAGAAGGCAGGCCTCATGGG - Intronic
1050289224 9:4136762-4136784 AGGGAGAAGACAGAGCTTAGAGG + Intronic
1051021572 9:12549971-12549993 TGGCATAGGGCAGTGTTTATAGG + Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051507592 9:17843319-17843341 AGGGAGAGGGCACAGCTTTGAGG - Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1053349494 9:37403614-37403636 AGGGATTGGGGAGTGCGTATTGG + Intergenic
1053614082 9:39745303-39745325 AGGAAGCGGGGAGTGCTGATTGG - Intergenic
1053872112 9:42503244-42503266 AGGAAGTGGGGAGTGCTGATTGG - Intergenic
1053900639 9:42792719-42792741 AGGAAGCGGGGAGTGCTGATTGG + Intergenic
1054239435 9:62597090-62597112 AGGAAGCGGGGAGTGCTGATTGG + Intergenic
1054261007 9:62864823-62864845 AGGAAGTGGGGAGTGCTGATTGG - Intergenic
1054553566 9:66631617-66631639 AGGAAGCGGGGAGTGCTGATTGG + Intergenic
1055086848 9:72323190-72323212 AGGGAAAGGAATGTGCTTATTGG + Intergenic
1055410904 9:76028441-76028463 AGGAAGTGGGGAGTGCTGATTGG + Intronic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058386637 9:104444408-104444430 AGGGAGAGAGGAATGCATATGGG - Intergenic
1058900910 9:109441444-109441466 AGGGAGAGGGGAGAGCATCTGGG - Intronic
1059136399 9:111810753-111810775 AGGAAGTGGGGAGTGCTGATTGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1060210957 9:121710125-121710147 AGGGAGAGGGCAGTACTGTGGGG - Intronic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1060796593 9:126516248-126516270 AGGGAGAGAGCTGTGCGTAGAGG + Intergenic
1061509164 9:131049956-131049978 AGGGAAAGGGCAGAGCTGGTCGG - Intronic
1061916156 9:133755566-133755588 AGAGAGAGGGCTGTGCCTCTTGG + Intergenic
1062084287 9:134641007-134641029 AGGGAGAAGGCATTCCTGATCGG - Intergenic
1062221637 9:135419251-135419273 AGGGAGAGGGCAGTGGTGGGTGG - Intergenic
1185480998 X:446195-446217 GGGGAGAGGGCAGAGCTCCTGGG + Intergenic
1185946179 X:4379132-4379154 AGGAAGTGGGGAGTGCTGATTGG + Intergenic
1186833205 X:13411776-13411798 AGGGAGTAGGGAGTGCTGATTGG - Intergenic
1187161435 X:16768841-16768863 AAGGAGTGGGGAGTGCTGATTGG - Intergenic
1187208262 X:17203511-17203533 AGGGAGAGTGCACTATTTATTGG + Intergenic
1187420472 X:19129664-19129686 AGGGCGAGGGCAGAGCTGAAAGG - Intergenic
1187837224 X:23445112-23445134 AGAGAGAGCTCACTGCTTATTGG + Intergenic
1188148575 X:26644836-26644858 AGGAAGTGGGGAGTGCTGATTGG + Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188747316 X:33862171-33862193 AGGGAGTGGGGAGTGTTGATTGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189858962 X:45252606-45252628 AGGGGGAGGGCAGTGCCAGTGGG + Intergenic
1190263191 X:48811905-48811927 AGGAAGAGGGCAGTGGGTACAGG - Intronic
1190877135 X:54467988-54468010 AGGGTGAGGGCAGTATTTGTGGG + Intronic
1192197260 X:69036843-69036865 AGGGAGGGGGCAGGGCTCTTGGG - Intergenic
1192234864 X:69289358-69289380 AGGGAGGGGGCAGTGCTGGAAGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192843385 X:74880829-74880851 AAGGAGAGAGCAGTGTATATGGG - Intronic
1193098221 X:77578040-77578062 AAGGAGAGTGCAGTGATCATAGG + Intronic
1193335585 X:80285035-80285057 AGGGAGAGGGAAGTGTGCATGGG + Intergenic
1193523575 X:82560563-82560585 AGGAAGTGGGGAGTGCTGATTGG - Intergenic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194824689 X:98547320-98547342 AGGGAGAGGTTAGTGCTGAAGGG - Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1196186632 X:112751164-112751186 GGGGAGAGGACAGTGGTGATGGG - Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197724496 X:129767700-129767722 AGGGAGAAGGCAATGCTGAGGGG - Intronic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1201733338 Y:17229749-17229771 AGGAAGAAGGGAGTGCTGATTGG + Intergenic