ID: 1019381651

View in Genome Browser
Species Human (GRCh38)
Location 7:727278-727300
Sequence CTGCAGCTGCGCCGCCGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 1, 2: 0, 3: 30, 4: 326}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019381643_1019381651 14 Left 1019381643 7:727241-727263 CCCTGCTCGACCCCTTCGCCGCC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG 0: 1
1: 1
2: 0
3: 30
4: 326
1019381648_1019381651 -4 Left 1019381648 7:727259-727281 CCGCCGTGCGCCGCGAGAGCTGC 0: 1
1: 0
2: 2
3: 8
4: 82
Right 1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG 0: 1
1: 1
2: 0
3: 30
4: 326
1019381649_1019381651 -7 Left 1019381649 7:727262-727284 CCGTGCGCCGCGAGAGCTGCAGC 0: 1
1: 0
2: 0
3: 10
4: 74
Right 1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG 0: 1
1: 1
2: 0
3: 30
4: 326
1019381646_1019381651 3 Left 1019381646 7:727252-727274 CCCTTCGCCGCCGTGCGCCGCGA 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG 0: 1
1: 1
2: 0
3: 30
4: 326
1019381647_1019381651 2 Left 1019381647 7:727253-727275 CCTTCGCCGCCGTGCGCCGCGAG 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG 0: 1
1: 1
2: 0
3: 30
4: 326
1019381645_1019381651 4 Left 1019381645 7:727251-727273 CCCCTTCGCCGCCGTGCGCCGCG 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG 0: 1
1: 1
2: 0
3: 30
4: 326
1019381644_1019381651 13 Left 1019381644 7:727242-727264 CCTGCTCGACCCCTTCGCCGCCG 0: 1
1: 0
2: 1
3: 9
4: 91
Right 1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG 0: 1
1: 1
2: 0
3: 30
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019381651 Original CRISPR CTGCAGCTGCGCCGCCGCCC TGG Exonic