ID: 1019381651

View in Genome Browser
Species Human (GRCh38)
Location 7:727278-727300
Sequence CTGCAGCTGCGCCGCCGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 1, 2: 0, 3: 30, 4: 326}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019381649_1019381651 -7 Left 1019381649 7:727262-727284 CCGTGCGCCGCGAGAGCTGCAGC 0: 1
1: 0
2: 0
3: 10
4: 74
Right 1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG 0: 1
1: 1
2: 0
3: 30
4: 326
1019381646_1019381651 3 Left 1019381646 7:727252-727274 CCCTTCGCCGCCGTGCGCCGCGA 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG 0: 1
1: 1
2: 0
3: 30
4: 326
1019381648_1019381651 -4 Left 1019381648 7:727259-727281 CCGCCGTGCGCCGCGAGAGCTGC 0: 1
1: 0
2: 2
3: 8
4: 82
Right 1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG 0: 1
1: 1
2: 0
3: 30
4: 326
1019381647_1019381651 2 Left 1019381647 7:727253-727275 CCTTCGCCGCCGTGCGCCGCGAG 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG 0: 1
1: 1
2: 0
3: 30
4: 326
1019381644_1019381651 13 Left 1019381644 7:727242-727264 CCTGCTCGACCCCTTCGCCGCCG 0: 1
1: 0
2: 1
3: 9
4: 91
Right 1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG 0: 1
1: 1
2: 0
3: 30
4: 326
1019381643_1019381651 14 Left 1019381643 7:727241-727263 CCCTGCTCGACCCCTTCGCCGCC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG 0: 1
1: 1
2: 0
3: 30
4: 326
1019381645_1019381651 4 Left 1019381645 7:727251-727273 CCCCTTCGCCGCCGTGCGCCGCG 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG 0: 1
1: 1
2: 0
3: 30
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019381651 Original CRISPR CTGCAGCTGCGCCGCCGCCC TGG Exonic
900137557 1:1124825-1124847 CTGCAGCAGTGCCGTGGCCCAGG - Intergenic
900384836 1:2405753-2405775 CTACCGCTGAGCCGGCGCCCGGG - Exonic
900557525 1:3287834-3287856 CTGCAGCCGCCCCGCCACGCGGG + Intronic
900787028 1:4655616-4655638 CTGGAGCAGCACCGCGGCCCTGG + Intronic
901055965 1:6448737-6448759 CGGCAGCTGGGCCGCTGCCCCGG + Exonic
901084772 1:6603595-6603617 CTGCAGCTGCGACGCAGACTCGG - Intronic
902478430 1:16699902-16699924 CGGCAGCTGGGCCGCTGCCCCGG - Intergenic
903055571 1:20633772-20633794 CTGCAACCGCGCCGCCAGCCCGG - Exonic
903497348 1:23778548-23778570 CTGCCGCTGCGCCGCCGAACGGG + Exonic
903555067 1:24187256-24187278 CTGCCGCGGCGTCCCCGCCCGGG + Exonic
903743905 1:25574038-25574060 GTGCAGCAGCGCTGCCGGCCAGG - Intergenic
903883795 1:26529862-26529884 CCCCGGCTGCGCCGCCTCCCGGG - Intronic
904831071 1:33307126-33307148 GTGCAGCTGCGCCACCGACTCGG + Exonic
905031220 1:34885636-34885658 CTGCAGCTCCGCCGACGGGCTGG - Exonic
905463078 1:38134021-38134043 CTCCGCCTGCTCCGCCGCCCCGG - Intergenic
905483074 1:38275058-38275080 CAGCAGCTGCTCCCCCACCCTGG + Intergenic
906027001 1:42682513-42682535 CGGCAGCTGCGGCTCCTCCCGGG - Exonic
906207526 1:43995157-43995179 CTGCAGGTGAGCCGCAGCCCTGG + Exonic
907222976 1:52921102-52921124 CTCCAGCCGCGCGCCCGCCCTGG - Intronic
908380554 1:63593625-63593647 CTGCCGCTGCGCCGGCTCCACGG - Intronic
913218297 1:116638933-116638955 TTCCAGCTGCGCCACTGCCCAGG + Intronic
914803212 1:150974912-150974934 CTGCGGCTGCCCCTTCGCCCCGG + Exonic
916651684 1:166839654-166839676 CTGCCGCGGCCCAGCCGCCCGGG - Intronic
916785743 1:168085864-168085886 CTGCTGCTGCTCCACCACCCCGG + Intronic
918046622 1:180945415-180945437 CTGCAGCTGCAGCGCTCCCCAGG + Exonic
919070689 1:192751496-192751518 GGGCAGCTCCGCCGCAGCCCTGG + Intergenic
920298089 1:204971922-204971944 TTGCAGCTGAGCCTCAGCCCTGG + Intronic
920556744 1:206909708-206909730 CTGCAGGTGAGCCGCCGGGCGGG - Exonic
921229165 1:213051258-213051280 GTGCAGCTGAGGCGCCGCCGTGG + Exonic
922705615 1:227788632-227788654 CTTCCGCTCCTCCGCCGCCCGGG - Intergenic
922784301 1:228275563-228275585 CCGCAGCTGCGCACCCTCCCGGG - Intronic
923127003 1:231041011-231041033 CTGAAGCTGGGCCGCCCCCTGGG - Intergenic
923171497 1:231421628-231421650 CGGCTGCAGTGCCGCCGCCCAGG - Exonic
923261476 1:232272253-232272275 TTGCAGCCACGCCGCAGCCCTGG + Intergenic
924527424 1:244864381-244864403 CTGCGGCTGCTCCTCGGCCCGGG + Exonic
1064380463 10:14837774-14837796 CAGCTGCTGCGCCGCAGCGCGGG + Intronic
1065101594 10:22336535-22336557 CTGCCGCGGCGCGGCCGCGCCGG - Intergenic
1066369643 10:34809610-34809632 CTGCAGCTGCTCCACCCCCTGGG - Intronic
1068352610 10:55868837-55868859 CTGCTACTGCACCGCAGCCCTGG - Intergenic
1069588956 10:69630308-69630330 CTGCAGGTGAGTCGCCGCGCCGG + Exonic
1069774440 10:70918586-70918608 CTGCAGCCTCTCCGTCGCCCGGG - Intergenic
1069774450 10:70918617-70918639 CTGCAGCCCCTCCGTCGCCCGGG - Intergenic
1069774460 10:70918648-70918670 CTGCAGCCCCTCCGTCGCCCGGG - Intergenic
1069774470 10:70918679-70918701 CTGCAGCCCCTCCGTCGCCCGGG - Intergenic
1069774480 10:70918710-70918732 CTGCAGCCCCTCCGTCGCCCGGG - Intergenic
1069774490 10:70918741-70918763 CTGCAGCCCCTCCGTCGCCCGGG - Intergenic
1069774500 10:70918772-70918794 CTGCAGCCCCTCCGTCGCCCGGG - Intergenic
1069774510 10:70918803-70918825 CTGCAGCCCCTCCGTCGCCCGGG - Intergenic
1069893176 10:71664535-71664557 CTGCTGCTGAGCCTCCTCCCAGG - Intronic
1071309437 10:84328765-84328787 CTGCAGCTGGGCCGCGGCCGAGG + Exonic
1071997722 10:91163507-91163529 CAGCAGCGGCGCCTCCGCCGAGG + Intronic
1072294203 10:93993887-93993909 CGGCAGCGGGGCCCCCGCCCTGG - Intergenic
1072465140 10:95656343-95656365 ATGCCGGTGCGCGGCCGCCCCGG - Intronic
1072876228 10:99175665-99175687 CTGCAGCTGCCCCTTCTCCCAGG - Intronic
1074814510 10:117134343-117134365 CTGCAGCGGCGCCCGCGCCCAGG + Exonic
1075779079 10:125005407-125005429 CTGCTGCTGCCCCGACACCCAGG + Intronic
1076751928 10:132547564-132547586 CTGCACCCTCGCCGTCGCCCTGG + Intronic
1076858416 10:133128423-133128445 GTGCAGCTGCGGCGCCACCCAGG + Exonic
1076861559 10:133140372-133140394 CTGCCCCTGCCCCGCCACCCTGG + Intergenic
1076895407 10:133308987-133309009 AGGCAGCGGCTCCGCCGCCCCGG - Exonic
1077198895 11:1295696-1295718 CTGCAGCTGCTGGGCCGCCTGGG + Exonic
1077281762 11:1749204-1749226 CTGCAGCCGCGCGGCCGGTCTGG - Intronic
1077416508 11:2426569-2426591 CTACAGGTGCCCCGCTGCCCTGG - Intergenic
1078164564 11:8871072-8871094 CTGCAGCCCGGCCGCAGCCCGGG - Intronic
1079297008 11:19242370-19242392 CCGAGGCAGCGCCGCCGCCCCGG - Intergenic
1080230919 11:30017096-30017118 CTGCACCCGCCCCGCCGCGCCGG - Intergenic
1080802226 11:35619052-35619074 CTCCAGCCACGCCGCCGCCTGGG - Exonic
1083274173 11:61587611-61587633 CTGCAGCTGGGACTCAGCCCAGG - Intergenic
1083807528 11:65083999-65084021 CTCCTCCAGCGCCGCCGCCCCGG + Exonic
1083893248 11:65607332-65607354 CCGCACGTGCGCCGCCGCCGCGG - Exonic
1084112506 11:67023255-67023277 CCGGAGCTGCGCCGCAGTCCGGG - Intronic
1084387743 11:68854789-68854811 CCGCGGCTGCGCGGGCGCCCTGG - Intergenic
1085043743 11:73341901-73341923 CTGCAGCTGTGCCTCAGCCCTGG - Intronic
1085208146 11:74749312-74749334 CGGCAGCCGCGCCCCCGTCCCGG - Exonic
1089153997 11:116386443-116386465 CTGCAGCAGCTCTGCGGCCCTGG + Intergenic
1089299334 11:117489202-117489224 CTGCAGCTGCCCCGCCGCAGAGG - Intronic
1093194333 12:16112287-16112309 GTGCAGCTGTGCCGGCCCCCTGG + Intergenic
1094041111 12:26122617-26122639 CCGCCGCCGCGCCGCCCCCCGGG + Exonic
1094061032 12:26315906-26315928 CTGCAGCTGCCCCTTCCCCCAGG + Intergenic
1096284130 12:50283519-50283541 CTGCTCCTGCGGCCCCGCCCCGG + Intronic
1096460848 12:51820895-51820917 CTGCCGCCGCGCCGTCGTCCCGG + Intergenic
1096788917 12:54033347-54033369 CTGCAGCGCCGCGGCCGCTCCGG + Exonic
1096791390 12:54047344-54047366 CTGCAGCGGCCCCGCGGCGCGGG - Intronic
1096870262 12:54588399-54588421 CCGCACCTGCTCCGCCGCCTCGG + Exonic
1097293735 12:57941736-57941758 CTGCAGCTGCTCCCCTGCCGCGG - Exonic
1098255399 12:68610940-68610962 CTGCCGCTGCCGCGCCGCTCCGG - Exonic
1100186368 12:92144969-92144991 GGGAAGCTGCGCCGCTGCCCCGG - Intronic
1100330116 12:93573435-93573457 CTGCAGCCGCAGCTCCGCCCGGG - Intronic
1101466923 12:104958361-104958383 GCGCAGCCGCGCCGCCGCCGGGG + Intronic
1103562538 12:121800126-121800148 ATGCAGATGAGCCGCCGCCCGGG - Intronic
1104914692 12:132258600-132258622 CGGCAGCTGCACCGAAGCCCGGG + Intronic
1105011901 12:132761790-132761812 CCACAGCATCGCCGCCGCCCGGG + Exonic
1106246534 13:27954528-27954550 CTGGGTCTGCGCCGCTGCCCGGG - Intergenic
1109900745 13:68766035-68766057 CTGCAACTCCTCCGCCTCCCAGG - Intergenic
1110705334 13:78597328-78597350 CTGCCTCTGCCCCGCCGCCCCGG - Intergenic
1111940514 13:94602011-94602033 CTTCAGCAGCACCGCGGCCCAGG + Exonic
1112570418 13:100588687-100588709 CTGCGCCTGCTCCGCCCCCCAGG - Intronic
1113591783 13:111506529-111506551 CTGCAGCGGCCCAGCCTCCCAGG - Intergenic
1117549094 14:56816753-56816775 CTCGAGCTGCGCCGCCCCGCTGG + Intergenic
1118351002 14:64972369-64972391 CTGCGCCGCCGCCGCCGCCCCGG + Intronic
1118463922 14:66013820-66013842 CGGCAGCTGCGGCTCCTCCCGGG + Intergenic
1119261012 14:73237992-73238014 CGGCACCTGCGCGGCCACCCCGG + Intronic
1119522150 14:75294322-75294344 CAGCCACTGCGCCGCCGGCCCGG + Intergenic
1119539292 14:75428199-75428221 CTGCAGCCGGGCCCCGGCCCCGG + Intronic
1119879655 14:78090354-78090376 CTGCAGCTGCCCATCCACCCTGG + Intergenic
1120765178 14:88322327-88322349 CTGGAGCTGCGCCGCATGCCCGG - Intronic
1121828956 14:97033507-97033529 CAGCTGCTGCGCCGCGCCCCGGG - Intergenic
1121951243 14:98172499-98172521 CAGCAGCTGGGCTGCCCCCCAGG - Intergenic
1122445030 14:101761819-101761841 CAGCAGCAGCGCCCCCGCCCCGG - Exonic
1122469375 14:101955934-101955956 CTGCTGCTGCGCGGGCGTCCCGG + Intergenic
1122605563 14:102945395-102945417 CTGCAGCTGTTCCTCCTCCCAGG + Intronic
1123216353 14:106812873-106812895 CAGCGGCTGCTCCGCTGCCCGGG - Intergenic
1123413006 15:20074431-20074453 CGGCAGCTGCGCGGCGGCACCGG - Intergenic
1123522348 15:21081544-21081566 CGGCAGCTGCGCGGCGGCACCGG - Intergenic
1126467689 15:48975925-48975947 CGCCAGCTCCGCGGCCGCCCCGG + Intergenic
1127286658 15:57539086-57539108 CTGCAGCTGTGCTCCCGGCCAGG - Intronic
1127687669 15:61364743-61364765 CTGCAGCTGCCCCTCCCCCTAGG + Intergenic
1128262334 15:66241155-66241177 CCGCAGCTGCTCCTCCTCCCAGG + Intronic
1128539902 15:68519122-68519144 CTGCAGCTGCTCCACACCCCAGG + Intergenic
1129150472 15:73684751-73684773 CTGCAGGTCCGACGGCGCCCGGG - Intronic
1130013740 15:80172099-80172121 CTGGAGCTGATCTGCCGCCCAGG - Intronic
1130224159 15:82045252-82045274 CCGGAGCCGCGCCGCTGCCCTGG - Intronic
1130517151 15:84634103-84634125 CCGCTGCAGCGCCGCCGTCCAGG + Intergenic
1130564202 15:84980868-84980890 CTGTAGCTTTGCGGCCGCCCCGG + Intronic
1131262606 15:90895490-90895512 CTGAAGCTGGGCCGCTGCCCAGG - Exonic
1132053002 15:98625943-98625965 CTGCAGCTGCACTGCAGCCTGGG + Intergenic
1132501936 16:288375-288397 CTGCATGTGCGCCCCCTCCCAGG + Intronic
1132508156 16:322885-322907 CTGCAGCTGCGTCCCAGCTCTGG + Intronic
1132807864 16:1783361-1783383 TTGCAACTGCACCGCAGCCCGGG + Intronic
1133311305 16:4848127-4848149 CGCTAGCTGCGCCGCCGCCCGGG + Intronic
1133650159 16:7805294-7805316 CAGCAGCTTCGCAGCCTCCCTGG + Intergenic
1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG + Exonic
1135196532 16:20399439-20399461 CTGCAGCTTGGCAGCAGCCCTGG + Intronic
1135821858 16:25692290-25692312 CCGCCGCTGCCCAGCCGCCCCGG - Exonic
1136861550 16:33707235-33707257 CCGCGCCTGCGCCGCCGCCGTGG + Intergenic
1136861558 16:33707264-33707286 CCGCGCCTGCGCCGCCGCCCTGG + Intergenic
1137758022 16:50918111-50918133 CCGCAGCTGCTCAGCAGCCCCGG + Intergenic
1138501461 16:57447557-57447579 CTGCAGCTGCGATGCCTGCCCGG + Exonic
1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG + Intergenic
1139778243 16:69330462-69330484 TTGCAGCTCCACGGCCGCCCCGG - Exonic
1140478776 16:75251579-75251601 CGGCAGCTGCGCGGCGGCACCGG - Intronic
1141427609 16:83953878-83953900 CTGCAGCTCCCCAGCCTCCCAGG - Intronic
1141900259 16:86986349-86986371 CTGCAGCTTCGCAGGAGCCCCGG + Intergenic
1142222305 16:88861526-88861548 CTGCAGCTGAGCCAACGCCGCGG - Exonic
1142411564 16:89919581-89919603 CTGCTGCAGCACCGCAGCCCGGG - Exonic
1142586853 17:979436-979458 CTCGGGCTCCGCCGCCGCCCCGG + Exonic
1142685396 17:1574675-1574697 CTGCAGCTGGGCCAGTGCCCAGG - Exonic
1144339742 17:14301674-14301696 CGGCTCCTGCGCCGCCGCGCCGG + Exonic
1144355202 17:14438706-14438728 CTGCAGCTGAGCAGCTGGCCAGG - Intergenic
1144490615 17:15704962-15704984 CAGCAGTTGGGCCCCCGCCCCGG - Intronic
1144513091 17:15894418-15894440 CTGCAGCTACTCCTTCGCCCTGG - Intergenic
1144519834 17:15945992-15946014 CTGCCGCTGCACCGCCGCTGCGG - Intronic
1144642230 17:16943885-16943907 CTGCACCTGCCCCGGAGCCCGGG + Intronic
1146169919 17:30625041-30625063 GTTCAGCTGCGCCTCCGCCAGGG - Intergenic
1146343372 17:32041071-32041093 GTTCAGCTGCGCCTCCGCCAGGG - Intronic
1146371121 17:32266099-32266121 CTGGAGCGGCGCGGCCGCCGCGG + Intergenic
1147659992 17:42112337-42112359 CTGCTGCTGCGCCAGCGCCCTGG + Intronic
1147660312 17:42113699-42113721 CTGCCGCTGTGCCAGCGCCCTGG - Exonic
1148441370 17:47713341-47713363 CTGCACCTGAGCCGTCTCCCAGG - Intergenic
1149833678 17:59893364-59893386 CTGAGCCCGCGCCGCCGCCCCGG - Intronic
1150289723 17:63974186-63974208 TTGCAGCAGCGCCCCTGCCCTGG + Intergenic
1150407947 17:64919097-64919119 GGGCAGGTGGGCCGCCGCCCAGG - Intronic
1150653533 17:67024995-67025017 CTGCAGGTGAGCCGCCCGCCCGG + Exonic
1150747275 17:67825868-67825890 GGGCAGGTGGGCCGCCGCCCAGG + Exonic
1151326191 17:73380967-73380989 CTCCCTCTGCGCCCCCGCCCCGG - Intronic
1151459964 17:74248635-74248657 CTGCAGCTGCCCTGGGGCCCAGG + Intronic
1151674401 17:75590137-75590159 CTGGAGCTGAGCCTCCGGCCGGG + Intergenic
1152103019 17:78313987-78314009 CAGCCGCTGCGGCGCGGCCCCGG + Intergenic
1152625356 17:81385634-81385656 CAGCAGCTGAGCCTGCGCCCTGG - Intergenic
1152685167 17:81690370-81690392 CAGCTGCTACGCCTCCGCCCAGG - Intronic
1152708042 17:81855500-81855522 CTGCAGCTGCGCCGTCAGGCAGG + Exonic
1152751788 17:82065691-82065713 CTCCGGCCTCGCCGCCGCCCGGG + Intronic
1154502380 18:15003286-15003308 CCTCAGCTGCGCCCCCGCTCAGG - Intergenic
1156171764 18:34494069-34494091 CTGCTGCCGCGGCGCCGCTCGGG + Intronic
1157753012 18:50194986-50195008 CCGTAGCTGCGCCGCCGCGGCGG - Exonic
1159298136 18:66523418-66523440 CTGCAGCTGCACCTCCTCCAAGG - Intronic
1160100684 18:75916847-75916869 CTGCACCTGCGCGGAGGCCCAGG + Intergenic
1160453599 18:78980679-78980701 CCGCCGCCGCGCCGCCCCCCAGG + Intronic
1160663402 19:311975-311997 CTTCCGCTGCGGCCCCGCCCTGG - Intronic
1160663421 19:312032-312054 CTTCCGCTGCGGCCCCGCCCTGG - Intronic
1160663441 19:312089-312111 CTTCCGCTGCGGCCCCGCCCTGG - Intronic
1160663460 19:312146-312168 CTTCCGCTGCGGCCCCGCCCTGG - Intronic
1160706306 19:531784-531806 CTGCGCCGCCGCCGCCGCCCGGG - Exonic
1161103041 19:2430709-2430731 CTGCCACTTCGCCGCTGCCCCGG - Exonic
1161155759 19:2731326-2731348 CTGCAGCAGGGCCACCGGCCGGG + Intronic
1162741767 19:12777710-12777732 CTGAAGCTGCCGCGTCGCCCGGG + Intronic
1162913362 19:13861861-13861883 CTGCTGCTGTGTCGCAGCCCTGG + Intergenic
1162953535 19:14085743-14085765 CCGGAGCCGCGCCGCCGCGCCGG + Exonic
1163513076 19:17747711-17747733 CGGCAGCCGCGCCGCAGCCGCGG + Exonic
1163830333 19:19544494-19544516 CTGCAGCTGCTCCGCGGAGCCGG - Exonic
1165096153 19:33410981-33411003 GAGCAGCTGGGCCGCTGCCCCGG - Intronic
1165463735 19:35959755-35959777 CTGGTGCTGCGACGCCGACCGGG + Intergenic
1165493545 19:36139539-36139561 CAGCGCCTGCGCCGCCTCCCAGG - Intergenic
1166100364 19:40567988-40568010 CCGCACCTGCTCCGCCGCCGCGG - Exonic
1166536232 19:43576636-43576658 CTCCAGCTGCGACCCCACCCAGG - Intronic
1167152693 19:47719041-47719063 CTGCGGCTGCCCCGCCAGCCAGG - Intronic
1167220558 19:48195941-48195963 GTGCAGCTGCGCCCCCCTCCAGG - Intronic
1167418812 19:49390855-49390877 CAGCAGCTGCGCCGCGGCAGGGG + Exonic
1202712449 1_KI270714v1_random:25733-25755 CGGCAGCTGGGCCGCTGCCCCGG - Intergenic
925012840 2:498607-498629 CTGCTGCTGCTCCGTCGGCCTGG + Intergenic
925084482 2:1097240-1097262 CTGCACCTGCACCGCTGGCCGGG + Intronic
925893917 2:8457097-8457119 CTGCACCTGCCCGGCCGCCTAGG + Intergenic
926453889 2:13040485-13040507 CTGCAGCTGCACCTCCTCCTAGG - Intergenic
926541143 2:14182735-14182757 CTGCAGCAGAGCCTCCTCCCAGG - Intergenic
928158113 2:28894895-28894917 CTGCAGCCGCGCTGGCGCCCAGG - Exonic
929532745 2:42762895-42762917 CTGCAGCTGGCCCTCAGCCCTGG + Exonic
930056521 2:47256640-47256662 CTGCAGCTGAGCCTCACCCCTGG - Intergenic
931762539 2:65431063-65431085 AGGCAGCTGCACCTCCGCCCCGG + Intronic
935237522 2:101151150-101151172 CTGCAGCGGCGCCGCGGGCACGG - Exonic
937375893 2:121335416-121335438 CTGTAGCGGCGGCGCTGCCCGGG + Intergenic
939033317 2:137101934-137101956 CCGCAGCTGCGCCTTCCCCCAGG - Intronic
943185167 2:184598315-184598337 CTGCGGCAGCGGCGCCGCGCGGG + Intergenic
944172976 2:196799736-196799758 CTGCAGCTGCGGCGCAGACCGGG - Intergenic
946375999 2:219309244-219309266 CTGCTGCTGAGCAGCCGCCCGGG - Exonic
946382586 2:219358895-219358917 CTGCTGCTGAGCAGCCGCCCGGG - Intergenic
948322934 2:237085563-237085585 CTGCAGCTGCTCGGCTGTCCCGG - Exonic
948805712 2:240452818-240452840 GTGCGGCTGCGGCGCTGCCCGGG + Intronic
948806067 2:240453816-240453838 CGGCGGCAGCGTCGCCGCCCTGG - Intronic
948874482 2:240819628-240819650 CTGCAGCCGCGCACCCTCCCAGG + Intronic
1168904495 20:1392673-1392695 CTGCCCCTGAGCCACCGCCCAGG + Intronic
1170133961 20:13052937-13052959 CTGCAGCTGCCCCTTCCCCCAGG - Intronic
1170674521 20:18467006-18467028 CTCCTCCTTCGCCGCCGCCCGGG + Exonic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1172008596 20:31833660-31833682 CTGCAGCTGCCCCCCTGCCCTGG + Intronic
1173972094 20:47161036-47161058 CCGCAGCTGCACTGCCACCCTGG - Intronic
1174113369 20:48211263-48211285 CTGCAGCTGCCCCTCCACACAGG + Intergenic
1174648346 20:52104581-52104603 CTACAGCAGCGCTGACGCCCTGG + Intronic
1175806209 20:61830565-61830587 CTGCAGCGGCCCCGCCTCCCAGG + Intronic
1175818587 20:61896396-61896418 GTGCAGCTGCGCCCCAGGCCTGG - Intronic
1175922197 20:62455526-62455548 CTGAAGCTGCCCCGCCTCCCAGG + Intergenic
1176182177 20:63755127-63755149 CCGCAGCTGCGGCTCTGCCCTGG - Intronic
1176376910 21:6091402-6091424 CTCCCGCCGCGCCACCGCCCCGG - Intergenic
1177920301 21:27143751-27143773 CCGCAGCGGCGCCTCGGCCCCGG - Intergenic
1178314805 21:31559003-31559025 CTGCAGCTCCGCGGACGCCTTGG - Intronic
1179746565 21:43446842-43446864 CTCCCGCCGCGCCACCGCCCCGG + Intergenic
1179944816 21:44666038-44666060 CTGCAGCTGCGCCCTCCACCCGG + Intronic
1180222815 21:46370190-46370212 CTGCAGCTGCCTCGCTGGCCAGG - Intronic
1180229979 21:46421405-46421427 CTGCAGCTGCGCCAGCCCACAGG - Intronic
1181270819 22:21657619-21657641 CCGCACCTGCGCCGCGGCCGTGG + Intronic
1181474670 22:23160898-23160920 CTTCAGCCGCGTAGCCGCCCTGG + Exonic
1182442742 22:30373700-30373722 CTGCAGCTGCTCCTCCACGCGGG - Exonic
1183650836 22:39152478-39152500 CCGCAGCTCCGCCCCCGGCCCGG - Exonic
1183683769 22:39350209-39350231 CCGCCGCCGCGCCGCCGCCGGGG - Intronic
1183720130 22:39557766-39557788 CAGCACCCGCGCCCCCGCCCCGG + Intergenic
1184037648 22:41926288-41926310 CTGCGGCTGCAGCGCCGTCCTGG + Exonic
1184067744 22:42129893-42129915 CTGCAGTTGCGGCGCCGCTTCGG - Exonic
1184070479 22:42143565-42143587 CTGCAGTTGCGGCGCCGCTTCGG - Intergenic
1184198742 22:42950469-42950491 CTGCAGCTGCACAGCCTCCTAGG + Intronic
1185274194 22:49943326-49943348 CTGCAGAAACGCCGCCACCCAGG - Intergenic
949414411 3:3799927-3799949 CTGCCGCGGCGCGGCCGGCCAGG - Intronic
950168028 3:10816215-10816237 CCGGCTCTGCGCCGCCGCCCCGG - Exonic
951432833 3:22628139-22628161 CTGCAGCTGCGCCTCCCCCAAGG + Intergenic
954481696 3:50805999-50806021 CTGCAGCTGCTCAGCTGGCCTGG + Intronic
956990087 3:74752271-74752293 CTGCAGCTGCACAGGGGCCCAGG + Intergenic
958900141 3:99876289-99876311 GTGTGGCTGCGCCGCCGCCGCGG - Intronic
959984952 3:112561926-112561948 CCGTAGCTGCGCCGCCACCGGGG + Exonic
962708440 3:138066861-138066883 CTTCAGGTGCGCCGTGGCCCAGG - Intronic
963401694 3:144806603-144806625 TTGCAGCTGCTCCTCCCCCCAGG + Intergenic
965206261 3:165721276-165721298 CTGCAGCTGCCCAGTTGCCCTGG - Intergenic
968511433 4:997510-997532 CCGCGGCTGAGCGGCCGCCCGGG - Intronic
968600116 4:1504669-1504691 CTGCATCTGAGCCGCCACTCTGG - Intergenic
968673428 4:1864339-1864361 CTCAAGCTGCCCCGCCTCCCAGG - Intergenic
968962329 4:3751935-3751957 CTGCAGGTGCAGGGCCGCCCTGG - Intergenic
969860739 4:10033724-10033746 CTGCAGCTGCCTGGCCGACCTGG + Intronic
970185316 4:13445967-13445989 CTGCAGCCGCCCCTCCCCCCAGG + Intronic
973694506 4:53476823-53476845 CTGCAGCAGCCCAGCAGCCCTGG - Exonic
973768314 4:54183884-54183906 CTGCAGCTTCTCTGCCTCCCAGG + Intronic
976511191 4:85911116-85911138 CTGCAGCTGCACCTGCACCCAGG + Intronic
976665691 4:87588436-87588458 CTGCAGCTTCGAGGCCACCCTGG - Intergenic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
979205439 4:118033247-118033269 TTGCAGCCTCGCAGCCGCCCTGG + Intergenic
979582787 4:122379621-122379643 CTGCTGCTGCGCCTCAGGCCGGG - Intronic
980130398 4:128811708-128811730 TGGCCGCTGCGCCCCCGCCCCGG + Intronic
981659192 4:147146263-147146285 CTGCAGCTGCGCCTGAGCTCTGG - Intergenic
982745595 4:159102630-159102652 CTGGCGCCACGCCGCCGCCCAGG - Intergenic
986402722 5:7395872-7395894 CTCCCGCTGCGCCCCGGCCCGGG - Intergenic
987085152 5:14461153-14461175 CCGCTGCTGAGCCGCCGCACGGG - Exonic
991110696 5:62896434-62896456 CTGAAGCTGCGCCTTCCCCCAGG + Intergenic
991371633 5:65925767-65925789 CGGCAACAGCGCCACCGCCCCGG - Intergenic
992374416 5:76174300-76174322 CTGCCGCTGCCGCGCCGCTCCGG + Intronic
992597315 5:78360059-78360081 CAGCGGCCGCGCCCCCGCCCCGG + Intergenic
994367001 5:98928434-98928456 CGGCCGCTGGGCCGCCGCCTGGG + Intronic
1000406529 5:160893588-160893610 CTGCAGCTGCCCCTTCCCCCAGG - Intergenic
1001250152 5:170140875-170140897 CTGGAGCTGCCCCTCTGCCCAGG + Intergenic
1006173611 6:32109180-32109202 CTGCAGCTGCTCGGTTGCCCAGG - Intronic
1006677763 6:35776593-35776615 CCGCCGCTGCTCTGCCGCCCAGG + Exonic
1012701185 6:102459136-102459158 CTGCAGCTGCCCCTCCTGCCAGG - Intergenic
1013232099 6:108168449-108168471 CTGCGGCTGCGCCCCCGCTGTGG + Intronic
1015786157 6:136922842-136922864 CACCACCTGCGGCGCCGCCCTGG + Exonic
1017952078 6:159143714-159143736 CTGCAGCTGTGCCTCCTTCCTGG - Intergenic
1019262536 7:89569-89591 CTCCAGCTGGGCCACTGCCCAGG + Intergenic
1019343058 7:517554-517576 CGCCAGGAGCGCCGCCGCCCCGG + Intronic
1019343754 7:519997-520019 CTGCCGCGGCGGCGGCGCCCGGG - Intronic
1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG + Exonic
1019476950 7:1248876-1248898 CTGCAGGTGCGAGGCCGGCCTGG + Intergenic
1019660729 7:2222671-2222693 CTGCATCTTCTCCTCCGCCCCGG + Exonic
1019770385 7:2880644-2880666 CTCCAGCTGGGCCTCTGCCCAGG + Intergenic
1019937385 7:4265269-4265291 GTGCAGCTGCGCGCCCGCCTCGG - Exonic
1022275795 7:28854300-28854322 CGGCAGGTGCGGCGACGCCCAGG - Intergenic
1022638939 7:32163237-32163259 CTGGAGCTTCGGCCCCGCCCTGG - Intronic
1022814999 7:33905212-33905234 CTGCCGCTCAGCCGCCGCCCGGG - Intronic
1024578322 7:50782461-50782483 CTGCGTGTGCGCCGCCGGCCCGG + Intronic
1024965480 7:55019495-55019517 GATCAGCTGCGCCGCCGACCGGG + Intronic
1025233938 7:57220956-57220978 CAGCAGCACCGCCGCCTCCCTGG - Intergenic
1026589744 7:71684433-71684455 CTACAGCTGACCCGCAGCCCAGG + Intronic
1026931297 7:74224317-74224339 CTGCAGCTGCTCCTGCACCCAGG - Intronic
1034589736 7:152129069-152129091 CCGCAGCTCCCCCGCCGCCAGGG - Intergenic
1034988789 7:155534549-155534571 CTGCAGCTGATCCGCCTTCCCGG - Intergenic
1035249070 7:157585218-157585240 CTGCAGCTGCTCCTCAGCCCTGG - Intronic
1035320917 7:158028787-158028809 CTGCAGCTGCCCCGCCCTCCTGG - Intronic
1037450800 8:19014009-19014031 CCGCAGCCGCGCGCCCGCCCTGG + Intronic
1037547698 8:19939968-19939990 CTGCGGCTCAGCCCCCGCCCGGG + Intronic
1039554924 8:38468543-38468565 CTGCGGCTGCACCGGCGTCCCGG + Intronic
1039598486 8:38812390-38812412 TTACAGCTGGGCCGCCGCCGGGG - Intronic
1040018679 8:42721132-42721154 CTGCAGCTGCATAGCCACCCAGG + Intronic
1040777125 8:51058262-51058284 CTGCAGCTGCAGAGCCGCCTCGG + Intergenic
1041201645 8:55455263-55455285 CTGCGGCTGCGGCGGCGGCCCGG + Intronic
1041287344 8:56274061-56274083 CTGAAGCTGCGCCTTCCCCCAGG - Intergenic
1041724548 8:61005873-61005895 CTGCAGCTGCACCCCAGCCGAGG + Intergenic
1042532777 8:69832626-69832648 CTCCAGCTGCTCTCCCGCCCCGG + Exonic
1047961659 8:130016076-130016098 GCGCAGCGGGGCCGCCGCCCGGG - Intronic
1049015103 8:139914464-139914486 CTCCCGCTGCGCTGCTGCCCCGG - Intronic
1049420517 8:142514339-142514361 CCGCATCTGCGCCGACACCCTGG - Intronic
1049457446 8:142700796-142700818 CTCAGGCTGCCCCGCCGCCCTGG - Intronic
1049496665 8:142938870-142938892 CTGCAGCTGCAAAGCAGCCCGGG - Intergenic
1050230921 9:3525589-3525611 CCGCTGCGGCGCCGCCGCCGAGG - Intronic
1051206374 9:14693313-14693335 CTCCTCCGGCGCCGCCGCCCAGG + Exonic
1051513749 9:17907034-17907056 CTGGGGCTGCGCTGCCGCCCAGG + Intergenic
1051641801 9:19230672-19230694 CTGCGCCTGCGCCGCCTCGCGGG - Exonic
1053608117 9:39680984-39681006 CTGCAGCTGCCCCTTCCCCCAGG + Intergenic
1053643123 9:40106765-40106787 CGGCGGCTGCGGCGCAGCCCGGG + Intergenic
1053763027 9:41358724-41358746 CGGCGGCTGCGGCGCAGCCCCGG - Intergenic
1053865958 9:42437344-42437366 CTGCAGCTGCCCCTTCCCCCAGG + Intergenic
1054245414 9:62661425-62661447 CTGCAGCTGCCCCTTCCCCCAGG - Intergenic
1054351008 9:64016751-64016773 CTGCGCCTGCGCCGGCGCTCTGG + Intergenic
1054541633 9:66269838-66269860 CGGCGGCTGCGGCGCAGCCCCGG - Intergenic
1054559543 9:66695956-66695978 CTGCAGCTGCCCCTTCCCCCAGG - Intergenic
1056092631 9:83219332-83219354 CTGCAACTCCGGCGTCGCCCGGG - Intergenic
1056475092 9:86945873-86945895 ATGCAGCAGCGCCGCTGCCCGGG + Exonic
1058237806 9:102514736-102514758 CTGCAGCTGGGCTGCAGCCAAGG + Intergenic
1058885781 9:109320501-109320523 CTGCCGCTGCGCCGCCGCCCGGG + Exonic
1058912582 9:109534363-109534385 CGGCAGCTGCGGCTCCTCCCGGG + Intergenic
1061586915 9:131575460-131575482 CAGCTGCTGCCCCGCAGCCCTGG + Intergenic
1062230515 9:135479574-135479596 CTGCCGCCGCGCCCGCGCCCCGG - Intronic
1062376351 9:136263586-136263608 CTGCAGCTGAGTCCCAGCCCAGG + Intergenic
1062498115 9:136841087-136841109 CCTCAGCTGCGCCCCCGCTCAGG + Exonic
1062596757 9:137302988-137303010 CTCCCGCTGCGCCCCGGCCCGGG - Intergenic
1062731495 9:138112667-138112689 CTGCAGCTCCTCTGCCACCCAGG - Intronic
1185538573 X:883861-883883 CTCCAGCAGCGCGGCCGTCCGGG + Intergenic
1185892030 X:3830066-3830088 CTGCAGCCTCTCCGCCTCCCAGG - Intronic
1185897137 X:3868480-3868502 CTGCAGCCTCTCCGCCTCCCAGG - Intergenic
1185902256 X:3906906-3906928 CTGCAGCCTCTCCGCCTCCCAGG - Intergenic
1187020748 X:15378950-15378972 CTCCAGCTGCACCGGCTCCCTGG + Intronic
1190581376 X:51894960-51894982 CCGCTGCTGCGCTGCCACCCGGG + Intronic
1194708168 X:97200699-97200721 CTGCAGCTGCCCCTCCCCACAGG - Intronic
1195802806 X:108732894-108732916 CGGCTGCTGCGCCGATGCCCGGG + Exonic
1200155417 X:153972347-153972369 CTGCAGCCGCGCCTGCGGCCGGG + Exonic
1200161759 X:154013236-154013258 CTGCAGCTGCTCTGCTGCCTGGG + Exonic