ID: 1019384415 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:746547-746569 |
Sequence | GAGCCTGGGCACGGCGGGCG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1019384415_1019384425 | 12 | Left | 1019384415 | 7:746547-746569 | CCCCGCCCGCCGTGCCCAGGCTC | No data | ||
Right | 1019384425 | 7:746582-746604 | TTTCCCCGCCCGTCGTGCCTAGG | No data | ||||
1019384415_1019384426 | 13 | Left | 1019384415 | 7:746547-746569 | CCCCGCCCGCCGTGCCCAGGCTC | No data | ||
Right | 1019384426 | 7:746583-746605 | TTCCCCGCCCGTCGTGCCTAGGG | 0: 1 1: 0 2: 0 3: 2 4: 28 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1019384415 | Original CRISPR | GAGCCTGGGCACGGCGGGCG GGG (reversed) | Intronic | ||