ID: 1019384415

View in Genome Browser
Species Human (GRCh38)
Location 7:746547-746569
Sequence GAGCCTGGGCACGGCGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019384415_1019384425 12 Left 1019384415 7:746547-746569 CCCCGCCCGCCGTGCCCAGGCTC No data
Right 1019384425 7:746582-746604 TTTCCCCGCCCGTCGTGCCTAGG No data
1019384415_1019384426 13 Left 1019384415 7:746547-746569 CCCCGCCCGCCGTGCCCAGGCTC No data
Right 1019384426 7:746583-746605 TTCCCCGCCCGTCGTGCCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019384415 Original CRISPR GAGCCTGGGCACGGCGGGCG GGG (reversed) Intronic