ID: 1019386565

View in Genome Browser
Species Human (GRCh38)
Location 7:760055-760077
Sequence CCGCGCGGCCCCGTCTCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 148}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019386565_1019386572 2 Left 1019386565 7:760055-760077 CCGAGGGAGACGGGGCCGCGCGG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 1019386572 7:760080-760102 CCTCCAGCTCTGAGGGAGACGGG 0: 1
1: 1
2: 1
3: 37
4: 285
1019386565_1019386577 28 Left 1019386565 7:760055-760077 CCGAGGGAGACGGGGCCGCGCGG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 1019386577 7:760106-760128 GCGCGGCTCCTCCAGCTCCGAGG No data
1019386565_1019386568 -6 Left 1019386565 7:760055-760077 CCGAGGGAGACGGGGCCGCGCGG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 1019386568 7:760072-760094 GCGCGGCTCCTCCAGCTCTGAGG 0: 1
1: 1
2: 0
3: 14
4: 191
1019386565_1019386575 11 Left 1019386565 7:760055-760077 CCGAGGGAGACGGGGCCGCGCGG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 1019386575 7:760089-760111 CTGAGGGAGACGGGGCCGCGCGG 0: 1
1: 1
2: 4
3: 19
4: 266
1019386565_1019386578 29 Left 1019386565 7:760055-760077 CCGAGGGAGACGGGGCCGCGCGG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 1019386578 7:760107-760129 CGCGGCTCCTCCAGCTCCGAGGG No data
1019386565_1019386573 3 Left 1019386565 7:760055-760077 CCGAGGGAGACGGGGCCGCGCGG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 1019386573 7:760081-760103 CTCCAGCTCTGAGGGAGACGGGG No data
1019386565_1019386569 -5 Left 1019386565 7:760055-760077 CCGAGGGAGACGGGGCCGCGCGG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 1019386569 7:760073-760095 CGCGGCTCCTCCAGCTCTGAGGG 0: 1
1: 1
2: 1
3: 11
4: 138
1019386565_1019386570 1 Left 1019386565 7:760055-760077 CCGAGGGAGACGGGGCCGCGCGG 0: 1
1: 0
2: 0
3: 15
4: 148
Right 1019386570 7:760079-760101 TCCTCCAGCTCTGAGGGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019386565 Original CRISPR CCGCGCGGCCCCGTCTCCCT CGG (reversed) Intronic
900142386 1:1144158-1144180 CCGGGCAGCCCCATCACCCTCGG + Intergenic
900645966 1:3708871-3708893 CCACGAGGCCCCGCCTCCCCGGG + Intronic
901666690 1:10830298-10830320 CGGCGCCGCCCCTTCCCCCTCGG + Intergenic
903142255 1:21345634-21345656 CCGCGCGGGCCCTTAACCCTTGG + Intergenic
903153248 1:21428110-21428132 CCGCCCGGCCCCGGCTCCCCGGG - Intergenic
903287410 1:22285719-22285741 CCCCGCAGCCCCGTGACCCTGGG + Intergenic
905108277 1:35576890-35576912 CCGCGTGGCCCCGTCCCGCGCGG - Intronic
905731996 1:40304071-40304093 CCGCGGGGCCCGGTCTTCCCTGG + Exonic
906130736 1:43453795-43453817 CCGCCCGGCCCGGCCTCCCCAGG - Exonic
910277399 1:85464388-85464410 CCTCGCGGCCCTCGCTCCCTGGG + Intronic
911104434 1:94118729-94118751 CCGAGTGGCTCCATCTCCCTGGG + Intronic
912799891 1:112714268-112714290 CTGAGCGCCCCCATCTCCCTCGG + Intronic
913968396 1:143395338-143395360 CCTCGAAGCCTCGTCTCCCTGGG - Intergenic
914062774 1:144220934-144220956 CCTCGAAGCCTCGTCTCCCTGGG - Intergenic
914116376 1:144745420-144745442 CCTCGAAGCCTCGTCTCCCTGGG + Intergenic
915429810 1:155857484-155857506 CCGCCCGCCTCCGTCTCCCAAGG - Intronic
916819825 1:168387296-168387318 CCACGCGGCCGCGCCTCCCGCGG - Intergenic
916961449 1:169893719-169893741 CCGCCCGGCCCCTTCCCCCACGG + Intronic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
1064552893 10:16520839-16520861 CCGCGCGGACCCGCCTTCCCGGG + Exonic
1065122838 10:22544948-22544970 CAGCGAGGCCCCGTGTCACTGGG - Intronic
1066126595 10:32347659-32347681 CCGCGCGCCGCCGTCTGCCGCGG + Intronic
1067216923 10:44310989-44311011 CGGCGCGGCCCCGGCACCCGTGG + Intergenic
1070642655 10:78180658-78180680 CCGGGCTCCCCCTTCTCCCTGGG + Intergenic
1071215904 10:83401071-83401093 CTGCTCTGCCCTGTCTCCCTGGG - Intergenic
1075129542 10:119726226-119726248 CCGCGGGCCGCCGCCTCCCTGGG + Exonic
1077366578 11:2163675-2163697 CCGAGCTGCCCCATCTCCGTGGG - Intergenic
1078216236 11:9314364-9314386 CCCCGCTGCCCCGTCCCCCACGG + Exonic
1083660797 11:64251037-64251059 CCGCGCGGTCCCCCCTCCCTGGG - Intergenic
1084086376 11:66857131-66857153 GCCCGCGGCCCCGGCTCGCTCGG - Intronic
1084973042 11:72781727-72781749 CCGCGCGGCCCCGGGTCTCCCGG - Intronic
1085284669 11:75351882-75351904 CCGCGCTGCCCTGCCTCGCTGGG - Intergenic
1089045970 11:115503050-115503072 CCCCGCGGCCCCGTGCCACTCGG + Intronic
1089499924 11:118925843-118925865 CCGCGCGCCGCCGCCTCCCCGGG + Intronic
1089966253 11:122656561-122656583 CCGCAGGGCCCCGCCTCCCTAGG - Intronic
1091616109 12:2052652-2052674 CCGCGCGCCCCGGCCTCCCCGGG + Intronic
1091718519 12:2795863-2795885 CCGCGCGGCGCCCCCTCCCTCGG + Intronic
1092246736 12:6868020-6868042 CCACGCGGCCCAGCCTCCCCCGG - Intronic
1095206104 12:39442668-39442690 CTGCGCGGCGCCGGGTCCCTGGG - Intronic
1095486332 12:42688535-42688557 CTGCTCGGCCCCATCTCCCCAGG - Intergenic
1096241249 12:49961545-49961567 CCGTGCGCCCCGGACTCCCTGGG - Intergenic
1097872102 12:64610409-64610431 GCCCGCGACCCCGCCTCCCTGGG - Intergenic
1100444805 12:94650515-94650537 CCGCGCCGCCCCCTCGCCCGCGG - Exonic
1101772091 12:107761041-107761063 CCGCTCGGCCCCCTCACCCCGGG + Exonic
1102140913 12:110614174-110614196 CCTCGCGGCCTCATCTCCCAGGG - Exonic
1103091855 12:118103622-118103644 CCCCGCGTCCTCGTCTGCCTCGG - Exonic
1103764488 12:123271145-123271167 GCGCGGGGCCCCGCCGCCCTGGG - Intronic
1103856286 12:123973009-123973031 CCCCGCGCCCCCCCCTCCCTCGG - Intronic
1106335369 13:28778421-28778443 CCCCGAGGCCCCAGCTCCCTGGG - Intergenic
1106498781 13:30307467-30307489 CCGCGCGGCCGCGGCTGCCATGG - Exonic
1113724599 13:112588592-112588614 CCGCGCGGGCCGGTCCCCCCCGG + Intergenic
1115399176 14:32938908-32938930 CCGGGCCGCCCCGGCTCCCGAGG - Intronic
1124322682 15:28726727-28726749 CCGCCCGCCTCCGCCTCCCTGGG + Intronic
1124523513 15:30426861-30426883 CCGCCCGCCTCCGCCTCCCTGGG + Intergenic
1124535154 15:30539353-30539375 CCGCCCGCCTCCGCCTCCCTGGG - Intergenic
1129326477 15:74802654-74802676 CCCTCCGGCCCCGTCTCTCTTGG + Exonic
1129656809 15:77529958-77529980 CAGCCTGGCCCAGTCTCCCTGGG + Intergenic
1130967079 15:88705501-88705523 GCGCGCCGCCCGGGCTCCCTCGG + Intergenic
1131381153 15:91965070-91965092 CCCCACAGCCCCCTCTCCCTGGG - Intronic
1132589580 16:720842-720864 ACGCGCAGCCCCGTTTCCCTGGG + Intronic
1134614892 16:15643265-15643287 CCGCGAGGCCCCGCCCCCCCCGG - Exonic
1138630827 16:58293151-58293173 CCGCCCTGCCCTGCCTCCCTGGG - Intronic
1139930647 16:70523559-70523581 CCGCGAGGCCCCCTCTTCGTTGG + Exonic
1141755022 16:85985152-85985174 CAGTGAGGCCCCGTCTCCCCAGG - Intergenic
1142279981 16:89142820-89142842 CTGCGAGACCCCGTCTCCTTAGG - Intronic
1142378966 16:89721255-89721277 CCCCGCGCCTCCGTCTCCCACGG + Intronic
1142757711 17:2025532-2025554 CCGCGCGGCGCCGCCTCCCAAGG + Intergenic
1146182997 17:30709234-30709256 CCGCGCGGCCCCCTCAGCCGGGG - Intergenic
1146935162 17:36808578-36808600 CCCCGCGCCCCCGGCTGCCTCGG - Intergenic
1147645022 17:42028181-42028203 CCGGGCGGCCCCGGCTCCTCCGG + Exonic
1148463551 17:47851367-47851389 CCACCCGGGCCCCTCTCCCTGGG - Intronic
1148685163 17:49496763-49496785 CCGGGCGCCCCCGTCTCGTTAGG - Intronic
1152559472 17:81070763-81070785 CCGGGAGCCCCCGTCTGCCTGGG + Intronic
1153201924 18:2655817-2655839 CCGCGCGTCCCCTTCTCCTCAGG + Exonic
1153805846 18:8707237-8707259 CGGCGCGGCCCCCTCTACCCGGG - Intronic
1154332615 18:13442295-13442317 CCGCTCGGCCCTCACTCCCTGGG - Intronic
1158662015 18:59396726-59396748 CCACGCAGCCCGGTCTTCCTTGG + Intergenic
1160300349 18:77672410-77672432 CCCCGCTCCCCCGTCTCCCCAGG - Intergenic
1160453357 18:78979813-78979835 CCGCGCGGCGCCGTCTCCGCCGG - Intergenic
1160976807 19:1796778-1796800 CCGCACGGCCTCGTCCCCGTTGG + Exonic
1161029521 19:2051200-2051222 CAGCGCGGACCCCTCTACCTGGG + Exonic
1161265265 19:3360783-3360805 CCGCGGAGCCGCGTGTCCCTGGG + Intronic
1162363042 19:10231020-10231042 CCGGGCGGCCCCCACTGCCTCGG - Intronic
1162741360 19:12775559-12775581 CCGCCCCGCCCCGCCCCCCTAGG + Intronic
1162975800 19:14206534-14206556 CCGCGCGGCCCCATCAGCCGGGG + Intergenic
1163020973 19:14480567-14480589 CCGGGGTGCCCCGTCTCCCCAGG + Intronic
1164594945 19:29526450-29526472 CCGCGCGGCGCCCCCTCCCCTGG - Intergenic
1166121630 19:40690491-40690513 CCGGGCGCCCCCGCCTCCCGCGG + Exonic
1202702184 1_KI270712v1_random:172806-172828 CCTCGAAGCCTCGTCTCCCTGGG - Intergenic
926901307 2:17754108-17754130 CCGCGCGGCCCCGCCTCTTCCGG - Intronic
927207146 2:20617944-20617966 GCGCACGGCTCCTTCTCCCTGGG + Exonic
927639691 2:24838714-24838736 CTGCTCGGCCCCGTGTCTCTCGG + Intronic
927945851 2:27134709-27134731 CCGCGGGGCCGCGTTTCCCGGGG + Intergenic
928556184 2:32427527-32427549 CCGCCCGCCTCCGTCTCCCAAGG + Intronic
930711920 2:54557999-54558021 CCGCGCGGGCCCGGGACCCTTGG + Intronic
931374412 2:61694815-61694837 CCGCCCCACCCCGCCTCCCTTGG - Intergenic
932231286 2:70086567-70086589 CCGCGCGGCCTGGGCTCCCGCGG - Intergenic
938073133 2:128318733-128318755 CCGCCCGGCCCCGGCTCCCCGGG + Intergenic
948449494 2:238060575-238060597 CCGCGCGGCCCCGGCTCTCCCGG + Intronic
948456659 2:238107615-238107637 ACGTGCGTCCCCGTCACCCTGGG - Intronic
1175562150 20:59939781-59939803 GCGCGCGGCCCGGGCTCCCAGGG + Exonic
1175726407 20:61321545-61321567 CCACGTGGCCTCATCTCCCTTGG + Intronic
1175947294 20:62564838-62564860 CCGCGAAGCCCCATCTCCATCGG + Intronic
1175965006 20:62656017-62656039 CCGCGTGGCCCCATCTCAGTAGG + Intronic
1176127986 20:63484434-63484456 CCGCGGTGCCCCTTCTCCATCGG - Intergenic
1176156943 20:63626811-63626833 CCGCGCGGCCGCCCCTCCCCCGG + Intronic
1176195289 20:63834102-63834124 CCGCGGTGCCCCCTCTTCCTAGG + Intergenic
1176218243 20:63958188-63958210 CAGTGGGGCCCCTTCTCCCTGGG + Exonic
1176307014 21:5128861-5128883 CCTCGCGGCTCCGGCTCCCACGG + Intergenic
1177871032 21:26573083-26573105 GCGCCCGGCCCGGGCTCCCTTGG - Exonic
1179850045 21:44133169-44133191 CCTCGCGGCTCCGGCTCCCACGG - Intergenic
1179935774 21:44602567-44602589 CCCCCCGGCCCCGCCTCACTGGG + Intronic
1179979675 21:44889494-44889516 CCGTGCTGCCCCGTCTTCCAGGG - Exonic
1180154707 21:45972360-45972382 CCCCCCGCCCCCGTCTCTCTGGG + Intergenic
1180982628 22:19886052-19886074 CCGCGCAGCCCACTCTCCCCTGG - Intronic
1183546198 22:38455785-38455807 CCGTGCGGCCCCCTCTGTCTCGG + Intergenic
1183583654 22:38739880-38739902 CCACGCGGCCCCCTCCACCTCGG + Exonic
1184211681 22:43039866-43039888 CCGGTCAGCCCCGTCACCCTGGG + Exonic
1184640380 22:45867221-45867243 CCGCGCCGCGCCCTCTCCCGAGG - Intergenic
954198066 3:49007901-49007923 CAGCTCGGCCCCGTCTCCTTCGG - Intronic
958718974 3:97822062-97822084 CAGCGCGGCTCAGTCTCTCTCGG - Exonic
962714539 3:138115311-138115333 CCGCGCGGCCCGCTCACCGTGGG + Exonic
967271644 3:187737980-187738002 CCCAGCGGCCCCGCCTCCCTGGG - Intronic
968850493 4:3074627-3074649 CGGCGCGGCCCCGCCTCCGCCGG + Intergenic
972311934 4:37890660-37890682 CCCCGCGCCCCCGGCTCCCCAGG + Intergenic
972533137 4:39977851-39977873 GCGCGAGGCCCCGGCTCCCGGGG - Exonic
980930279 4:139177435-139177457 CCGCGGGGCCCCGCCGCCCTCGG + Intergenic
982157215 4:152535275-152535297 CCCCCCGGCCCCGCCGCCCTCGG + Exonic
984928282 4:184825724-184825746 GCCCGCGGCCCCGCTTCCCTCGG - Intronic
985660886 5:1155988-1156010 CCGCGCGGCCCCATCCCCGGCGG - Intergenic
987133535 5:14880930-14880952 CTGCTCGGCCACTTCTCCCTGGG - Intergenic
992552659 5:77874053-77874075 CAGCGCGGCCCCGTCACCACTGG + Intergenic
992627390 5:78648321-78648343 CCGCTCGGCGCGGTCTCCCAGGG + Intronic
999318891 5:150601226-150601248 CCCCGAGGCCCCCTCTCCCCTGG - Intronic
1002284587 5:178153841-178153863 CCGCGTGGGCTCGCCTCCCTGGG - Exonic
1004336823 6:14771590-14771612 CCATGGGGCCCCGTGTCCCTTGG - Intergenic
1013441790 6:110179212-110179234 GCGCCCGCCGCCGTCTCCCTCGG + Intronic
1016329888 6:142945206-142945228 CCGCGCGGCCCCCTCCCCCCAGG + Intergenic
1017842488 6:158232710-158232732 GAGCGCAGCCCAGTCTCCCTGGG - Intronic
1018134661 6:160767526-160767548 CCGGGCGCCCTCGCCTCCCTGGG - Intergenic
1018987430 6:168648495-168648517 CCACCCGGCCTCGGCTCCCTGGG - Intronic
1019386565 7:760055-760077 CCGCGCGGCCCCGTCTCCCTCGG - Intronic
1021845242 7:24757275-24757297 CCGCGCGGCGCTTTCTCTCTGGG - Intronic
1026806783 7:73433960-73433982 GAGCGCGGCCCCGGCTCACTCGG - Exonic
1029414736 7:100435831-100435853 CCGCCCGCCCCCCTCACCCTCGG + Exonic
1030048948 7:105521730-105521752 CCGCGCGGCGCTGTCCCCCGGGG - Intronic
1034228136 7:149498116-149498138 CAGGGCGGCCCCCTCGCCCTGGG + Intergenic
1034452309 7:151143514-151143536 CCGCCCGTCCCCGTCCCCATAGG - Exonic
1034897151 7:154884967-154884989 CCGTGCTGTCCCGTTTCCCTCGG + Intronic
1035458062 7:159022478-159022500 CCGCGGGGCCCCGTCTGGCATGG + Intergenic
1037767191 8:21779482-21779504 ACCCGCTGCCCAGTCTCCCTTGG + Intronic
1041689855 8:60678544-60678566 CCGCGCCGCCCCTTTTCTCTCGG + Intergenic
1048919327 8:139213520-139213542 CCCCGCGGCCGCCTCTTCCTGGG - Intergenic
1049585470 8:143430708-143430730 CCGGCCGGCCCCGCCTCCCACGG + Intergenic
1050106356 9:2170345-2170367 CCGCCCGGCTCCTTCTTCCTAGG - Intronic
1056992371 9:91423797-91423819 CCGCGCGGCCACGGCGCCCGCGG - Exonic
1057758960 9:97857693-97857715 TCGCGCGTCTCCGTGTCCCTTGG - Intergenic
1058662965 9:107283224-107283246 CCGCCCGGCCCCATCCCCCCAGG + Intronic
1060936985 9:127521697-127521719 CCGGGTGGCCCCTTCTCCCCAGG - Intronic
1061919016 9:133772086-133772108 CCACACGGCCCCGGCCCCCTTGG + Intronic
1062560582 9:137139877-137139899 CCGGGAGGCCTCGTCTCACTAGG + Intronic
1185450775 X:280184-280206 CCCCGCGGCCCCGGGACCCTGGG + Intronic
1187900802 X:24025443-24025465 CCGGCCAGCCCCGCCTCCCTGGG - Intronic
1196840305 X:119853163-119853185 CCTCGCGGCCCAGACTCCCTCGG + Intergenic