ID: 1019387179

View in Genome Browser
Species Human (GRCh38)
Location 7:763838-763860
Sequence GGAGGGTGTCAGCAGCTGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 1, 2: 6, 3: 42, 4: 398}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019387172_1019387179 13 Left 1019387172 7:763802-763824 CCAGGCACAGGAGACGATGGACT 0: 1
1: 0
2: 1
3: 6
4: 113
Right 1019387179 7:763838-763860 GGAGGGTGTCAGCAGCTGCCAGG 0: 1
1: 1
2: 6
3: 42
4: 398
1019387170_1019387179 16 Left 1019387170 7:763799-763821 CCTCCAGGCACAGGAGACGATGG 0: 1
1: 0
2: 2
3: 12
4: 168
Right 1019387179 7:763838-763860 GGAGGGTGTCAGCAGCTGCCAGG 0: 1
1: 1
2: 6
3: 42
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019387179 Original CRISPR GGAGGGTGTCAGCAGCTGCC AGG Exonic
900187037 1:1337460-1337482 GGAGGGTGGCAGCTGCAGCCCGG - Intronic
900409748 1:2507262-2507284 GGTGGGTGGCAGCAGTGGCCTGG - Intergenic
900414153 1:2527493-2527515 GGAGAATGCCACCAGCTGCCTGG + Intergenic
900465967 1:2825602-2825624 CGAGGGTGGCACCAGCTGCAGGG - Intergenic
901404978 1:9039521-9039543 GGAGGCTGTGGGCAGCTCCCAGG + Intronic
901653823 1:10757903-10757925 GGTGGGTGTCAGGAGGTGCAGGG - Intronic
901781805 1:11599188-11599210 GAGGGGTGGCAGCAGCTCCCTGG - Intergenic
901834708 1:11916605-11916627 GCATGGTGCCAGCATCTGCCTGG + Intergenic
901869076 1:12126955-12126977 GGAGGGGGTCAGAAGCACCCAGG - Intronic
902450675 1:16494909-16494931 GGTGGGTGTCACCTGGTGCCAGG - Intergenic
902515221 1:16986372-16986394 GGAGGGTGTCAGGGGCAGCCGGG + Intronic
902709389 1:18228151-18228173 GGAGGGTGTCAGCAGAGGGCGGG - Intronic
903369976 1:22829246-22829268 GGAAGGTGGGAGCAGTTGCCTGG + Intronic
904352987 1:29920990-29921012 GGAGGGAGGCAGGAACTGCCAGG - Intergenic
904364942 1:30004545-30004567 GGAGTGTGTCTGCAGGTCCCGGG - Intergenic
904857282 1:33509263-33509285 GGGGGGGGTCAGCCCCTGCCCGG - Intergenic
905248396 1:36630373-36630395 GGAGGCTGCCAGCAACCGCCTGG + Intergenic
905452002 1:38062955-38062977 TGGGGTTGGCAGCAGCTGCCTGG + Intergenic
905534864 1:38713281-38713303 GGAGGCTGTCAGCCACTCCCTGG + Intergenic
906770642 1:48479564-48479586 GGTGGGGGTCAGCCCCTGCCAGG + Intergenic
907110465 1:51922124-51922146 GGAGGGTCTCTGAAGCTGACTGG - Intronic
907237539 1:53062390-53062412 GGATGGCTCCAGCAGCTGCCTGG + Intronic
907326089 1:53639373-53639395 GCAGGGTGGCAGCAGCCGTCTGG + Intronic
907482617 1:54755121-54755143 GCTGGAGGTCAGCAGCTGCCTGG - Intergenic
907617251 1:55937928-55937950 GGAAGGTGTGAGCAGCTGTGGGG - Intergenic
912039090 1:105362747-105362769 GCATGGTGTCAGCACCTGCTTGG - Intergenic
912819533 1:112855695-112855717 GGAGGGTGTCATGCCCTGCCAGG + Intergenic
913230558 1:116737462-116737484 AGAGGGTGGCAGCAGCAGGCAGG + Intergenic
913586141 1:120277568-120277590 GGAGGGTGACAGCAGAGTCCTGG + Intergenic
913622045 1:120620801-120620823 GGAGGGTGACAGCAGAGTCCTGG - Intergenic
914568150 1:148889426-148889448 GGAGGGTGACAGCAGAGTCCTGG + Intronic
914604674 1:149240823-149240845 GGAGGGTGACAGCAGAGTCCTGG - Intergenic
914747680 1:150511720-150511742 GTAGGGGGTCAGTAGCTGGCAGG - Exonic
915655618 1:157357357-157357379 GGAGGATTTCGGCAGCTGTCGGG + Intergenic
915666288 1:157448178-157448200 GGAGCATCCCAGCAGCTGCCAGG - Intergenic
916519641 1:165552165-165552187 GGAGTGTGTCAGCATCACCCAGG - Intronic
919056053 1:192570560-192570582 GTAGGTTGTCAGAAGCAGCCAGG + Intergenic
919711957 1:200738041-200738063 GAAAGTTGTCAGCAGCTGTCAGG + Intergenic
920041917 1:203103582-203103604 GGACAGGGCCAGCAGCTGCCAGG + Intronic
920335472 1:205242138-205242160 GTGGGGTGTCAGTATCTGCCAGG - Intronic
920502844 1:206496372-206496394 AGAGTGTGGCAGCAACTGCCTGG + Exonic
920787159 1:209052098-209052120 GCAGAGTGTTAGCAGATGCCAGG - Intergenic
922341683 1:224661911-224661933 GGAGGATGTGGGCAGCTGGCGGG + Intronic
922580545 1:226694694-226694716 GGAGGATGTCGGCAGCATCCTGG + Intronic
923456426 1:234169289-234169311 GGAGTGTCTCACCAGCTGCCTGG + Intronic
1062857866 10:788350-788372 CCAGGGTGGCAGCAGCTGCAGGG + Intergenic
1062907638 10:1189620-1189642 AGAGGGTGTCTGCAGCTGCAGGG + Intronic
1062936607 10:1395241-1395263 AGACGGTGTCATCAGCTGTCGGG - Intronic
1064061494 10:12141219-12141241 GAAGAGTGTCTACAGCTGCCAGG + Intronic
1065376637 10:25049964-25049986 GCATGGTGTCAGCATCTGCATGG + Intronic
1066464959 10:35642633-35642655 GGAGGGTGGCAGCAGGGGCTTGG - Intergenic
1066952919 10:42138329-42138351 GGTGGGGGTCAGCCCCTGCCCGG + Intergenic
1067026479 10:42847488-42847510 GGTGGGGGTCAGCCCCTGCCAGG + Intergenic
1067045280 10:42981895-42981917 GGGGGGTATGTGCAGCTGCCTGG + Intergenic
1068053540 10:51982848-51982870 GCAGGGTGCTAGCAGGTGCCAGG + Intronic
1069123272 10:64596498-64596520 GGAGGGTACCAGCAGCAGTCAGG + Intergenic
1069486438 10:68827109-68827131 TGAGGGTGTCAGCGGGGGCCTGG - Intergenic
1069617476 10:69815318-69815340 GGGGGGAGTGAGTAGCTGCCTGG + Intronic
1069679913 10:70277165-70277187 GAAGGGTCTCAGCTGCTGCTGGG - Intronic
1069768771 10:70884097-70884119 GGAGGGAGTCACTAGCTGCTGGG + Intronic
1069994237 10:72332749-72332771 GGACAGTGTCAGCAGCAGCAGGG + Intergenic
1070427488 10:76303842-76303864 CGAGCGTGTTAGCCGCTGCCTGG - Intronic
1073582344 10:104680297-104680319 GGGGGCAGTGAGCAGCTGCCTGG + Intronic
1074217256 10:111397847-111397869 GCAGGGAGTTAGGAGCTGCCTGG + Intergenic
1074300818 10:112232095-112232117 GGAGGGGGTGGGCATCTGCCTGG - Intergenic
1075071601 10:119323600-119323622 GGAGCTGGGCAGCAGCTGCCCGG - Intronic
1075674030 10:124283430-124283452 AGAGGATGTGAGAAGCTGCCTGG + Intergenic
1075700886 10:124468822-124468844 GGAGGGTGTACGGAGCTTCCCGG - Intronic
1076272452 10:129166171-129166193 GGAGGGTGCCAACATCTGCTGGG + Intergenic
1076833524 10:133008625-133008647 GAAGAGATTCAGCAGCTGCCCGG + Intergenic
1076993950 11:289378-289400 GGAGGGAGTCCGGGGCTGCCGGG - Intronic
1077066781 11:644603-644625 GGACGGTGACAGCTGCTGACTGG + Exonic
1077188080 11:1244341-1244363 GTGGGGTGCCAGCAGTTGCCTGG - Exonic
1077188617 11:1246438-1246460 TGAGGGTGCCAGCAGTTGCCCGG - Exonic
1077189035 11:1248112-1248134 GTGGGGTGCCAGCAGTTGCCTGG - Exonic
1077189598 11:1250296-1250318 GTGGGGTGCCAGCAGTTGCCTGG - Exonic
1077420237 11:2446559-2446581 GGCGGGTGACAGCAGGAGCCAGG + Intronic
1078241051 11:9531122-9531144 AGAGGGTGGCAGCAGTTGCAGGG - Intergenic
1080434047 11:32223587-32223609 GGAGGCTGTTATGAGCTGCCGGG - Intergenic
1080854582 11:36101169-36101191 GACAGGTGTCAGCAACTGCCTGG - Intronic
1080866333 11:36198700-36198722 GGAGGCTCTAAGCAGGTGCCAGG - Intronic
1081447664 11:43146053-43146075 GCATGGTGCCAGCAGCTGCATGG + Intergenic
1081743885 11:45459639-45459661 GGGTTGTTTCAGCAGCTGCCTGG + Intergenic
1082706230 11:56497339-56497361 GGTGGGGGTCAGCCCCTGCCCGG + Intergenic
1083180522 11:60982041-60982063 GGGAGGTGCCAGCAGATGCCAGG + Intronic
1083198214 11:61103420-61103442 GGAGGATGCGAGCAGCTTCCAGG + Intronic
1083686545 11:64379423-64379445 GGCGTGTGTCAGTAGCTGCCTGG + Intergenic
1084649181 11:70478658-70478680 GTTGTGTCTCAGCAGCTGCCAGG + Intronic
1084731577 11:71076932-71076954 TGAGGGTCCCAGCAGCTCCCAGG - Intronic
1084735967 11:71105614-71105636 AGAAAGGGTCAGCAGCTGCCAGG + Intronic
1085073780 11:73572158-73572180 GGTGGGGGTCAGCCCCTGCCCGG + Intronic
1085260065 11:75199548-75199570 GGGAAGTGTCTGCAGCTGCCAGG + Intronic
1085293165 11:75414683-75414705 CCAGTCTGTCAGCAGCTGCCAGG - Intronic
1085339114 11:75719844-75719866 GGAGGAAGACAGCAGCTTCCGGG - Intronic
1086107198 11:83158212-83158234 GACGGGAGTGAGCAGCTGCCTGG - Intronic
1089339281 11:117746626-117746648 TGGGAGTGTCAGCAGCTGCTAGG - Intronic
1089665304 11:120014218-120014240 TGAGTGTGGCAGCAGCTGGCAGG - Intergenic
1089759251 11:120711002-120711024 AGGGGGTGTGAGCAGCTGCAGGG + Intronic
1090128840 11:124118242-124118264 GGAGGGGGACAGCAGCTCCAGGG + Exonic
1090243880 11:125202257-125202279 GGAGGGTCCCAGCTGCAGCCTGG - Intronic
1090330908 11:125931643-125931665 GGAGGGTGTTAGCAGATTCTGGG - Intergenic
1090399273 11:126438457-126438479 GCAGGATGTCAGCAGCACCCTGG + Intronic
1091319863 11:134641752-134641774 GGAGGGTGACAGCATGAGCCTGG + Intergenic
1092513591 12:9184524-9184546 GCAGGGTGCTAGCAGGTGCCAGG - Intronic
1093371831 12:18375437-18375459 TGAGGCTGTTAGCAGCAGCCAGG - Intronic
1095113868 12:38330449-38330471 GGGGGGGGTCAGCCCCTGCCCGG - Intergenic
1101251336 12:102939089-102939111 GCAGGGTGTCAGGAGCTCACAGG - Intronic
1101315784 12:103627590-103627612 GCAGGCTGCCAGCTGCTGCCAGG - Intronic
1101986164 12:109448930-109448952 GGAGGGTGACAGAATATGCCAGG + Exonic
1101992768 12:109500911-109500933 GGAAGGTGACAGCAGATTCCAGG + Intronic
1102999604 12:117375317-117375339 GGAGGGTGTGGGCACCTCCCAGG + Intronic
1103704357 12:122863268-122863290 TGAGGGGGTCAGCAACTGCTAGG - Intergenic
1103782551 12:123408822-123408844 TGAGGCTGGCAGCAGCGGCCGGG - Exonic
1104602085 12:130161391-130161413 GGAGCGCGTCAGCGCCTGCCCGG - Intergenic
1104934407 12:132356837-132356859 GGAGGGAGGCAGCAGCTTCCTGG + Intergenic
1104966735 12:132511713-132511735 GCTGGAGGTCAGCAGCTGCCTGG - Intronic
1105259394 13:18767604-18767626 TGAGGGTGCCAGCAGTTGGCGGG + Intergenic
1106316996 13:28603068-28603090 GGAGGGTTTCTGCAGCAGCTAGG + Intergenic
1107837254 13:44422011-44422033 TGTGGGTGTCAGCATCTGCTGGG + Intergenic
1108608569 13:52063899-52063921 GGTGGGGGTCAGCCCCTGCCAGG + Intronic
1108920763 13:55671742-55671764 GGAGGGTGTCACAAGGTGCTCGG + Intergenic
1111840674 13:93446442-93446464 GGAGGGTATTAGTAGCTGCTAGG + Intronic
1112497117 13:99914010-99914032 GGAGGGAATCAGCAAGTGCCTGG + Intergenic
1113778357 13:112961703-112961725 TGAGGGTGACTGCAGCTCCCGGG - Intronic
1114508053 14:23232787-23232809 GGGGGGGGTCAGCCTCTGCCCGG + Intronic
1115592011 14:34874211-34874233 GGAGGGCGACAGCAGCGGCTAGG + Intronic
1116902147 14:50371732-50371754 ACTGGGTGTCTGCAGCTGCCTGG - Intronic
1117722054 14:58637955-58637977 GCAGGGCGTTATCAGCTGCCGGG + Intronic
1118761054 14:68880305-68880327 GCAGGGTGGCAGCCTCTGCCTGG + Intronic
1119421113 14:74508604-74508626 AGAGGGGGGCACCAGCTGCCAGG - Exonic
1119700355 14:76750538-76750560 GGGGGGGGTCAGCACCAGCCAGG + Intergenic
1122364035 14:101183699-101183721 GGAGGCTGTCAGCAGCTGGGAGG + Intergenic
1122533510 14:102445665-102445687 GGAGCGGATCAGCAGGTGCCAGG - Intronic
1122636729 14:103133475-103133497 GGATGGTGTCAGCATTGGCCAGG - Exonic
1122692597 14:103538310-103538332 GGAGGGAGTGAGCAACTGCCGGG + Intergenic
1122847222 14:104506520-104506542 GGAGAGTGTCTGGAGGTGCCTGG - Intronic
1122901169 14:104782890-104782912 GGGGGGTGCCAGCTGCAGCCAGG + Intronic
1123125371 14:105942079-105942101 GGGTGGTGTTAGCAGCTGCACGG - Intergenic
1124439355 15:29675269-29675291 TGAGCGTGGCAGCTGCTGCCGGG + Intergenic
1124818864 15:33022868-33022890 AGAGGTTGTCAACTGCTGCCTGG + Intronic
1125686189 15:41564666-41564688 AGAGGGTGTCTGCAGGAGCCAGG + Intronic
1127374778 15:58374445-58374467 GGAAGGTGTCAACTGCTTCCAGG + Intronic
1129409864 15:75344146-75344168 GGTGGTTGCCAGGAGCTGCCGGG - Intergenic
1129459833 15:75694991-75695013 AGCGGCTGACAGCAGCTGCCAGG + Intronic
1129704776 15:77787928-77787950 GGAGGTTGGCAGCTGTTGCCTGG - Intronic
1129742476 15:77996149-77996171 GGCAGTTGTCAGCAGCTGCCGGG - Exonic
1129843007 15:78755328-78755350 GGCAGTTGTCAGCAGCTGCCGGG + Intergenic
1130557882 15:84935582-84935604 GGAGCGGGAGAGCAGCTGCCAGG - Intronic
1130866746 15:87940002-87940024 GGAGCCCTTCAGCAGCTGCCAGG + Intronic
1131146486 15:90017040-90017062 GGTAGGTGCCAGCTGCTGCCAGG + Intronic
1131538371 15:93255844-93255866 TGGGGGTGGCAGCAGTTGCCAGG - Intergenic
1132464062 16:69588-69610 GAAGGGGGTCACCAGCTGTCTGG + Intronic
1132507847 16:321222-321244 GGAGGGTGGCGGCTCCTGCCTGG - Intronic
1132507861 16:321273-321295 GGAGGGTGGCGGCTCCTGCCTGG - Intronic
1132517542 16:372827-372849 TGAGGGTGGCAGCAGCTCCGAGG - Intronic
1132561593 16:597131-597153 GGAGGGGCTCAGGAGCAGCCAGG + Intronic
1132664125 16:1073892-1073914 CGAGGCTGTCAGGAGGTGCCTGG + Intergenic
1132743381 16:1426975-1426997 GGAGGATGACAGCAGCTTTCTGG - Intergenic
1133209999 16:4258156-4258178 GAAGCCTGTCCGCAGCTGCCCGG - Exonic
1133398014 16:5464048-5464070 GGAGGGAATCAGGAGGTGCCAGG + Intergenic
1134066729 16:11233140-11233162 TGGGGGTGGCAGCGGCTGCCGGG + Intergenic
1134229289 16:12416633-12416655 GCATGGTGTCAGCATCTGCTCGG + Intronic
1134364048 16:13560345-13560367 GGAGGGTGTAAGCTGCTGATTGG + Intergenic
1134777647 16:16866969-16866991 GGAGGGTGAAAGCAGCAGCCAGG + Intergenic
1135736472 16:24935530-24935552 GGTGGGAGCCAGCAGCTGCCTGG + Exonic
1136057510 16:27701437-27701459 TGAGGGTGACAGCAACTGCCTGG - Intronic
1136094598 16:27945939-27945961 GGAGGGAGGCAGCAGCTGAGGGG - Intronic
1138028757 16:53542444-53542466 GTGCTGTGTCAGCAGCTGCCAGG - Intergenic
1138228910 16:55323936-55323958 GGAGCTTCTCTGCAGCTGCCTGG - Exonic
1138588214 16:57985207-57985229 GGAGGGTCTCAGCGGCTACGCGG + Exonic
1141604858 16:85146936-85146958 GGAGAGTCACTGCAGCTGCCAGG + Intergenic
1141663284 16:85453122-85453144 GCAGGGGGTTAGCAACTGCCAGG + Intergenic
1141962928 16:87421445-87421467 GGAGGAGGTCAGCTCCTGCCGGG + Intronic
1142069612 16:88083928-88083950 GGCTGGTGTCCCCAGCTGCCAGG + Intronic
1142279333 16:89139557-89139579 GGAGGGGGTCACCAAGTGCCAGG - Intronic
1142325775 16:89413702-89413724 TGTGGCTGTCAGCAGCCGCCAGG + Intronic
1142687686 17:1587192-1587214 GGAGAATGTCAGCAGGGGCCCGG - Intronic
1142760822 17:2041156-2041178 ATAGGGTGTCAGCAGCGGCTTGG - Exonic
1142849381 17:2696870-2696892 GGAGGGGGTCTCCAGCTGGCTGG + Exonic
1143088791 17:4436202-4436224 GGAGGGTGCCTGCAGCTGCCAGG + Intronic
1143241168 17:5444456-5444478 GGAGAGTGTCCGCCGCTGCCTGG - Exonic
1143582642 17:7835691-7835713 GCTGGGAGGCAGCAGCTGCCTGG + Intergenic
1144099481 17:11931219-11931241 AGAGGGTTCCAGCAGCTGCTAGG + Intronic
1144495897 17:15744561-15744583 AGAGGGTGTCAAGAGCAGCCAGG - Intronic
1144582375 17:16466184-16466206 TGATGGTGTCACCAGCTGCTGGG + Intronic
1144740878 17:17581621-17581643 GGTGGATGTCAGCTGCTGCTGGG - Intronic
1145297467 17:21602493-21602515 AGTGGCTGTCAGCAGCTGGCAGG + Intergenic
1145366477 17:22270372-22270394 AGTGGCTGTCAGCAGCTGGCAGG - Intergenic
1147252594 17:39162154-39162176 GAAAGCTGCCAGCAGCTGCCAGG + Intronic
1147456610 17:40542040-40542062 GGAGCATGTCAGCTGCAGCCTGG + Intergenic
1147809656 17:43159355-43159377 GGTGGGGGTCAGCCCCTGCCAGG - Intergenic
1148156645 17:45428447-45428469 AGTGGCTGTCAGCAGCTGGCAGG + Intronic
1148694597 17:49551411-49551433 GGAGGGTGTGAGCCGCTGGATGG + Intergenic
1148777418 17:50103387-50103409 GGAGAGTATCAGATGCTGCCTGG + Intronic
1150876559 17:68977175-68977197 GAAGGGACTCAGGAGCTGCCAGG + Intronic
1151555291 17:74843397-74843419 GGCGGGCGTAAGCAGCTCCCTGG - Exonic
1151556794 17:74850772-74850794 GGAGGGTGACAGCCTCAGCCTGG + Intronic
1151728089 17:75895980-75896002 GGTGGGTCTCAGAAGCTGCTCGG - Intronic
1151935100 17:77256630-77256652 GAAGGGTGGCTGGAGCTGCCTGG + Intergenic
1152259831 17:79260913-79260935 GGAGTGTGCCGGCAGGTGCCAGG - Intronic
1152268126 17:79308111-79308133 GGAGAGTGCCAGCAGGTGACGGG + Intronic
1152476327 17:80520792-80520814 GGGGCCTGTCAGAAGCTGCCTGG + Intergenic
1152590357 17:81208658-81208680 GCAGGGTCCCAGCAGCCGCCGGG + Intronic
1153305110 18:3623994-3624016 GGAATGTGGCAGCAGCTGTCTGG - Intronic
1153596408 18:6729731-6729753 GGAGGCTGTCAGCAGCTGGGCGG - Intronic
1153819955 18:8824660-8824682 AGAGGGTGTCAGTACCTGCCAGG - Intronic
1153959945 18:10132080-10132102 GCGGGGCGGCAGCAGCTGCCGGG - Intergenic
1154411309 18:14143590-14143612 GGAGGCTGTCAGCAGGTGTGTGG - Intergenic
1154466176 18:14643917-14643939 GGAGAGTGTCTGCAGGGGCCAGG + Intergenic
1155146327 18:23086665-23086687 GGAGGCAGTGAGCAGCCGCCAGG - Intergenic
1156391631 18:36656036-36656058 TGCCTGTGTCAGCAGCTGCCTGG - Intronic
1156526828 18:37775653-37775675 GGAGGCTGTCAGCAGAGGGCAGG + Intergenic
1157198267 18:45637902-45637924 CCAGGGTGTCAGCTGCGGCCTGG + Intronic
1157642700 18:49233806-49233828 GAAGGTTCTCAGAAGCTGCCAGG - Intronic
1160556725 18:79730350-79730372 GGGACGTGTCAGCAGCTTCCAGG - Intronic
1161027756 19:2044484-2044506 GGAGGGTCCCAGCAGGTGCCAGG - Intronic
1161073408 19:2273586-2273608 GGAGGGGTCCCGCAGCTGCCTGG - Intronic
1161145611 19:2676340-2676362 GGAGGGTGTCTGAACATGCCAGG - Intronic
1161325570 19:3662106-3662128 GGAGGGGGTTGGCAGGTGCCGGG - Intronic
1161602581 19:5193522-5193544 GGAGGGTTTCAGGAGAGGCCAGG - Intronic
1161946505 19:7440529-7440551 AGAGGCTGTCAACAGCTCCCCGG - Intronic
1162105219 19:8366163-8366185 GGAGGGTGTCAGGTCCTGCCTGG - Intronic
1162498089 19:11034635-11034657 GCAGGGGGGCAGCAGCTGCGTGG - Intronic
1162776797 19:12984760-12984782 GAAGGGGGTGACCAGCTGCCTGG + Intergenic
1162997945 19:14348401-14348423 GGAGGGAGCCCTCAGCTGCCCGG + Intergenic
1163315334 19:16537188-16537210 TGAGGGTGTCCTCAGCTGCCTGG - Intronic
1164192900 19:22927963-22927985 GGGGGGTGTCAGCCCCCGCCCGG + Intergenic
1166194795 19:41198574-41198596 GCAGGGTACCACCAGCTGCCCGG - Exonic
1166996842 19:46723447-46723469 GGGCAGTGTGAGCAGCTGCCGGG - Intronic
1167149146 19:47698989-47699011 GGTGCGTTTCAGCAGCTGCGTGG - Exonic
1167289944 19:48619036-48619058 GCAGGGGGTCTGCGGCTGCCCGG - Intronic
1167377614 19:49120021-49120043 GGCGGGTGTCTGGAGCTCCCAGG - Intronic
1167523899 19:49972175-49972197 GGAGGGTCCCAGCAGCTGGGGGG - Intergenic
1167767454 19:51492955-51492977 GGAGAGTGACAGAGGCTGCCTGG + Intronic
1168015017 19:53565988-53566010 GGGGTGTGTCAGGAGCTGTCAGG + Intronic
1168060293 19:53888216-53888238 GGAGGGTGTTGGCAGTTTCCAGG - Intronic
1168295155 19:55374554-55374576 GGAAACGGTCAGCAGCTGCCCGG + Intergenic
1168431933 19:56288264-56288286 GGATGGAGCCTGCAGCTGCCGGG - Intronic
925831551 2:7900825-7900847 GGATGGTCTCAGCAGCTCCCAGG + Intergenic
925976931 2:9148235-9148257 GGAGGGAGGAACCAGCTGCCAGG - Intergenic
926592712 2:14757205-14757227 TGAGGGTGTCTGCAGCTGCCTGG + Intergenic
926627227 2:15102344-15102366 GGAGGGTGTCTGCAGTTCCTGGG - Intergenic
926706471 2:15841252-15841274 GGAGGGTGACAGGAGCAGTCAGG - Intergenic
927481416 2:23457064-23457086 GGAGGGTCTCAGCAGATGCCTGG - Intronic
927928040 2:27026618-27026640 GGCGGGTGGCAGCAGCACCCTGG - Exonic
928226894 2:29457372-29457394 GGAGGGCTTCAGCTGCTGCTGGG + Intronic
928542157 2:32294156-32294178 GGTGGGGGTCAGCCCCTGCCAGG - Intronic
929533691 2:42767614-42767636 GGAGGCTGTCATCAGGGGCCAGG + Exonic
929868515 2:45738002-45738024 GGAGGCTGTCAGGACCTGCCAGG - Intronic
929953031 2:46431409-46431431 GGAGGGTGACAGCAGAAGCAAGG + Intronic
932231886 2:70089656-70089678 GGAGGAGGGCAACAGCTGCCGGG + Intergenic
932731684 2:74226286-74226308 GGAGTGTGTCAGCAAATGCCTGG - Intronic
933033167 2:77358233-77358255 GCATGGTGCCAGCATCTGCCTGG + Intronic
933737270 2:85505116-85505138 GGAGGCAGGAAGCAGCTGCCAGG + Intergenic
936252478 2:110877238-110877260 GGAGGGTGGCAGAAGCTCCCAGG - Intronic
936644502 2:114353150-114353172 GGAGGCTACCAGCAGCTGCTGGG - Intergenic
937243286 2:120476249-120476271 GGTGGGTGGCAGGAGCTGCCAGG - Intergenic
937912612 2:127082750-127082772 GGGAGGTGTGAGCAGCAGCCGGG - Intronic
938956992 2:136308021-136308043 GGAGGGAGTGAGAAGCTTCCTGG - Intergenic
939117536 2:138077567-138077589 GGAGGGTGCCTGAATCTGCCAGG - Intergenic
942445619 2:176075641-176075663 GCAGGGTGACAGCTGCTGCAGGG - Intergenic
945977749 2:216283796-216283818 GGAGGGTGGCAGCTGCAGCCTGG + Intronic
946193667 2:218021092-218021114 GGCTGGGGTCAGCGGCTGCCTGG - Intergenic
947748078 2:232519745-232519767 GGAGAGCGTCAGAAGCTGCTAGG + Intergenic
948795555 2:240400510-240400532 GCAGGGTCTCTGCAGCTGCTGGG + Intergenic
948816660 2:240513726-240513748 CCTGGGAGTCAGCAGCTGCCTGG - Intronic
948816830 2:240514824-240514846 CCTGGGAGTCAGCAGCTGCCTGG + Intronic
949041227 2:241850833-241850855 GGACGGTGACACCTGCTGCCTGG + Exonic
1168800405 20:640917-640939 GGAGGCTGTGAGCAGGTTCCTGG - Intergenic
1169033385 20:2430660-2430682 GGAGGGCGTCAGAAGCTGGGGGG + Intronic
1169040034 20:2485878-2485900 TGAGGCTCTCAGCAGCTGTCAGG + Intronic
1169209543 20:3758541-3758563 GGAGAGTGACAGCAGCTTTCTGG - Exonic
1170095632 20:12642872-12642894 GGAGTGTGAGAGCAGCTCCCAGG + Intergenic
1170150331 20:13221195-13221217 GGAGGGCTTCAGCTGCGGCCGGG - Intergenic
1171339828 20:24419286-24419308 GGAGGGTGGCAGCAGGAGCTGGG + Intergenic
1171344097 20:24452647-24452669 GGTGTGTGGCAGAAGCTGCCCGG - Intergenic
1171899879 20:30847108-30847130 GGTGGGGGTCAGCCCCTGCCAGG - Intergenic
1172055257 20:32150399-32150421 GGAGGGGTGCAGCAGCTGCTGGG - Intronic
1172297667 20:33824847-33824869 GGAGGGTGGCAGAAGCTCCTAGG + Intronic
1173178868 20:40786527-40786549 GGACGCTGGGAGCAGCTGCCAGG + Intergenic
1173388766 20:42612427-42612449 GGGGAGTCTCAGCTGCTGCCTGG - Intronic
1176195122 20:63833156-63833178 GGAGAGCAGCAGCAGCTGCCTGG + Intergenic
1176842715 21:13853283-13853305 TGAGGGTGCCAGCAGTTGGCGGG + Intergenic
1176861748 21:14014827-14014849 GGAGGCTGTCAGCAGGTGTGTGG + Intergenic
1177178393 21:17720350-17720372 GGGGGGGGTCAGCCCCTGCCTGG - Intergenic
1179513733 21:41892259-41892281 AAAGGTTGTCAGCAGCTGTCAGG + Intronic
1179560147 21:42210698-42210720 GGAGGGGGGCGGCAGATGCCTGG - Intronic
1179805208 21:43832903-43832925 TGAGGTTGGCAGCAGCTCCCAGG + Intergenic
1180963349 22:19772862-19772884 GCTGGGTCTCAGGAGCTGCCGGG + Intronic
1181886256 22:26024570-26024592 GGAGGGTTACAGCAGCGGTCTGG - Intronic
1182430100 22:30294224-30294246 GCAGGGTGTCTGCCTCTGCCAGG + Intronic
1183455799 22:37922398-37922420 GCAGGCTGGCAGCAGCAGCCTGG + Exonic
1183493499 22:38128931-38128953 GGAGGGTTTCAGCAGCTGTGGGG - Intronic
1183585691 22:38751722-38751744 GGGCTGTGGCAGCAGCTGCCTGG - Intronic
1183587726 22:38762647-38762669 GGATGGTTTCTGCAGCTTCCTGG + Intronic
1183631983 22:39039078-39039100 GGAGGGGGTCACCAGGTGCATGG + Intergenic
1184404287 22:44291481-44291503 GGAGGGTGTCAGCATGAGTCAGG + Intronic
1184474221 22:44711888-44711910 GGAGGGTGTCTGCAGCTGCCAGG + Intronic
1184608684 22:45588924-45588946 GGAGGATGTCAGGTGCTTCCAGG + Intronic
1185084223 22:48729928-48729950 GGTGGGTGTATGCAGCTGCTAGG - Intronic
1185133918 22:49057777-49057799 GGATGGTGATTGCAGCTGCCAGG + Intergenic
950152199 3:10696522-10696544 GCAGGGTTTCCGCAGCTGCCTGG + Intronic
951140102 3:19148419-19148441 GGGGGGTTTCAGCAGCTGGCGGG + Intergenic
951217529 3:20039885-20039907 GGAGGTGGCCAGCAGGTGCCTGG + Intergenic
951315569 3:21185896-21185918 GGAGGGGGTCACCAGGTGCATGG + Intergenic
951881176 3:27483363-27483385 GGAGGGTGTCCTGAGCTGTCTGG - Intronic
952901450 3:38114491-38114513 GGAGGGTTTCAGGGGCTACCAGG - Intronic
953069539 3:39505662-39505684 GGAGTGTGACAGCCTCTGCCTGG + Intronic
953435627 3:42875051-42875073 GGAGGGCATCAGCAACTGGCTGG - Exonic
954426181 3:50444239-50444261 GGAGGTGGTCAGCAGCTGGCTGG + Intronic
955902990 3:63777086-63777108 GCATGGTGTCAGCATCTGCTTGG - Intergenic
961370342 3:126424787-126424809 GGAGGGTGACAGCAGATGGGAGG + Intronic
961397822 3:126609398-126609420 GGAGGCAGGCAGAAGCTGCCAGG + Intronic
962714405 3:138114726-138114748 GGAGGGGGTCCGAGGCTGCCTGG - Intronic
964706864 3:159627744-159627766 GGAGGGTTTCTGAGGCTGCCAGG + Intronic
965963100 3:174452383-174452405 GCAGGGTGCTAGCAGGTGCCAGG - Intronic
967770683 3:193330558-193330580 GGGGGGTGTCAGGACCTGCTTGG + Intronic
967921795 3:194619480-194619502 GGATGGTCTCTGCAGCTGCCAGG + Intronic
968574615 4:1359842-1359864 GGAGGCTGTCAGCTGCATCCTGG - Intronic
968627239 4:1631479-1631501 GGAGTGTGTCCCCCGCTGCCTGG + Intronic
969470168 4:7382807-7382829 GGTGGGTGTAAACAGCTGCGGGG + Intronic
969564058 4:7967239-7967261 AGAGGGTGTCAGGAACCGCCAGG - Intronic
971361311 4:25940920-25940942 GGAGGGAGTCACCACTTGCCGGG - Intergenic
973631714 4:52826042-52826064 GGAGGGTGCCATCTGCTGCAGGG + Intergenic
974021216 4:56693573-56693595 GGTGGGGGTCAGCCCCTGCCAGG - Intergenic
974575515 4:63715118-63715140 GTAGGTTGTCAGAAACTGCCAGG + Intergenic
975511109 4:75194368-75194390 GCAGGGTGCTAGCAGATGCCGGG - Intergenic
976664924 4:87580250-87580272 GGAGGGTGAGAGCAGCAGGCTGG - Intergenic
981753682 4:148118449-148118471 GGAGGGTGGCAGAAGCTGCAGGG - Intronic
984818457 4:183859230-183859252 GTAGGGTGTCACATGCTGCCAGG + Intronic
985091413 4:186366268-186366290 GGAGCGTGTCTGCAGCAGGCAGG - Intergenic
985169015 4:187128374-187128396 GGACGGAGTCAGCAGCTGCCAGG - Intergenic
987429016 5:17808813-17808835 GGAGAGTGTATGCAGCTGACTGG + Intergenic
989615420 5:43333183-43333205 GGAGGGGGTCACAAGCTGCATGG + Intergenic
991215583 5:64154898-64154920 CTGGGGTGGCAGCAGCTGCCTGG - Intergenic
992894208 5:81232933-81232955 GGAGGATGTCTCAAGCTGCCTGG - Intergenic
994051684 5:95369380-95369402 GGAGGGTGGGAGTAGATGCCTGG - Intergenic
997928392 5:138052154-138052176 GGAGGGTGTTGGGAGGTGCCTGG - Intergenic
998144128 5:139716609-139716631 GGTGGGAGTCAGCAGCTCCCTGG - Intergenic
999264354 5:150256744-150256766 GGTGAGTGTCAGGTGCTGCCTGG - Exonic
999313571 5:150569398-150569420 ATAGGGTGGCACCAGCTGCCTGG + Intergenic
1001280986 5:170386316-170386338 GGAGTGCGTCAGAAGCTGGCGGG + Intronic
1001718607 5:173837784-173837806 GGTGGTTGTCAGCAGCTGGAGGG + Intergenic
1002940728 6:1713373-1713395 GGTGGGTGCCAGGAGCAGCCAGG - Intronic
1003190779 6:3872467-3872489 GGCGGGTGCCAGCCGCTGTCTGG - Intergenic
1005808151 6:29494352-29494374 TGAGGGAGTCAGGGGCTGCCAGG - Intergenic
1005959733 6:30686610-30686632 GGAGGGCGGCGGCAGCAGCCGGG + Exonic
1006342520 6:33454388-33454410 GGAGGACTTCAGCAGCTCCCCGG + Intronic
1006467234 6:34203000-34203022 GGAGGGGGTCAGGAGCAGGCAGG - Intergenic
1006902344 6:37511370-37511392 GGAGGATGAAAGCAGCTGTCTGG + Intergenic
1006929226 6:37677830-37677852 GGAGGGGGTCAGAGTCTGCCAGG - Intronic
1007168853 6:39848102-39848124 AGAGGGCGTCAGCACATGCCAGG - Intronic
1007293233 6:40802474-40802496 GGAGGGAGGGAGCAGTTGCCAGG + Intergenic
1008020212 6:46567902-46567924 GGTGAGTTTCAGCAGTTGCCAGG + Intronic
1008592579 6:53009118-53009140 GGAGGGTGCCTGCTGCAGCCAGG + Intronic
1011670656 6:89680053-89680075 GGAGGTAGTCAGAGGCTGCCAGG + Intronic
1015299438 6:131635654-131635676 GGAGATTCCCAGCAGCTGCCGGG + Intronic
1017152803 6:151296104-151296126 TGAGGGTGGCAGCAGGTCCCAGG - Intronic
1017751213 6:157492098-157492120 GGACAGTGACAGCACCTGCCTGG - Intronic
1017945210 6:159091043-159091065 GGAGGAGGTCAGCAGGTGGCGGG - Intergenic
1018990208 6:168668837-168668859 GGAGGGTGACAGCAGGTGTGGGG - Intronic
1018990264 6:168668980-168669002 GGAGGGTGACAGCAGGTGTGGGG - Intronic
1018991523 6:168677357-168677379 GGAGGGTGTCACAAGGTGCATGG + Intergenic
1019015255 6:168875544-168875566 GGAGCGTGTCAGGAGGTGCTGGG + Intergenic
1019387179 7:763838-763860 GGAGGGTGTCAGCAGCTGCCAGG + Exonic
1019463040 7:1171352-1171374 GGAGGGAGACAGCAGGTGGCAGG + Intergenic
1019576396 7:1739698-1739720 GGAGGGAGCCAGCAGCTTCCTGG + Intronic
1024022822 7:45387094-45387116 GGAGGGGGTCGGCAGCTGCCCGG + Intergenic
1024045075 7:45580373-45580395 GGGTGGAGTCTGCAGCTGCCGGG + Intronic
1024226790 7:47331516-47331538 GGATGGTGTGAGCAGCTCACTGG - Intronic
1026598323 7:71752704-71752726 GAAGGGTGAGAGCAGCTTCCGGG - Intergenic
1027196468 7:76033986-76034008 TGAGGGTGACAGTACCTGCCTGG + Intronic
1027267681 7:76503296-76503318 GGAGGCTGCCAGCAACTCCCTGG + Intronic
1027319493 7:77003159-77003181 GGAGGCTGCCAGCAACTCCCTGG + Intergenic
1028734273 7:94189574-94189596 GTAGGGTGCTAGCAGGTGCCAGG + Intergenic
1029430109 7:100523739-100523761 GGTGGGGGTCAGCCCCTGCCAGG - Intergenic
1031988234 7:128177810-128177832 TCAGGGTGTCAGCAGCATCCAGG + Intergenic
1032011805 7:128352005-128352027 GGAGAGCGCCAGCAGCAGCCCGG + Exonic
1032091923 7:128915425-128915447 GGAGGGCGGGAGCAGGTGCCCGG - Intergenic
1032472290 7:132187354-132187376 GGAGGGTGTAACCACCTGACAGG - Intronic
1032499686 7:132391145-132391167 GAAGGGTACCAGCAGCTGGCAGG + Intronic
1034129060 7:148699029-148699051 GGTGAGTGTCGGCAGCCGCCGGG + Exonic
1035275476 7:157745624-157745646 TGAGGGTGCCAGCATCTGCAGGG + Intronic
1035277043 7:157753960-157753982 GGATGGGGTCAGCTGGTGCCAGG - Intronic
1035667446 8:1389339-1389361 GGAGGGTGGCTGCAGCATCCCGG + Intergenic
1035700409 8:1634450-1634472 GCAGGGTGCCCACAGCTGCCCGG - Intronic
1036024982 8:4896842-4896864 GGAGGGTTGCAGCAGCTGCCGGG + Intronic
1036285614 8:7442292-7442314 GGAGGGAAGCATCAGCTGCCAGG - Intergenic
1036335859 8:7869237-7869259 GGAGGGAAGCATCAGCTGCCAGG + Intergenic
1037955076 8:23049960-23049982 GGAGGATCCCAGCAGCTGTCAGG + Intronic
1038041580 8:23727902-23727924 GGCTGGTGCCAGCAGATGCCAGG - Intergenic
1040690908 8:49937284-49937306 GGAGTGGATCAGGAGCTGCCTGG + Intronic
1040977852 8:53214352-53214374 GTGGGGTGCCAGCAGGTGCCAGG + Intergenic
1040991253 8:53352663-53352685 GGAGACTCCCAGCAGCTGCCGGG - Intergenic
1041270417 8:56104584-56104606 GGTGGGGGTCAGCCCCTGCCAGG - Intergenic
1042006255 8:64183196-64183218 GCAGGGTGCTAGCAGGTGCCAGG - Intergenic
1042699222 8:71594015-71594037 GCATGGTGTCAGCATCTGCTTGG - Intergenic
1044637399 8:94340900-94340922 GGAGGGGGCCAGCCCCTGCCCGG + Intergenic
1045375718 8:101571885-101571907 GCACCATGTCAGCAGCTGCCAGG + Intronic
1047406451 8:124589547-124589569 GGAAGTTGCCAGCTGCTGCCTGG - Intronic
1048365080 8:133731363-133731385 GGAGGGTGCTAGGAGGTGCCAGG + Intergenic
1048861960 8:138730224-138730246 AGAGGGTGTCAACAGGTGACAGG + Intronic
1048897251 8:139003200-139003222 GGAGGGTGGCAGGACATGCCAGG - Intergenic
1049350514 8:142162007-142162029 GCTGGGTGCCAGCAGCTGACTGG - Intergenic
1049544926 8:143226117-143226139 GGAGGGGGTGCCCAGCTGCCTGG + Intergenic
1049578090 8:143398727-143398749 GGAGGGAGCCAGCAGCTCCCCGG + Intergenic
1049605721 8:143528360-143528382 GGAGGGTGTCTGTCGCTGCCTGG - Intronic
1053149903 9:35736741-35736763 GGGGGGTCTCAGCAGGAGCCTGG + Exonic
1053360985 9:37486446-37486468 GGAGGCTGACAGCAGAGGCCTGG - Intronic
1054748530 9:68880804-68880826 GGTGGGTGGCAGCAGCTGTTGGG - Intronic
1056214867 9:84397567-84397589 GGAGCGTGGCTGCATCTGCCAGG + Intergenic
1057327621 9:94080133-94080155 GGTGGGTGGCAGCAGCAGCTTGG + Intronic
1057348074 9:94269491-94269513 GGAGGATTCCAGCAGCTGCCGGG - Intronic
1057739104 9:97696793-97696815 GGGAGGTGTCAGCCACTGCCAGG - Intronic
1057739848 9:97701552-97701574 GGAGGGTGTCTGCATGGGCCTGG - Intergenic
1059302349 9:113324215-113324237 GGTGGGTGCCAGCGGCTGCGGGG - Intronic
1060220719 9:121762781-121762803 GGAGGGTGTTAGTATCTGCATGG + Intronic
1060802679 9:126554518-126554540 GGAGGGAGTGTGCAGCAGCCTGG + Intergenic
1060971142 9:127738829-127738851 TCAGGGTGCCAGCAGCAGCCAGG - Exonic
1060978579 9:127779549-127779571 AAAGGGTGTCAGCAGCTGCTGGG + Intergenic
1061249210 9:129416668-129416690 GGTGGGTCACAGCACCTGCCTGG + Intergenic
1061540050 9:131273335-131273357 GGATGGAGTCAGAAGCTTCCTGG - Intronic
1061715659 9:132517251-132517273 CGAGGGTGCCAGCAACTCCCCGG + Intronic
1061852747 9:133425455-133425477 CCTGGGAGTCAGCAGCTGCCTGG + Intronic
1061899243 9:133664537-133664559 GGAGGGTGTCACCTCCAGCCTGG + Intronic
1062171295 9:135136292-135136314 GGGGGCTCTCAGCAGCAGCCAGG + Intergenic
1062351570 9:136142226-136142248 GGAGGCTGGCAGCACCTACCCGG + Intergenic
1062418719 9:136467987-136468009 GGAGGCTGGCAGCTGCTGCCTGG - Intronic
1062640355 9:137515481-137515503 GCAGGGGCCCAGCAGCTGCCGGG + Exonic
1185787762 X:2905091-2905113 GGAGAGGGGCATCAGCTGCCTGG + Exonic
1192363896 X:70455398-70455420 GGAGGGTCTCAGAAGGAGCCTGG - Intronic
1192760512 X:74091070-74091092 GCATGGTGTCAGCATCTGCTTGG + Intergenic
1192794118 X:74412580-74412602 GTAGGGGGTCAGCACCCGCCCGG - Intergenic
1193449431 X:81647380-81647402 GTAGGGTGCTAGCAGGTGCCAGG + Intergenic
1196496460 X:116329488-116329510 GGAGGGAGGGGGCAGCTGCCTGG - Intergenic
1196823348 X:119721414-119721436 GCATGGTGTCAGCATCTGCTGGG + Intergenic
1197474261 X:126901140-126901162 GCAGGGTGCTAGTAGCTGCCAGG - Intergenic
1197765261 X:130055985-130056007 GGCAGGGGTCAGCAGCTGACTGG - Exonic
1197934774 X:131729012-131729034 GGAGTGAACCAGCAGCTGCCAGG + Intergenic
1197935286 X:131734337-131734359 GGAGTGAACCAGCAGCTGCCAGG + Intergenic
1197938321 X:131763140-131763162 GGAGTGAAGCAGCAGCTGCCAGG + Intergenic
1197939941 X:131778953-131778975 GGAGTGAGGCAGCGGCTGCCAGG + Intergenic
1197941291 X:131793003-131793025 GGAGTGAAGCAGCAGCTGCCAGG - Intergenic
1199952391 X:152716264-152716286 GGAGGGTCTCAGGCCCTGCCAGG + Intronic
1199957292 X:152752184-152752206 GGAGGGTCTCAGGCCCTGCCAGG - Intronic
1199972752 X:152872862-152872884 GGAGGGGGCCAGCAGCTGTCGGG + Intergenic
1200310443 X:155071709-155071731 GGTGGGTGCCGGCAGCTCCCAGG + Intronic
1200758812 Y:7016954-7016976 GGTGGCTGTCAGCTGCTGCCTGG + Intronic