ID: 1019388945

View in Genome Browser
Species Human (GRCh38)
Location 7:774478-774500
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019388940_1019388945 22 Left 1019388940 7:774433-774455 CCGGTCGTGCTGCGGGTTTTGCA 0: 1
1: 0
2: 0
3: 0
4: 59
Right 1019388945 7:774478-774500 CTCGGTTTCCGGCCCAATGCTGG No data
1019388939_1019388945 23 Left 1019388939 7:774432-774454 CCCGGTCGTGCTGCGGGTTTTGC 0: 1
1: 0
2: 1
3: 1
4: 34
Right 1019388945 7:774478-774500 CTCGGTTTCCGGCCCAATGCTGG No data
1019388938_1019388945 27 Left 1019388938 7:774428-774450 CCAGCCCGGTCGTGCTGCGGGTT 0: 1
1: 0
2: 1
3: 4
4: 35
Right 1019388945 7:774478-774500 CTCGGTTTCCGGCCCAATGCTGG No data
1019388942_1019388945 -2 Left 1019388942 7:774457-774479 CCGCTCATGAGCGTGCGGTTTCT 0: 1
1: 0
2: 0
3: 0
4: 51
Right 1019388945 7:774478-774500 CTCGGTTTCCGGCCCAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr