ID: 1019390755

View in Genome Browser
Species Human (GRCh38)
Location 7:785536-785558
Sequence CGGGCTGTTCCCAGATCTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019390754_1019390755 -8 Left 1019390754 7:785521-785543 CCTCAAAGAGGGCAGCGGGCTGT 0: 1
1: 0
2: 1
3: 6
4: 114
Right 1019390755 7:785536-785558 CGGGCTGTTCCCAGATCTCCTGG 0: 1
1: 0
2: 2
3: 15
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019390755 Original CRISPR CGGGCTGTTCCCAGATCTCC TGG Exonic
900266835 1:1761633-1761655 CGGGCTGTGACCCGGTCTCCAGG + Intronic
900872385 1:5313216-5313238 AGGGCTGCTCCCTGTTCTCCAGG - Intergenic
901045122 1:6391693-6391715 GGGGCTGTCCCTGGATCTCCTGG + Intronic
903370868 1:22835167-22835189 CAGGCTGGTCTCAGAACTCCTGG - Intronic
903529774 1:24021328-24021350 CGGGCTGGTCTCAAAACTCCTGG + Intergenic
903977919 1:27163450-27163472 CAGGCTTTTCCCAGTTCTCCAGG + Intronic
905210543 1:36371085-36371107 CAGGCTGTTCTCAGAACTCCTGG + Intronic
905766740 1:40607682-40607704 CTGGCTTGTCCCAGAGCTCCTGG + Intergenic
906302929 1:44696893-44696915 CTGGCTGTTCACTGTTCTCCAGG - Intronic
907541714 1:55221423-55221445 CAGGCTGGTCCCAAATCTCCTGG + Intergenic
908100407 1:60785477-60785499 CTGACTGTTGCCAGCTCTCCTGG - Intergenic
909580278 1:77225303-77225325 CAGGCTGATCTCAGAACTCCTGG - Intergenic
917594065 1:176509790-176509812 CAGGCTGTTCTCAAATTTCCAGG - Intronic
919408126 1:197209655-197209677 CGGTCTTTTCCCAGTTCCCCTGG + Intergenic
919835565 1:201570780-201570802 AGGCCTGTTCCCAGAAGTCCAGG + Intergenic
920182357 1:204140152-204140174 GGCTCTGTTGCCAGATCTCCTGG - Intronic
922460969 1:225814190-225814212 CAGGCTGGTCTCAGAACTCCTGG - Intronic
923105075 1:230848127-230848149 AGAGCTGTTGCCAGGTCTCCAGG - Intronic
924230808 1:241960265-241960287 CAGGCTGGTCTCAGAACTCCTGG - Intergenic
1064794213 10:18993233-18993255 CTGCCCGTTCTCAGATCTCCAGG - Intergenic
1065508882 10:26457620-26457642 CAGCCTGTTCCCAGGTCCCCTGG - Intronic
1066498047 10:35961598-35961620 GGTGTAGTTCCCAGATCTCCTGG + Intergenic
1068689451 10:59900847-59900869 CAGGCTGGTCTCAGAACTCCTGG - Intronic
1069518457 10:69098747-69098769 CAGGCTGGTCCCAAACCTCCTGG - Intronic
1069526649 10:69178124-69178146 CAGGCTGGTCTCAGAACTCCTGG - Intergenic
1069959785 10:72072910-72072932 GCTGCTGTTCCCTGATCTCCAGG - Exonic
1070664883 10:78336025-78336047 CTGGCTGACCCCAGAGCTCCAGG - Intergenic
1070921260 10:80187875-80187897 CCAGCTTCTCCCAGATCTCCTGG + Intronic
1071525176 10:86354234-86354256 TGGGCTGGGCCCAGAGCTCCAGG + Intronic
1072115197 10:92364097-92364119 CAGGCTGGTCTCAGAACTCCTGG - Intergenic
1073061344 10:100735590-100735612 GTGGCTGCGCCCAGATCTCCGGG + Intronic
1075177712 10:120181408-120181430 CATGCTGTTCTCAGATCACCAGG + Intergenic
1075859935 10:125666839-125666861 CCGGCTGTTCCCAACACTCCAGG - Intronic
1076443746 10:130497972-130497994 GAGGCTGGTCCCAGATCTCAAGG + Intergenic
1077033619 11:482430-482452 CAGGCTGGTCTCAGAACTCCTGG + Intronic
1077545654 11:3168480-3168502 AGCGCTGTTCCCACATGTCCTGG - Intergenic
1078509571 11:11975553-11975575 GGGGCTGTTCCCAGAACCCACGG + Intronic
1078881235 11:15450887-15450909 CTGGCTGTCCCCAGAGATCCTGG - Intergenic
1079160934 11:17993794-17993816 CGGGCTGTTCCCTCCTCACCTGG - Intronic
1079763889 11:24365522-24365544 GGAGCTGTTCCCAAACCTCCGGG + Intergenic
1084609925 11:70195523-70195545 TGGGCTGGTCCCATGTCTCCAGG - Intergenic
1084642161 11:70432392-70432414 CTGGCTCTTCCCAGATCTCCTGG + Intronic
1084707680 11:70824774-70824796 CAGGCAGTTCCCGGATCACCCGG - Intronic
1085203203 11:74714126-74714148 GGGGGTCTTCCCAGCTCTCCAGG + Intronic
1086142807 11:83517991-83518013 CTGTCTGTTCTCAGATCTCAAGG + Intronic
1087076258 11:94129268-94129290 CCGGCTGTACCCGGACCTCCTGG + Exonic
1087791784 11:102413571-102413593 AGGCCTGGTCCCAGACCTCCAGG + Intronic
1092999114 12:13979289-13979311 CGGGCTGGTCTCAGAACACCTGG - Intronic
1094504962 12:31053844-31053866 CTGCCTGTTCCCAGATGTACTGG - Intergenic
1095515082 12:42996523-42996545 CAGGCTGGTCTCAGAACTCCTGG + Intergenic
1095971856 12:47907263-47907285 CAGGCTTTTCCAACATCTCCAGG + Intronic
1097792025 12:63825159-63825181 CAGGCTGGTCTCAGAACTCCTGG - Intergenic
1098296442 12:69008910-69008932 CAGGCTGGTCCCAGATTCCCAGG - Intergenic
1098574763 12:72028617-72028639 CTGGCTGCTCCCCCATCTCCAGG + Intronic
1100167265 12:91929900-91929922 AGGGCTGTTCTCTGTTCTCCTGG - Intergenic
1100206197 12:92352924-92352946 CAGGCTGTTCTCAAAACTCCGGG + Intergenic
1100207581 12:92367333-92367355 CAGGCTGTTCCCAATTCTTCAGG + Intergenic
1100408259 12:94289981-94290003 CGGGCTGTTGCCAGCTCTTGAGG + Intronic
1100976479 12:100127801-100127823 CAGGCTGGTCTCAGAGCTCCTGG - Intronic
1102796625 12:115694700-115694722 TGTGCTGTTCCCAGTTCTGCAGG - Intergenic
1103568201 12:121827658-121827680 CGGGCTTCACCCAGATCGCCGGG + Intronic
1104014851 12:124955071-124955093 TGGCCTCTGCCCAGATCTCCTGG - Intronic
1104492804 12:129209240-129209262 TGGCCTCTTCCCAGATCCCCAGG - Intronic
1104984079 12:132586938-132586960 AGGTATGTTCCCAGATCTCTGGG - Intergenic
1107840598 13:44452701-44452723 CTGGCTGTTCCCAGCTCCCTGGG - Intronic
1111322703 13:86651082-86651104 CTGTCCGTTCTCAGATCTCCAGG + Intergenic
1112562563 13:100527046-100527068 CGAGCTGTTCCCAGTTCCCCGGG + Intronic
1114775151 14:25473380-25473402 GGGGCTGCTCACTGATCTCCTGG - Intergenic
1115291533 14:31778180-31778202 CTGTCTGTGGCCAGATCTCCTGG + Intronic
1115478850 14:33842053-33842075 TGGGCTGTTCCCAGATGGCATGG + Intergenic
1118198400 14:63649378-63649400 CAGGCTGGTCTCAGAACTCCTGG - Intergenic
1118474760 14:66106258-66106280 CTGGCTCTTCCCTGATCTCCAGG - Intergenic
1118576389 14:67245559-67245581 CAGGCTGGTCTCAGAACTCCTGG + Intronic
1123019084 14:105389222-105389244 CGGGCTGTGACCAGACTTCCAGG + Intronic
1123102535 14:105815028-105815050 CAGGCTGGTCCCAAACCTCCTGG + Intergenic
1126355431 15:47790193-47790215 ATGGCTATGCCCAGATCTCCAGG + Intergenic
1127212171 15:56784549-56784571 TGGGCAGTTCCCAGATCTGAGGG - Intronic
1128637878 15:69314715-69314737 CGGGGTGTTCCCAGCACACCAGG - Intronic
1130650907 15:85761574-85761596 AGGTCTGTCCCCAGCTCTCCTGG + Intronic
1132488627 16:211852-211874 GGTGCTGTTACCAGCTCTCCCGG + Intronic
1132676129 16:1121954-1121976 GGGCCTGTCCCCAGCTCTCCTGG + Intergenic
1132782160 16:1633257-1633279 CTGGCTCTTCCCAAAGCTCCGGG - Intronic
1134014565 16:10879251-10879273 CTTGCTGTGCCCAGAGCTCCGGG + Intronic
1134154921 16:11835390-11835412 CAGGCTGGTCTCAGAACTCCTGG + Exonic
1135184206 16:20300700-20300722 CTGGCAGTTCCCATTTCTCCCGG - Intergenic
1137300895 16:47146440-47146462 CAGTCTGTTCCCAGATTACCTGG + Intergenic
1139491264 16:67287244-67287266 CGAGCTTTTCCCAGGTCTCTGGG - Intronic
1139619861 16:68129885-68129907 CGGGCTGGTCTCAAAACTCCTGG + Intronic
1141318432 16:82983667-82983689 TGAACTGTTCCCAAATCTCCAGG - Intronic
1142715999 17:1747270-1747292 CAAGCTGTTCCCAGGGCTCCAGG - Intronic
1143003499 17:3811164-3811186 TGGGCTGTTACCAGAATTCCTGG - Intergenic
1145012547 17:19378132-19378154 CGGGCAGTTCCCCGAGCTCACGG + Intronic
1147666111 17:42149369-42149391 CAGGCTGGTCTCAGAACTCCTGG - Intronic
1149616263 17:58002800-58002822 CAGGCTGGTCCCAAAACTCCTGG - Intronic
1150373398 17:64661507-64661529 GGGGCTGTTCCCCGAGCCCCGGG + Intronic
1150778820 17:68102260-68102282 GGGGCTGTTCCCCGAGCCCCGGG - Intergenic
1151404357 17:73877128-73877150 TTGGCAGTTCCCAGATGTCCAGG + Intergenic
1152024626 17:77800872-77800894 CGGGCTGTTCGCAAACTTCCAGG + Intergenic
1153901308 18:9619382-9619404 CGTGCTTTTCCCAGTGCTCCAGG + Intergenic
1158901260 18:61963894-61963916 GGGGCTGTTGCCAGACCTCTGGG - Intergenic
1160363858 18:78307844-78307866 GGAGCTGTTTCCAGATCTCTAGG - Intergenic
1161059956 19:2209889-2209911 CGGGCCGTTCCCTGCTCTCCAGG - Intronic
1161385128 19:3987564-3987586 GGGGCTGTTCACAGGTATCCCGG + Intergenic
1162443452 19:10707578-10707600 TGGGCTGGACGCAGATCTCCGGG + Exonic
1165821567 19:38679703-38679725 CAGGCTGGTCTCAGAACTCCTGG + Intronic
1166330146 19:42073474-42073496 CAGGCTGGTCTCAGAACTCCTGG - Intronic
1167837026 19:52081641-52081663 CTGGCTGGTCTCAGAACTCCTGG - Intronic
1168596442 19:57681715-57681737 GGGGCTTTTCCCAGATTTCTGGG - Intergenic
925739600 2:6994194-6994216 CAAGCTCTCCCCAGATCTCCAGG + Intronic
925774839 2:7324924-7324946 CTGGCTGTTCCCAGTTCCCTGGG + Intergenic
927717426 2:25361633-25361655 CGCGCTGCACCCAGACCTCCGGG - Intergenic
927863661 2:26575731-26575753 CAGGCTGGTCTCAGAACTCCTGG + Intronic
928470714 2:31573090-31573112 TGGCCTGTTCCCAGATTTCTGGG - Intronic
929027026 2:37614662-37614684 CAGGCTGTTCCCAAAGCTCGAGG - Intergenic
930358323 2:50347229-50347251 GTGGCTGCTCCCAGATTTCCAGG + Intronic
931030780 2:58172266-58172288 CTGCCTGTTCTCAGATCTCCAGG - Intronic
931376934 2:61716472-61716494 CCAGCTGTACCCAGCTCTCCTGG - Intergenic
938727910 2:134122852-134122874 AGGGCTCTGCCCAGATCTGCCGG + Intronic
939955178 2:148521860-148521882 CTGGCTCTTCCCAAATGTCCAGG + Intergenic
946307260 2:218863230-218863252 CAGGCTGTTCCCCGATGCCCAGG + Intronic
948162915 2:235839765-235839787 CCTCCTGTTCCCACATCTCCTGG - Intronic
948320154 2:237062479-237062501 CGGGCCTTCCCCAGAGCTCCAGG - Intergenic
948517107 2:238510991-238511013 CGAGCTGCTCCCGGAGCTCCTGG + Intergenic
1171466379 20:25330606-25330628 CTGCCCGTTCTCAGATCTCCAGG - Intronic
1172224678 20:33297439-33297461 CGGGCTGTGCCCAGCCCACCTGG - Intronic
1173408514 20:42788559-42788581 CAGGCTGCTTGCAGATCTCCAGG + Intronic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1175875701 20:62228267-62228289 TGTGCTGTTCCCAGAGCTGCTGG + Intergenic
1175951212 20:62584375-62584397 CAGGCTGTCCCCAGAACTGCTGG + Intergenic
1176268610 20:64223697-64223719 TGGGCTTTTCCCAAATCTCTAGG - Intronic
1176410354 21:6446366-6446388 CAGGCTGGTCCCAGACTTCCGGG - Intergenic
1179685847 21:43054688-43054710 CAGGCTGGTCCCAGACTTCCGGG - Intronic
1181048221 22:20226613-20226635 CAGGCTGGTCCCAGGTCCCCAGG + Intergenic
1181792930 22:25282322-25282344 CGGGGTCATCCCAGACCTCCTGG + Intergenic
1182104532 22:27679993-27680015 CTGGCTGTACCTAGATCTGCAGG - Intergenic
1184602119 22:45549784-45549806 TGGGCTGCTCCCCCATCTCCAGG + Intronic
1184661045 22:45965646-45965668 CAGGCTGGTCTCAGAGCTCCTGG + Intronic
1185080062 22:48704735-48704757 AGGGATGTTCCCATGTCTCCTGG + Intronic
953599406 3:44348342-44348364 GGAGCTGTTCCCAGAGCCCCTGG - Intronic
954277498 3:49552214-49552236 CTGGCTGTTAGCAGACCTCCAGG - Intergenic
954736411 3:52710549-52710571 CAGGCTGATCTCAGAACTCCTGG - Exonic
956794027 3:72702045-72702067 CTGGCTTTTCCCAGATCTCCTGG + Intergenic
956794165 3:72703042-72703064 CTTGGTTTTCCCAGATCTCCTGG - Intergenic
959994365 3:112664488-112664510 CTGCCCGTTCTCAGATCTCCAGG + Intergenic
961488928 3:127237625-127237647 CGGGCTGTGACCAGTTCTGCTGG - Intergenic
961828838 3:129612918-129612940 CTGGCTGTTCCCTGTTCTCCAGG + Intergenic
962080853 3:132137521-132137543 CTGCCCGTTCTCAGATCTCCAGG - Intronic
962421368 3:135232019-135232041 GAGGCTGTTCCCAGTTCCCCAGG - Intronic
962616292 3:137130191-137130213 AGGCCTGCTCCCTGATCTCCAGG + Intergenic
963852296 3:150221059-150221081 CTGCCTCTTCCCAGAACTCCAGG + Intergenic
967404165 3:189098373-189098395 CCTGCTGAACCCAGATCTCCTGG - Intronic
968117698 3:196102155-196102177 CAGGCTGATCTCAGATCTCCTGG - Intergenic
968496895 4:923457-923479 TAGGCTGTTCTCAGAACTCCTGG - Intronic
969093373 4:4713653-4713675 CAGGCTGGTCTCAGAACTCCTGG - Intergenic
969392752 4:6902017-6902039 CTGGCTGTTCTCAGATCTCATGG - Intergenic
969583508 4:8079036-8079058 CGGGCTGTTGCTAGGTCCCCAGG + Intronic
969677034 4:8619936-8619958 CTGGCTTTTCCCAGACCACCAGG + Intergenic
969677510 4:8622190-8622212 AGGGCTGTTCCCAGCTCTATTGG - Intergenic
969678465 4:8627831-8627853 AGGGCTGTTCCCAGCTCTATTGG - Intergenic
969679421 4:8633465-8633487 AGGGCTGTTCCCAGCTCTATTGG - Intergenic
984049309 4:174843971-174843993 CTTCCTGTTCCCAGGTCTCCAGG - Intronic
985030886 4:185788074-185788096 CGGGCTGTTCCGTGAGCACCAGG + Intronic
985423161 4:189804185-189804207 GGGGCTGTTCCTAGTTGTCCAGG + Intergenic
986169038 5:5300885-5300907 CAGGATGTTCCTGGATCTCCTGG + Intronic
991063227 5:62400460-62400482 CGGGCTGGTCTCAAAACTCCTGG + Intronic
995524383 5:113038953-113038975 GGGGCTGTGCCCAGCCCTCCAGG - Intronic
995681630 5:114727018-114727040 CCGACTGTTCCCAAACCTCCTGG + Intergenic
996907297 5:128615537-128615559 GGGGCTTTTCCCAAATGTCCTGG + Intronic
997640325 5:135444746-135444768 GGGGCTGTTTCCAGGTCTCCCGG - Exonic
1002163350 5:177330233-177330255 CAGGCTCTTCTCAGTTCTCCAGG + Intergenic
1003311609 6:4974066-4974088 GGGGCTGGACCCAGCTCTCCAGG + Intergenic
1004355062 6:14923469-14923491 CAGGTTGTTCCCAAAGCTCCAGG + Intergenic
1004770622 6:18777073-18777095 CAGGCTGGTCCCAAAACTCCTGG + Intergenic
1005072461 6:21874466-21874488 GGGGCTGTTTCCAGATATCAGGG + Intergenic
1005511214 6:26513097-26513119 CAGGCTGGTCTCAGAACTCCTGG - Intergenic
1008263838 6:49399621-49399643 TGTGCTGTTCCAAGATCTCTCGG + Intergenic
1008417719 6:51262386-51262408 CTGCATGTTCCCATATCTCCAGG - Intergenic
1012752452 6:103181431-103181453 CAGGCTGGTCTCAGAACTCCTGG + Intergenic
1016163437 6:140908745-140908767 CTGCCTGTTCCCAGATCCCCTGG + Intergenic
1019210063 6:170397745-170397767 CAGGCTGGTCACGGATCTCCAGG - Intronic
1019390755 7:785536-785558 CGGGCTGTTCCCAGATCTCCTGG + Exonic
1019544378 7:1566407-1566429 CAGGCTGGTCTCAGAACTCCTGG - Intergenic
1022511071 7:30935276-30935298 TGGGCCCTTCCCAGTTCTCCAGG + Intergenic
1023994679 7:45151997-45152019 GGGGCTGTTCCCAGCTCTAGAGG + Intergenic
1024924183 7:54595658-54595680 AGGGCTCTTCCCAGATCTACAGG + Intergenic
1025089808 7:56052331-56052353 CGGGCTTTTCCCAGATTTTAGGG - Intronic
1025901960 7:65751622-65751644 CGGGCTTTTCCCCGATCTTAGGG - Intergenic
1025901972 7:65751704-65751726 AGGACTTTTCCCAGATCTCAGGG - Intergenic
1026358306 7:69579300-69579322 CGTGGTGTTACCAGATCTCTGGG + Intergenic
1029449304 7:100632039-100632061 CGTGCTGTTCCCAGGTCCCGAGG - Intronic
1029576461 7:101406733-101406755 CAGGCTGGTCTCAGAACTCCTGG - Intronic
1032086948 7:128889359-128889381 GGGGCTACTCCCAGCTCTCCGGG - Intronic
1032463372 7:132127744-132127766 CTGGCTGTCCCCATTTCTCCTGG - Exonic
1033439124 7:141362827-141362849 CGGGCTGTAGCCATTTCTCCTGG + Intronic
1034421325 7:150992575-150992597 CGGGCTGTGCTCAGAGCTCTGGG - Intronic
1042910365 8:73820022-73820044 CAGGCTGGTCCCAAAACTCCTGG + Intronic
1044402045 8:91783907-91783929 AGGGCTTTTCCCAGATCTGCAGG + Intergenic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1046433934 8:114163385-114163407 CTTCCTGTTCTCAGATCTCCAGG - Intergenic
1047743658 8:127827595-127827617 AGGCCTGTTCCAAGAACTCCAGG + Intergenic
1049989674 9:978721-978743 CAGGCTGTTCTCAGAGCTTCAGG - Intronic
1050460990 9:5877172-5877194 GGGGCTTGTCCCAGGTCTCCAGG + Intergenic
1052808719 9:33037260-33037282 CAGGCTGTTCTCAAAACTCCAGG - Intronic
1053042539 9:34886888-34886910 TGGGCTCTTCCCTGAACTCCAGG + Intergenic
1055488952 9:76784714-76784736 CAGCCTGTTCACAGATCCCCTGG - Intronic
1056684254 9:88746628-88746650 AGGGCTGTAGCCAGAGCTCCGGG - Intergenic
1056763780 9:89432330-89432352 GGTCCTGTCCCCAGATCTCCAGG - Intronic
1060980643 9:127789659-127789681 CGGGCTGCTCCCAGAGCCCAGGG - Exonic
1061386626 9:130294491-130294513 GGGGGAGTTTCCAGATCTCCAGG + Intronic
1061539578 9:131270772-131270794 TGGCCTGTCCCCAGATCTGCTGG + Intronic
1187344177 X:18447960-18447982 CAGGCTGGTCTCAGAACTCCTGG + Intronic
1187480354 X:19649271-19649293 GGGTCTGTTTCCAGATCCCCCGG - Intronic
1188940789 X:36235092-36235114 CTGCCCGTTCTCAGATCTCCAGG + Intronic
1191187052 X:57624232-57624254 CTGCCTGTTCTCAGATCTCAAGG - Intergenic
1192451464 X:71247641-71247663 CGGGGTGTGGACAGATCTCCAGG - Intronic
1192760735 X:74093886-74093908 CGGACTGTCCCCAAATCTGCTGG + Intergenic
1197569043 X:128127058-128127080 CGGGTTGTTCCCTGAGCTCAAGG + Intergenic
1197585030 X:128336308-128336330 AGGACTGTTCAAAGATCTCCAGG - Intergenic
1198209446 X:134503270-134503292 CAGGCTGGTCTCAGAACTCCTGG + Intronic
1200882327 Y:8229470-8229492 TTGGCTCTTCCCAGATCTCAAGG + Intergenic
1202194151 Y:22278897-22278919 TTGGCTCTTCCCAGATCTCAAGG + Intergenic