ID: 1019394578

View in Genome Browser
Species Human (GRCh38)
Location 7:810626-810648
Sequence CAGGAGCAAGAGAGGCCGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019394572_1019394578 23 Left 1019394572 7:810580-810602 CCACTCATGGCAGAGGTGAAGGG No data
Right 1019394578 7:810626-810648 CAGGAGCAAGAGAGGCCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019394578 Original CRISPR CAGGAGCAAGAGAGGCCGTG AGG Intergenic
No off target data available for this crispr