ID: 1019395936

View in Genome Browser
Species Human (GRCh38)
Location 7:817478-817500
Sequence TCCCCAGGGCTCCCCAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 433}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019395929_1019395936 3 Left 1019395929 7:817452-817474 CCGTCATGGGGAGGATTTCTCCC 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1019395936 7:817478-817500 TCCCCAGGGCTCCCCAGGACAGG 0: 1
1: 0
2: 3
3: 58
4: 433
1019395923_1019395936 17 Left 1019395923 7:817438-817460 CCTTGCCACTGTCACCGTCATGG 0: 1
1: 1
2: 0
3: 14
4: 139
Right 1019395936 7:817478-817500 TCCCCAGGGCTCCCCAGGACAGG 0: 1
1: 0
2: 3
3: 58
4: 433
1019395927_1019395936 12 Left 1019395927 7:817443-817465 CCACTGTCACCGTCATGGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1019395936 7:817478-817500 TCCCCAGGGCTCCCCAGGACAGG 0: 1
1: 0
2: 3
3: 58
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019395936 Original CRISPR TCCCCAGGGCTCCCCAGGAC AGG Intronic
900334982 1:2158217-2158239 ACCCCAGGGCTCCCCAGTGTTGG + Intronic
900549629 1:3247754-3247776 CGCCCAGGGCGCACCAGGACGGG - Intronic
901053955 1:6440159-6440181 CGTCCAGGGCTCCCCGGGACGGG + Intronic
901325084 1:8360860-8360882 TCCCCAGGCCTCCCAAGGCCAGG - Exonic
902116352 1:14124880-14124902 TCCCCAGTGCTGCCCCCGACAGG - Intergenic
902146071 1:14400126-14400148 CCTCCAGGGATACCCAGGACAGG + Intergenic
902362025 1:15947115-15947137 GCCCCAGGCCTACCAAGGACAGG + Exonic
902571126 1:17347673-17347695 TCACCAGGGGTCCCCAGCACTGG + Intronic
902577365 1:17386739-17386761 TCCCCAGGGCCTCCAAGGAGGGG + Intronic
903151735 1:21414718-21414740 TCCACAGAGATCCCAAGGACAGG - Intergenic
904264323 1:29309778-29309800 GCCCCTGGGCTCCTCAGGCCTGG + Intronic
904481714 1:30798003-30798025 CCTCCAGGGCTCCCCAGTCCTGG - Intergenic
904768301 1:32867378-32867400 TCCCCTGAGCTTCCCAGGCCTGG + Intronic
905271671 1:36791537-36791559 TCCTCAGGGCTCCCTGGGGCTGG + Intergenic
905451591 1:38060394-38060416 CCCCCGGGGCTGCCCAGGGCAGG + Intergenic
905485390 1:38292434-38292456 TGCCCAGGGCTCCCCAGGCTGGG - Intergenic
905834305 1:41104067-41104089 TCCCCAGGCCTCCCAAGAAAAGG - Intronic
906292133 1:44626209-44626231 TCCCCAAAGCACCACAGGACTGG + Intronic
908533296 1:65053817-65053839 TCCCCTGGGCCCCCCAAAACAGG + Intergenic
911975290 1:104487354-104487376 ACCCCAGCCCACCCCAGGACAGG + Intergenic
912452733 1:109777214-109777236 ACCCCAGGGCTGTCCAGGTCGGG - Intergenic
912487947 1:110043835-110043857 TCCCGTGGGCTCCCAAGGTCAGG + Exonic
912597703 1:110895649-110895671 TCCCCAGGGCTACCCAATTCTGG - Intronic
912721075 1:112020696-112020718 TCTCCTGGGCTCCACTGGACCGG + Intergenic
915168771 1:153963434-153963456 TGCCCAGGCCTCCCCGGGCCCGG - Exonic
915267114 1:154726841-154726863 TCCCCCGGGCTCCCCTGGCACGG - Intronic
915314103 1:155018331-155018353 GCCCCAGGTCTCCCCAGCCCTGG - Exonic
915530775 1:156500944-156500966 TCCCCAGGGCTGGCCGGGCCAGG + Intergenic
915585114 1:156840269-156840291 TGCCCAGGGCTCCCCAAGCTTGG - Exonic
915593671 1:156884437-156884459 TCCCCAGGGGCCTCCAGCACTGG + Intergenic
915938853 1:160105657-160105679 TCCCCAGGGCTATCCAGTTCAGG - Intergenic
916265702 1:162888147-162888169 TCCCCAGGGCTCCTGAGCATGGG - Intergenic
920311803 1:205052951-205052973 TCCCCAGGGCCCCAGAGGAAGGG - Intronic
920375177 1:205504489-205504511 TCCCCAGGGCTCCCTCTGCCCGG - Intergenic
920951517 1:210575493-210575515 TCCCCAGGGCTCCCAGGCCCAGG - Intronic
921270659 1:213466467-213466489 TCCTCTGGCCACCCCAGGACTGG - Intergenic
923337915 1:232986060-232986082 TGGGCAGGGCTCACCAGGACAGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923746187 1:236702619-236702641 TCCCCAGGGCTCCTGCTGACTGG - Intronic
924932732 1:248745191-248745213 TTTCCAGGGCTTCCCATGACAGG + Exonic
1063158009 10:3397748-3397770 TCCCCTGGGCTCCCCTGAGCAGG + Intergenic
1064475310 10:15682129-15682151 TCCCCTGGCTTCCCCAGCACAGG + Intronic
1065875388 10:29993357-29993379 CCCCCAGCGCTCCCCAGGACAGG + Intergenic
1067222487 10:44353934-44353956 TCCCCATGGCTGCCCATGGCAGG + Intergenic
1069636892 10:69930438-69930460 TCCCCAAGGCCCCCCAGGAAAGG + Exonic
1069740486 10:70684054-70684076 TCCTCAGGCCTCCCCAGTAGTGG - Intronic
1070319329 10:75343083-75343105 TTCCCAAGCCTCCCCTGGACAGG + Intergenic
1070332044 10:75424684-75424706 TCCCAAGGCCTTCCCATGACTGG + Intergenic
1070819535 10:79346843-79346865 CCCCCAGCCCTCCCCAGGACTGG - Intergenic
1071568350 10:86683033-86683055 CCCCCAGGGTTCCCCAGCAAAGG + Intronic
1073429439 10:103476713-103476735 GCCCCTGGGATCCCCAGGACTGG + Intronic
1073485923 10:103819266-103819288 TTCCCAGGGAACCCCAGGAGAGG + Intronic
1075076140 10:119351769-119351791 TATCCAGGGTTCCCAAGGACTGG - Intronic
1075124946 10:119692114-119692136 GCCCTCGGCCTCCCCAGGACAGG - Intergenic
1075522959 10:123154874-123154896 TCCCCAGGGGTCCCGCGGGCTGG - Intronic
1075799620 10:125145329-125145351 TCCCCAAGGCACCCCTGGCCAGG - Intronic
1076491548 10:130865109-130865131 TTCCCAGGGCTGCCCAAGACAGG + Intergenic
1076864307 10:133159796-133159818 CCCCCAGGGTCCCCCAGGACCGG + Intergenic
1076875923 10:133215465-133215487 TCGCCAGGGCACGCCAGCACGGG + Intronic
1077296040 11:1826710-1826732 ACCCCAGGAATCCCCAGGACAGG + Intergenic
1077343947 11:2037873-2037895 CTCCCATGGCTCCCCAGTACTGG - Intergenic
1077422752 11:2460665-2460687 TCCCCAGCGTTCCCCAGCAGTGG - Intronic
1077437448 11:2549702-2549724 GGCCCTGGGCTCCCCAGGCCTGG + Intronic
1077465925 11:2733636-2733658 CCCCCAGGGCTGCCCAGGCCTGG - Intronic
1078606918 11:12785138-12785160 TCCCCACGGCTCCCAGGCACAGG - Intronic
1079157405 11:17961043-17961065 TCCCCAGCTCTCCCCAGAAAGGG + Intronic
1079659664 11:23022002-23022024 TCCACAGGGCTCTCTAGGATTGG + Intergenic
1080577021 11:33609348-33609370 GCCACTGGGTTCCCCAGGACTGG + Intronic
1080925444 11:36751475-36751497 TCCCTAGGAGTCCCCAGGAAGGG + Intergenic
1081574502 11:44310632-44310654 TCCCCAGGGCTCCCGAGGCTAGG + Intergenic
1083685665 11:64373513-64373535 TCCCCAGGCCTCCCGGGGACAGG - Intergenic
1083764972 11:64837313-64837335 TCCCCAGGGCTGTCGAGGACAGG + Intronic
1083815085 11:65128184-65128206 TCCCCATGGCTGCCTGGGACTGG + Exonic
1083820942 11:65171100-65171122 TCCTCCTGGCACCCCAGGACAGG - Intronic
1083889509 11:65588919-65588941 TCCTCAGGGCTCCCCAGACCTGG - Intronic
1084412680 11:69013487-69013509 TCGGCAGGGCTGCCCAGGAGAGG + Intergenic
1084680420 11:70663316-70663338 TCCCCAGGGCCCCCCAATCCGGG - Intronic
1087162166 11:94959400-94959422 CCTCCTGGACTCCCCAGGACAGG - Intergenic
1087747919 11:101971221-101971243 TCCCTAGGCCTCCCAAGTACTGG + Intronic
1088457741 11:110050276-110050298 TCCTCTGGGCTCCCCAAGGCAGG + Intergenic
1088595033 11:111435055-111435077 TCCCCAGGGCTGCCCGGTTCTGG + Intronic
1088849843 11:113695629-113695651 TCATCAGTGGTCCCCAGGACAGG + Intronic
1089136031 11:116250050-116250072 TCCTCATGGGTCCCCAGGATGGG + Intergenic
1089282023 11:117381381-117381403 TCCCCAGAGCTCACCAGCACTGG - Intronic
1089654431 11:119936333-119936355 CCCCCAAGAATCCCCAGGACAGG - Intergenic
1089732335 11:120527117-120527139 TCCTCCAGGTTCCCCAGGACTGG - Intronic
1089897677 11:121948030-121948052 TCCCCAGGGCTGCTTATGACAGG - Intergenic
1090004167 11:122985019-122985041 GCCCCAGGGCTGCCCAGGGAAGG + Intergenic
1090208012 11:124896460-124896482 TACCCAGGTCTGCCCAGGCCAGG + Intronic
1090262303 11:125330417-125330439 TCCCAGGGGCTGCCCAGGGCAGG + Intronic
1090827044 11:130394907-130394929 TCCCCATGGTAACCCAGGACTGG + Intergenic
1090839669 11:130477084-130477106 GCCCCAGCGGCCCCCAGGACTGG - Intergenic
1202826933 11_KI270721v1_random:93062-93084 CTCCCATGGCTCCCCAGTACTGG - Intergenic
1096173980 12:49499356-49499378 TCCCCAGAGCTCACCAGGCCAGG - Intronic
1096325960 12:50662239-50662261 TACCCAGAGATCCCCAGAACAGG - Intronic
1096534600 12:52263333-52263355 TTCCAGGGGCTCCCCAGGAAGGG - Intronic
1096574774 12:52545883-52545905 TCCCCAGGGCTCTACAGGGATGG - Intronic
1096904154 12:54917448-54917470 TCCCCAGCGATGGCCAGGACTGG + Intergenic
1097679135 12:62632589-62632611 TACCCGGGGCTCCCCCGGGCAGG - Intergenic
1098192308 12:67962464-67962486 GCCCTAGGGCTCCCCAGTAAAGG + Intergenic
1100258120 12:92904779-92904801 TCTGCAGGGCTCCCAAGCACAGG + Intronic
1100468814 12:94873099-94873121 CCCCGAGGGCGCCCCAGGCCAGG + Intergenic
1101970840 12:109310650-109310672 AACTCAGGGCTCCCCTGGACTGG + Intergenic
1103212941 12:119179581-119179603 TTTCCAGGGCTCCCCAGGGAAGG - Exonic
1103478242 12:121233874-121233896 TCTCCAGCTCTCTCCAGGACAGG + Exonic
1103562796 12:121800868-121800890 TGCTCCGGGCTCCCCACGACCGG + Intronic
1103607537 12:122098294-122098316 GCCCCAGGGCCCTCTAGGACAGG - Intronic
1103741950 12:123096969-123096991 TCCCCAGGACTCCCCAGAGTGGG + Intronic
1104568506 12:129904697-129904719 TCCCCAGGGCTCACTGGGAAAGG + Intergenic
1104854654 12:131896031-131896053 GCCGCAGGGCGCCCCAGGGCAGG + Intronic
1104860582 12:131921384-131921406 TCTGCAGGGCTCGGCAGGACGGG - Exonic
1104949550 12:132433044-132433066 TCGGCAGGGCTCCCCACGGCAGG - Intergenic
1105704845 13:22962413-22962435 TCCCCAGGCCTCCCCAACCCGGG + Intergenic
1106402646 13:29444716-29444738 TGCCCAGGGCCCCCCATGATGGG - Intronic
1112139540 13:96623314-96623336 TGCCCAGTGCCCCCCAGCACAGG - Intronic
1113093364 13:106637595-106637617 TCCACAGGGATCCCCAAGAAAGG - Intergenic
1113950081 13:114066870-114066892 GCCCCAGAGCACCCCAGGCCAGG - Intronic
1114473959 14:22981548-22981570 GCTCCAGGGCTGCCCAGGGCCGG + Exonic
1117202845 14:53410258-53410280 TCCCCTGGCATCCCCAGGATAGG + Intergenic
1117226604 14:53667200-53667222 TCCCCTGGGTTCCAGAGGACAGG - Intergenic
1117413027 14:55467968-55467990 ACCTCAGGGCTCCCCAAGCCAGG - Intergenic
1118297752 14:64585833-64585855 TCTCAAGGGCTCCCCAGACCAGG + Intronic
1118862266 14:69673650-69673672 GCCCCGGGGCTCACCAGGTCTGG - Intronic
1119535056 14:75396116-75396138 TCCCCAGGGAAGCCCAGGAAGGG - Intergenic
1119735139 14:76976767-76976789 TCCCCAGGGCTCCCAGTGAAAGG - Intergenic
1121069362 14:91003551-91003573 TCCCCAGGGCTCCAGATGAAGGG + Intronic
1121450073 14:94001386-94001408 TCCCCAGGGCTATGCAGGAAAGG - Intergenic
1121586172 14:95064498-95064520 TACCCAAGGATCCCCAGGCCTGG - Intergenic
1121595123 14:95156897-95156919 GCCCCAGGCCTCGCCAGGCCGGG + Intronic
1121718010 14:96089902-96089924 GACCCCAGGCTCCCCAGGACAGG + Exonic
1121909470 14:97776084-97776106 TCCTCATGGCTTCCTAGGACTGG + Intergenic
1121957625 14:98228512-98228534 TAGCCAGGACTCCCCAGGGCAGG + Intergenic
1122296595 14:100709421-100709443 CCCCCAGGCCTCCCCTGGCCTGG + Intergenic
1122413079 14:101535842-101535864 TGTACAGGGCCCCCCAGGACTGG + Intergenic
1122645120 14:103189120-103189142 CCCACAGAGCTCCCCAGGCCTGG + Intergenic
1122723775 14:103737044-103737066 GCCCCAGGCCACCCCAGGAAAGG + Intronic
1122790469 14:104182235-104182257 GCCACAGGGCCCCCCAGGTCAGG + Intergenic
1122819202 14:104332817-104332839 TCCACAGGGCCCCCGGGGACTGG - Intergenic
1122872461 14:104646221-104646243 ACCCCAGGCCTCCACAGCACAGG + Intergenic
1122882928 14:104698091-104698113 TCCTCAGAGCTCCCCAGCCCCGG - Intronic
1122888551 14:104722389-104722411 GCCCCAGGGGTCCCCAGGAAGGG + Intronic
1123060469 14:105592080-105592102 TCCACATGGCTCCACAGGGCGGG + Intergenic
1123084947 14:105713051-105713073 TCCACATGGCTCCACAGGGCGGG + Intergenic
1123404064 15:20010082-20010104 TCCCCAGGGCTACCCTGACCTGG - Intergenic
1123513403 15:21016728-21016750 TCCCCAGGGCTACCCTGACCTGG - Intergenic
1124249316 15:28096832-28096854 TTCGCAGGGCCCCCCGGGACTGG + Intronic
1124405630 15:29389374-29389396 TCCCCAGACCTCTCCAGGAGGGG + Intronic
1124405708 15:29389865-29389887 TCCCCAGACCTCTCCAGGAGGGG + Intronic
1125227666 15:37413178-37413200 CCCCCAGGGCTGTCCTGGACAGG - Intergenic
1125318000 15:38452984-38453006 TCCTGAGGCCTCCCCAGGAGTGG + Intergenic
1125749578 15:42019516-42019538 TCCCCAGGGCTTCTCAGGTCAGG + Intronic
1125757100 15:42071475-42071497 TTTCCAGGACTCCCCAGAACTGG + Exonic
1126703066 15:51384633-51384655 TGACCCCGGCTCCCCAGGACTGG - Intronic
1127314718 15:57784137-57784159 TCCCCAGGGATCCTTAGGAGTGG + Intergenic
1128091482 15:64922046-64922068 TCCCCTCGGCTCCCCTGGCCTGG + Intronic
1128517870 15:68354647-68354669 TCCCAGGGTCTTCCCAGGACAGG + Intronic
1128669794 15:69566502-69566524 GCCCCAGGGGTCTCCAGGAAGGG + Intergenic
1128984333 15:72208194-72208216 TCCACATGGCTCCCCAGGAAGGG + Intronic
1129161902 15:73752179-73752201 CCCCCAAGGCTCCCTAGGGCGGG + Exonic
1129298095 15:74610788-74610810 TCCCAAGGGTCCCCCAGGCCTGG + Intronic
1129330171 15:74823134-74823156 CCCCCAGGGCTCCAGAGGCCTGG - Intronic
1129405387 15:75313604-75313626 TGCCCAGGGCTCCAGAGGGCAGG + Intergenic
1129752500 15:78076156-78076178 CCCCCAGAACTCCCAAGGACAGG + Intronic
1129776612 15:78241141-78241163 CACCCAGGTCTCCACAGGACTGG + Intronic
1129862387 15:78872774-78872796 GCCCCAGGGCACGCCGGGACTGG - Intronic
1130132168 15:81153295-81153317 TCCCCACTTCTCCCCAGGAGAGG - Intergenic
1130411889 15:83654414-83654436 GCCCCAGGGGGCCTCAGGACTGG + Intronic
1130988479 15:88860338-88860360 TCCACAGGGCTCCTCTGCACAGG - Exonic
1131179230 15:90228753-90228775 GCCCCAAGGCTCCCAAGGGCCGG - Exonic
1131985651 15:98040924-98040946 TCTCCAGGGCTGCCCAGGAGAGG - Intergenic
1132625884 16:891263-891285 TCCCCAGGACTCACCTGGCCAGG - Intronic
1132653412 16:1031575-1031597 TGCCCAGGGCTCAGCAGGGCAGG + Intergenic
1132982501 16:2745650-2745672 TCTCCAGGGCCCCCGAGGACTGG + Intergenic
1133281960 16:4671684-4671706 TCCCCAGGGCAGCCCAGGAATGG + Intronic
1136267872 16:29131535-29131557 CCCTCAGGGCGCCCCAGGCCAGG + Intergenic
1136394205 16:29984038-29984060 GGCACAGGGCTCCCCAGCACTGG - Intronic
1137787982 16:51152626-51152648 TGCCCAGGGGTCCCAGGGACTGG - Intergenic
1138349627 16:56339594-56339616 GCCCCAGGGCTCTCCTGGCCTGG - Intronic
1138862473 16:60774948-60774970 TCCCCCGACCTCCCCACGACAGG - Intergenic
1140403667 16:74692955-74692977 TCCCCAGAGCTCCTCAGTCCTGG - Intronic
1141681558 16:85547175-85547197 TGCCCAGAGCTTCCCAGGGCTGG + Intergenic
1142033569 16:87850407-87850429 ACCCCAGGGCTGCAGAGGACAGG - Intronic
1142071175 16:88091882-88091904 CCCTCAGGGCGCCCCAGGCCAGG + Intronic
1142220740 16:88853785-88853807 TCCCCAGGGCTGCCCTGCCCTGG - Intronic
1142518599 17:489813-489835 TCCCTAGGGATCCCCACGAGAGG - Intergenic
1142591051 17:1006279-1006301 ACACCTGGGCTCCCCAGGAAGGG - Intronic
1143028469 17:3954289-3954311 ACAGCAGGGCTCCCCTGGACAGG + Intronic
1143091234 17:4450121-4450143 CCCCCAGGACCCACCAGGACAGG - Intronic
1143711877 17:8741282-8741304 TCCCCAGTGCCCCCCAGGGCTGG + Intronic
1143855261 17:9843544-9843566 TCCCCATGGCTTCCCAGGAAAGG + Intronic
1144794673 17:17882948-17882970 TCCCCAAGGCTGCCCACGAAAGG + Intronic
1145754477 17:27380742-27380764 TCCCCCTGGCTCCCCACGTCAGG - Intergenic
1145974525 17:28976566-28976588 TCCCCATGGCTCCTCAGGCTTGG - Intronic
1146266604 17:31457392-31457414 TCCCCAGGGGTCCCCAGTTCCGG + Intronic
1146296376 17:31653721-31653743 TCTCCAAGGCTCCCTAGGAGAGG + Intergenic
1146371399 17:32267004-32267026 TTCCCAGGGCTTCGCAGGGCCGG - Intronic
1147319550 17:39637439-39637461 CTCCCCGGGCTCCCCAGGATAGG - Intronic
1148806297 17:50265644-50265666 TCCCCAAGGCCCCCCAGGGGAGG + Intergenic
1150904995 17:69327409-69327431 TCCCCAGGGCCTCCCACGCCTGG + Intergenic
1151505559 17:74524868-74524890 TCCCCAGGGCTGCCAAGTAGGGG - Intronic
1151564280 17:74888924-74888946 TCCCCATGGTGACCCAGGACAGG + Intronic
1151624042 17:75265577-75265599 TCCCCAGGCCTGACCAGGGCTGG + Intronic
1151723756 17:75873204-75873226 GCCTCAGGGCGCCCCAGGCCTGG + Intergenic
1151853790 17:76708000-76708022 TCCCCAGGGCAGCACAGGCCAGG - Intronic
1152070791 17:78132687-78132709 TGCCCAGGCCTCCCCAGGGTTGG + Intronic
1152331214 17:79674395-79674417 AGCCCAGGGCACCCCAAGACAGG + Intergenic
1152516142 17:80826017-80826039 TCCTCAGAGCTCCCCAGGGCCGG - Intronic
1152593228 17:81223633-81223655 TCCCCAGGGCTCCCGGAGAGAGG - Intergenic
1152688795 17:81708121-81708143 TGCCAAGGGCTGCCCAGCACTGG - Intergenic
1152995984 18:406744-406766 TCCTCAGTGCTCTCCAGGACTGG + Intronic
1155889999 18:31255750-31255772 TCCCCCATGCTCCCCAGGAGCGG + Intergenic
1156497480 18:37535696-37535718 TCCCCAGGGGTGCTCAGGGCTGG - Intronic
1157446146 18:47748267-47748289 TCACATGGGTTCCCCAGGACTGG + Intergenic
1157706735 18:49813683-49813705 TCCCCTGGGCTCCCTCGGGCTGG - Exonic
1160527086 18:79544435-79544457 GCCCAGGGGCTCCCTAGGACAGG + Intergenic
1160727628 19:624604-624626 TGCCCAGGGCTCACCTGGGCTGG - Intronic
1160845081 19:1162700-1162722 TCTCCAGAGCTCCCCAGAGCTGG + Intronic
1160860000 19:1233724-1233746 TCCCAAGGGCCCCCCATCACTGG + Intronic
1160947653 19:1651234-1651256 TCCCCAGGGGTCCCCAGGTGGGG + Intronic
1161121456 19:2529087-2529109 TGCCCAGGTCTCTCCAGGGCCGG - Intronic
1161273912 19:3404885-3404907 TCCCCAGGGGTCCCCAGAGGCGG + Intronic
1161522220 19:4730985-4731007 TCCCCATGTCTCACCAGGTCTGG + Intergenic
1161544652 19:4872972-4872994 TCTCCAGGGCTGCCCAGCACAGG - Intergenic
1161943935 19:7422636-7422658 TCACCTGGGCTCCTCTGGACTGG + Intronic
1161949946 19:7462383-7462405 TCCTCAGGGAACCCCAGGCCAGG + Intronic
1162027976 19:7904873-7904895 GCCCCAGGTGTCCCCAGGTCAGG - Intronic
1162494099 19:11013597-11013619 ACCCCAGGCCTCCCCAGGGGTGG - Intronic
1162904926 19:13817763-13817785 TCCCCAGGGCTCCCGGGCACAGG - Exonic
1163127580 19:15252587-15252609 ACCCCATGGCTGCCCAGGAAGGG - Intronic
1163158088 19:15449764-15449786 ACCCGCGGGCTCCCCAGGCCGGG + Intronic
1163207674 19:15815508-15815530 TCCCCAGGTCTCTCCTGGTCAGG + Intergenic
1163248474 19:16111739-16111761 TCCCAAGGTCTCCCCGCGACTGG + Exonic
1163514324 19:17754037-17754059 TCCCGGGGCCTCCCCAGGAAAGG - Intronic
1163667505 19:18610194-18610216 TGCTCAGGGCTCCCCAGTATGGG + Intronic
1165320696 19:35083592-35083614 TCCCAGGCCCTCCCCAGGACAGG - Intergenic
1165730481 19:38141634-38141656 AACCCAGAGCTCCCCAGCACTGG - Intronic
1165838043 19:38771175-38771197 TCCCCAGGGCCACCCAGCACGGG - Intronic
1165841522 19:38791522-38791544 TCCCCAGGGCCACCCAGCACGGG + Intronic
1166420302 19:42631390-42631412 CCCCGAGGGCCCCCCAGGCCAGG + Intronic
1166729911 19:45053089-45053111 TCCCTAAAGCTCCCCAGAACAGG + Exonic
1166796650 19:45430172-45430194 TCCCCAGCGCTGCCCAGCACAGG + Intronic
1167331415 19:48858881-48858903 CCCCCAGGAGTCCCCAGCACTGG - Exonic
1167356240 19:49006017-49006039 ACCCCAGTGCTGCCCAGCACAGG - Intronic
1167450783 19:49567520-49567542 GCCCCAGGGCTTCCTGGGACTGG + Intronic
1168146126 19:54420855-54420877 ACCCTAGGGCACCCTAGGACAGG + Intronic
1168259960 19:55187765-55187787 TCCCCAGTGCCCCACAGGGCAGG - Intronic
1168269699 19:55242680-55242702 CCCGGAAGGCTCCCCAGGACAGG + Intronic
925169667 2:1743462-1743484 CCCCCAGGACACCCCAGGAGAGG + Intronic
925295510 2:2773873-2773895 TCCCCAGCGCCACCCAGGAAAGG + Intergenic
925559966 2:5181024-5181046 TCCCGAGGCCTCACCAGGAGCGG - Intergenic
925578155 2:5381655-5381677 TCCTCAGGCCTCCCCAGAAGCGG + Intergenic
926120685 2:10239807-10239829 CCCGAAGGGCTCCCAAGGACAGG - Intergenic
926295587 2:11566429-11566451 TGCCCAGGGCTTCCCAGAAGCGG - Intronic
926681298 2:15665897-15665919 TCCCCACGCCTCCCCAGCACTGG + Intergenic
927497529 2:23560958-23560980 TCCCCAGGGCTGAGCTGGACTGG + Intronic
927639324 2:24836810-24836832 TGGCCAGGTCTCCCCAGCACAGG + Intronic
927843116 2:26457694-26457716 TCCCCAGGTCTTCCAAGTACAGG - Exonic
927865449 2:26584785-26584807 TCCCCAGGGCTCCCCACGGCCGG - Intronic
927904305 2:26846600-26846622 TCTCCAGGGCTTGCCCGGACAGG - Intergenic
928279048 2:29928142-29928164 TCCCCAGGGATCCACAGTCCAGG + Intergenic
928372960 2:30754457-30754479 TGCCCTGTGCTCCCCAGGAATGG - Intronic
928376571 2:30779199-30779221 CCTCCAGGGATCCCCAGGGCAGG + Intronic
929511376 2:42568494-42568516 TCCCCGGGCCTCCCCCGGCCCGG + Intronic
929895902 2:45960668-45960690 TCCCCAGGGGACCACAGTACTGG - Intronic
932373491 2:71213044-71213066 TCCCCACTGCTCCCCAGGCCAGG - Intronic
932439262 2:71721518-71721540 ACCCCAGGCATTCCCAGGACTGG + Intergenic
932443004 2:71749686-71749708 TCCCCAGGGCACCTCAGCAGAGG - Intergenic
933700996 2:85255510-85255532 TTCCCAGGGAGCCCCAGGGCAGG + Intronic
933867735 2:86537612-86537634 TCCCCAGGGCTCATCAGGTTTGG + Intronic
934654455 2:96109997-96110019 TCCCCAGGGTTCCCCAGCTTGGG - Intergenic
934819571 2:97360423-97360445 TATCCAGGGCTTCCCAGGGCAGG - Intergenic
935753918 2:106262375-106262397 TCCTGATGGCTCCCCAGTACGGG - Intergenic
936855029 2:116947555-116947577 TCACAAGGCCTCCCCAAGACAGG - Intergenic
937078610 2:119124890-119124912 ACCCCAGGGCACCTCAGGAGAGG - Intergenic
937438783 2:121900004-121900026 TCCTCTGGGATCCCCAGGTCTGG - Intergenic
937869718 2:126778383-126778405 TCAGCAGGGATCCCCAGGAAGGG - Intergenic
939084820 2:137707257-137707279 ACCTCAGGGCTCCCCAGGTCAGG - Intergenic
940267784 2:151858171-151858193 TCCCCAGGGCTCCATTTGACTGG - Intronic
944743480 2:202634664-202634686 TCCCCAGGGCTCCCCCCGGCGGG + Intergenic
947392226 2:229651118-229651140 TCCCAAGGGCATCCCAGGAAAGG + Intronic
947528528 2:230894064-230894086 TCCCCAGGCCTCCCCAGGCCAGG + Intergenic
948182533 2:235993789-235993811 ACACCTGTGCTCCCCAGGACTGG - Intronic
948438030 2:237967114-237967136 TCACCTGGGCTCCCCGAGACAGG - Exonic
949010536 2:241675956-241675978 TCCCCAGTGCACCCCAGCTCCGG + Exonic
1171141705 20:22749270-22749292 TCTCTTGGGCTCCCCTGGACTGG + Intergenic
1171459595 20:25291226-25291248 TCCCAGGGTCTCCCCAGGACTGG - Intronic
1172528591 20:35616128-35616150 GCCCTCGGGCTCCCCAGGCCCGG - Exonic
1172661971 20:36574191-36574213 TCCCCAGGGCCCCCCCGCTCCGG - Intronic
1173135272 20:40433615-40433637 TCCCCAAGCTTCCCCAGGCCAGG - Intergenic
1174198080 20:48787183-48787205 TCCCCAGGCCTCCTCAGGGAGGG - Intronic
1174390375 20:50215180-50215202 TCCCGGGGGCTGCCCAGGGCTGG - Intergenic
1175368415 20:58470877-58470899 TCCCCAGGGTGCCCCAGTTCTGG + Intronic
1175468022 20:59205671-59205693 TCCACAGTGCTCCTCAGAACCGG - Intronic
1176143289 20:63554306-63554328 TCCCCTTGGCTCCCCTGGCCCGG - Exonic
1176171350 20:63697736-63697758 TTCCCAGAGCTCCCCAGGGGAGG - Intronic
1176736141 21:10548494-10548516 TCCCCAGGGCTTCCCCTGGCAGG + Intronic
1177288500 21:19080468-19080490 TCCCCAGGCCTCCCCAACAGCGG - Intergenic
1179810029 21:43864789-43864811 CCGCGAGGGCTCCCCCGGACCGG - Intergenic
1179902172 21:44399948-44399970 TCCCCAGGCCTCCCTAGGCCTGG - Intronic
1179986923 21:44927366-44927388 ACCCCAGGGGTCTCCAGGGCTGG - Intronic
1180030130 21:45201093-45201115 TCCCATGGGGTCCGCAGGACAGG + Intronic
1180074150 21:45454288-45454310 TCCCCAGCTGTCCCCAGGTCAGG - Intronic
1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG + Intronic
1180695694 22:17750202-17750224 TGACCAGGGCTTCCCAGGAGCGG - Intronic
1180696366 22:17753938-17753960 TCTCCAGGACTCTGCAGGACTGG + Intronic
1180696399 22:17754055-17754077 TCTCCAGGACTCTGCAGGACAGG + Intronic
1181043492 22:20203944-20203966 TCCACAGGCCTCCACAGGGCAGG - Intergenic
1181461471 22:23088568-23088590 TCCACAGGGGACTCCAGGACAGG + Intronic
1181504454 22:23342516-23342538 GTCCCAGTGCTCCTCAGGACAGG - Intergenic
1181560313 22:23696165-23696187 TCCCCAGGGCCCCCAAAGAGAGG - Intronic
1181655570 22:24295128-24295150 GTCCCAGTGCTCCTCAGGACAGG - Intronic
1181677141 22:24462742-24462764 TGCCCTTGGCTCCTCAGGACTGG - Intergenic
1181709450 22:24672747-24672769 GTCCCAGTGCTCCTCAGGACAGG - Intergenic
1181741984 22:24928519-24928541 TGCCCAGCACTCCCCAGGTCTGG - Intergenic
1181919714 22:26311222-26311244 GCTTCAGGGCTCCCCAGCACAGG - Intronic
1182472568 22:30557454-30557476 CCCCCAAGGCTGCCCAGGCCTGG + Intronic
1182516913 22:30864316-30864338 TCCTTTGGGCTCCCCAGCACTGG - Intronic
1182559365 22:31147726-31147748 TGCCCAAGGCTGCCCAGGAGGGG - Intergenic
1182623549 22:31630623-31630645 TCCGCGGGGCTCCTCAGGCCGGG + Intronic
1183315604 22:37135434-37135456 TCCCAAGGGCTGCCCAGGGGTGG + Exonic
1183409558 22:37646933-37646955 TGCCCAGGGCTCCCCGGATCAGG - Intronic
1183787038 22:40035546-40035568 TCACCATGGATCCCCAGGCCGGG - Exonic
1183870334 22:40736971-40736993 GCCCCAAGGCTGCCCAGGCCCGG - Intergenic
1184330885 22:43826711-43826733 TCCCCAGGGTTTGCCAGGGCAGG - Intronic
950657382 3:14444987-14445009 TCCCCAGGCCTGCCCAGGGCAGG - Intronic
950673325 3:14540039-14540061 CCCCCAGGGCTGTCCAGCACAGG - Intronic
951630607 3:24716265-24716287 TCCCCAGGGATCACCAGTTCAGG + Intergenic
951638862 3:24811356-24811378 TCCTCAGGGTTCCTCAAGACTGG - Intergenic
952784962 3:37144060-37144082 TACCCTGGGCACCCCAAGACAGG + Intronic
952905666 3:38137922-38137944 GAACCAGGGCTCCCCAGGTCAGG + Intergenic
953043888 3:39278438-39278460 TCCTCAAGGCTCTCCAGCACAGG + Intronic
953901653 3:46847046-46847068 ACCCCAGCACTCCCAAGGACCGG + Intergenic
953982632 3:47420292-47420314 TCCCCAGAGTGGCCCAGGACAGG - Intronic
954879519 3:53823948-53823970 GCCCCAGGGCTCCCCGTGCCAGG + Exonic
960970878 3:123139323-123139345 CACCCACGGCTCCCCAAGACAGG + Intronic
960973241 3:123154090-123154112 GCTCCTGGGCTCACCAGGACAGG + Intronic
960988347 3:123294982-123295004 TCCCCAGGGTGCCCCAGCCCAGG + Intronic
961355999 3:126340382-126340404 GCCCCTTGGCTCCACAGGACTGG - Intergenic
961537100 3:127576933-127576955 TCCCCAGCCCACCCCAGGCCAGG + Intronic
961677080 3:128574209-128574231 GCCACAGGGATGCCCAGGACAGG + Exonic
963085392 3:141430964-141430986 GTCCCAGAGTTCCCCAGGACAGG - Intronic
965680825 3:171249536-171249558 TCCTAAGGGCTGCCCAGGACTGG - Intronic
966207551 3:177420441-177420463 TTCCCAGGGCTCCCCAGGGTGGG + Intergenic
967097449 3:186188587-186188609 TCCCCGGAGCTGACCAGGACTGG - Intronic
967149122 3:186632140-186632162 ACCACAGGGCTGCCAAGGACTGG - Intergenic
967938013 3:194744750-194744772 TCCCCAGAGCTCCTAGGGACTGG + Intergenic
968505277 4:968447-968469 CCCCCAGGGCTCCCTGGGGCCGG + Intronic
968541966 4:1172439-1172461 TCCAGAGGGACCCCCAGGACTGG - Intronic
968753034 4:2400066-2400088 TCCCCGGAGCTCCTCAGGGCGGG + Intronic
968943559 4:3651960-3651982 TCCCCAGGATTCCCCAGGGAGGG - Intergenic
968963719 4:3758890-3758912 TACCCAGGGCTGCCCAGTGCAGG + Intergenic
969329249 4:6463554-6463576 GCCCCTGTGCTGCCCAGGACAGG - Intronic
969350040 4:6593205-6593227 TCCCCAAGCCTCCCCAAGATGGG + Exonic
969608145 4:8212452-8212474 TCCCCACCACTCCACAGGACAGG + Intronic
972174504 4:36386792-36386814 TCCCCAAGGCTCCCCATGGAAGG - Intergenic
977305602 4:95319605-95319627 TCAACAGGCTTCCCCAGGACTGG + Intronic
978540033 4:109806490-109806512 TCCTGAGGCCTCCCCAGAACCGG + Intergenic
980149989 4:129033670-129033692 TCTCCAGAGCTGCACAGGACTGG - Intronic
982600475 4:157443266-157443288 TCCACAGGGCTCTGCAGAACAGG - Intergenic
984639424 4:182145020-182145042 ACCCCGGGGCTCCCCAGTACGGG - Intronic
985492211 5:186678-186700 TCCCCAGCCCTGCCCAGGAAGGG + Exonic
985838591 5:2289062-2289084 TCCCCAGGTCTCCCTAGAAGCGG - Intergenic
986785426 5:11110136-11110158 TCTCATGGGCTCCCCAAGACAGG + Intronic
987441899 5:17967063-17967085 ACCTCAGGGCTCCCCAAGCCAGG - Intergenic
992769610 5:80035241-80035263 TGCCCAGCTCTTCCCAGGACAGG + Intronic
993048052 5:82891421-82891443 TGCCCAGGCCTCTCCTGGACTGG + Intergenic
997206103 5:132051143-132051165 TCCCCCGGGCTGACCAGCACTGG + Intergenic
997210969 5:132076478-132076500 CCCCCAGGCCTCCCCAGGAAGGG - Intergenic
997695262 5:135856472-135856494 GCCCCGGAGCTGCCCAGGACAGG + Intronic
999104908 5:149062643-149062665 TCCCGAGATCCCCCCAGGACAGG - Intronic
999262719 5:150247558-150247580 AGCCCAGGGCCCACCAGGACTGG - Intronic
999371922 5:151060966-151060988 TCCTCTGGGATCTCCAGGACTGG - Intronic
999431739 5:151530968-151530990 TCCCCATGGCTCCCCTGGAATGG - Intronic
999758590 5:154683092-154683114 TCCCCAGGCCTCTCCGGGAAAGG - Intergenic
1001051535 5:168418289-168418311 TCCCCACTGCTCCCCAGAGCTGG + Intronic
1001747571 5:174103528-174103550 TCCCCACCGCGCCCCAGCACTGG - Intronic
1002252462 5:177938389-177938411 ACCCCAGGACCCCCCAGCACAGG + Intergenic
1002419853 5:179139795-179139817 GCCACAGGGCCCTCCAGGACAGG + Intronic
1002534890 5:179870589-179870611 GCCCCAGGGCTCCGCAGGCTTGG - Intronic
1002616919 5:180461720-180461742 GCTCCTGGGCTCCCCAGGCCAGG + Intergenic
1002775445 6:324316-324338 CTCCCAGGCCTCCCCAGGAAGGG - Intronic
1003564965 6:7215040-7215062 CCCCCAGGGCTCCCCAGATGAGG + Intronic
1004424951 6:15501018-15501040 TCCCCAGAACTGCCCAGGACCGG + Exonic
1004925998 6:20415725-20415747 ACCCCATGGCACCCCAGAACTGG + Intronic
1005582654 6:27249119-27249141 TCACCAGGGCGCCCCAGGCTGGG - Exonic
1005807552 6:29488603-29488625 TACCCAAGGATGCCCAGGACTGG - Intergenic
1007223179 6:40294804-40294826 TCCTCAGGGTTCCCCAGTAACGG + Intergenic
1007336807 6:41160356-41160378 TCCCCTGGCCTCCCCAAGTCAGG + Intronic
1008546780 6:52590221-52590243 TCCCCAGGGCATGCCAGGAAAGG - Intergenic
1008879922 6:56371571-56371593 TTCTCAGGGTTCCCCAGGAAAGG + Intronic
1010734558 6:79429185-79429207 TGCTCAGGGCTCCCCTGGAGTGG + Intergenic
1011228857 6:85137508-85137530 TCCCTAGGGCTCCGCGGGACAGG + Intergenic
1011822552 6:91270956-91270978 ACCTCAGGGCCCCCCAGGCCAGG - Intergenic
1013155382 6:107488424-107488446 TCCCCTCGCCTCCCCGGGACGGG + Intergenic
1014214422 6:118738903-118738925 TACACTGGGATCCCCAGGACTGG - Intergenic
1018907827 6:168085520-168085542 CCACCATGGCTCCCCAGGACGGG + Intergenic
1019031516 6:169017984-169018006 TCCCCAGGGCTCCCTCAGGCAGG + Intergenic
1019195945 6:170283259-170283281 GCCCCAGGGCTCCTCAGGGGAGG - Exonic
1019296954 7:282714-282736 CCCCCAGCGCTCAGCAGGACAGG - Intergenic
1019395936 7:817478-817500 TCCCCAGGGCTCCCCAGGACAGG + Intronic
1019603172 7:1895426-1895448 TGCCCAGAGCTCCCCATGCCAGG + Intronic
1019713481 7:2527891-2527913 TCCCTTTGCCTCCCCAGGACAGG + Exonic
1019734489 7:2644096-2644118 TCCCCTGGGCTCCCATGGCCTGG - Intronic
1020098885 7:5383348-5383370 GACCCAGGGCTCCCCTGCACAGG + Intronic
1021798801 7:24284349-24284371 GCCCCAGGGCTCCACAGAGCGGG - Intronic
1022723809 7:32963290-32963312 CACCCAGGCCTCCCAAGGACTGG - Intronic
1023819761 7:43974064-43974086 TGCCCTGGGCCCACCAGGACAGG - Intergenic
1023973048 7:45005884-45005906 GCCCAAGGACTTCCCAGGACTGG - Intronic
1024197575 7:47074024-47074046 TCCCCAAAGCTGCCCAGGTCAGG - Intergenic
1025049816 7:55724626-55724648 CACCCAGGCCTCCCAAGGACTGG + Intergenic
1026320966 7:69267296-69267318 TCCCCAGGGGTCCCCTGGAGGGG + Intergenic
1026592701 7:71710787-71710809 TCCCCAGGGCACCCAAGTGCAGG - Exonic
1026740373 7:72975346-72975368 TCCCCAGGACTCCCTAGGGAAGG - Intergenic
1026895617 7:74008400-74008422 GCCCCATGGCCTCCCAGGACCGG + Intergenic
1026978462 7:74512978-74513000 ACCCCAGGGCTCCGGAGGGCCGG + Intronic
1027103358 7:75389724-75389746 TCCCCAGGACTCCCTAGGGAAGG + Intergenic
1027611014 7:80360600-80360622 TCCTCAGGCCTCCCCAGAAGTGG + Intergenic
1029060891 7:97797061-97797083 TCCCAAGGCCTCCCCAGAAGCGG - Intergenic
1029269256 7:99366950-99366972 GCCCCAGGGCCTCCCAGGGCAGG - Intronic
1029381737 7:100219706-100219728 TCCCCAGGCCTAGCCAGGGCTGG + Exonic
1029538389 7:101169028-101169050 TCCCCAGGATTCCCCAGCTCTGG - Intergenic
1029610265 7:101622874-101622896 TACCCTGTGCTCCCCAGCACAGG + Intronic
1029748034 7:102527517-102527539 TGCCCTGGGCCCACCAGGACAGG - Intergenic
1032683581 7:134209494-134209516 TCCCCGGGGCTCCCCTGGCCTGG - Intronic
1033275908 7:139971520-139971542 CCCGCAGGTATCCCCAGGACGGG - Intronic
1033684239 7:143624035-143624057 TCCCACGGGAGCCCCAGGACAGG - Intronic
1033687416 7:143703254-143703276 TCCCACGGGAGCCCCAGGACAGG - Exonic
1033700372 7:143833588-143833610 TCCCACGGGAGCCCCAGGACAGG + Intergenic
1034265077 7:149776858-149776880 TCCCCAGGCCTCCCCAGGGTGGG + Intergenic
1034517757 7:151594028-151594050 TCCCCAGGGACCCCCAGGTGTGG - Intronic
1035031285 7:155862760-155862782 TCCCCACGGCTTACCAGGACTGG - Intergenic
1035412040 7:158652269-158652291 TACTCAGAACTCCCCAGGACGGG - Intronic
1035671068 8:1417489-1417511 TCCACGGGGCTCACCAGGGCAGG + Intergenic
1035730879 8:1852986-1853008 TCCTCTGGCCTGCCCAGGACAGG - Intronic
1037769074 8:21788508-21788530 TCCCCTGCGCTTCCCAGGAGGGG + Exonic
1037890387 8:22621024-22621046 GCCAGAGGGCTCCCCAGGATGGG + Exonic
1038070828 8:24010896-24010918 TCCCCAAGGCTCCAGTGGACAGG - Intergenic
1039320679 8:36427110-36427132 TCCCCAGGAGTCTCCAGGATAGG - Intergenic
1040286187 8:46101606-46101628 CCCCCAGGGCTCTCCAGGGCAGG - Intergenic
1040294675 8:46143017-46143039 CCCCCAGGGCTGTCCAGGGCAGG - Intergenic
1040295829 8:46148591-46148613 TCCCCAGGGCTGTCCTGGTCGGG - Intergenic
1040312935 8:46246127-46246149 TCCCCAGGGCTGTCCTGGGCAGG + Intergenic
1040313244 8:46247646-46247668 ACCCCTGGGCTCCCCTGGGCAGG + Intergenic
1040314135 8:46252018-46252040 CCCCCTGGGCTCCCCTGGGCAGG + Intergenic
1040314608 8:46254387-46254409 TTCCCAGGGCTGTCCTGGACGGG + Intergenic
1040330956 8:46385539-46385561 CCCCCAGGGCTACCCCGGGCGGG + Intergenic
1040333269 8:46403202-46403224 GCCCCAGGGCTGCCCTGGGCAGG + Intergenic
1041596694 8:59663103-59663125 TCCCCAGAGCACCTCAGCACTGG + Intergenic
1042625193 8:70749352-70749374 ACCTCAGGGCTCCCCAAGCCAGG + Intronic
1045111884 8:98944429-98944451 TCCCCAGGCTGCCCCAGGCCGGG - Exonic
1045420497 8:102009963-102009985 ACCCAAGTGCTCCCCAGTACTGG - Intronic
1045507482 8:102788946-102788968 TCCCCAGGGCTCCTAGGGAGTGG + Intergenic
1047247540 8:123158416-123158438 TCCCCAGGGGTCCCCACGCCTGG - Intergenic
1049213816 8:141398720-141398742 TCCCCTGGGCAGCCCAGGCCTGG - Intronic
1049325158 8:142017842-142017864 TCCTCAGGCCGCTCCAGGACAGG + Intergenic
1049363473 8:142225267-142225289 ACCCCAGGGCTCTCCTGGTCTGG + Intronic
1049377691 8:142296799-142296821 CCCCACAGGCTCCCCAGGACGGG + Intronic
1049378205 8:142299065-142299087 TCTCCAGGGAGCCCGAGGACAGG + Intronic
1049562090 8:143317000-143317022 TCCCCAGGGCAGCACAGCACCGG + Intronic
1050809006 9:9719711-9719733 ACCTCAGGGCTCCCCATGTCAGG + Intronic
1052436773 9:28439686-28439708 TCCTGAGGGCTCCCCAGGCATGG + Intronic
1052818882 9:33123567-33123589 CCCCCAGGGCTGCCCAGCCCAGG + Intronic
1055760384 9:79600733-79600755 TGCCCATGGCTCCCCAAGCCTGG + Intronic
1057908564 9:99001129-99001151 TCTCCAGGGATGCACAGGACTGG + Intronic
1059451899 9:114376212-114376234 ACCCCAGGGCTCCCCACCCCAGG + Intronic
1060036631 9:120261520-120261542 CTCCCAGGGCTCCCCTGGAGAGG + Intergenic
1060727702 9:126016967-126016989 AGCCCAGGGCTCCCCTGGGCAGG - Intergenic
1060995271 9:127872222-127872244 GCCCCTGAGCTCCCCAGGGCAGG - Intronic
1061096143 9:128457483-128457505 TGGCCAGGGGTCCCCAGGGCAGG + Intronic
1061154167 9:128847073-128847095 TCCCAAGGCCCCTCCAGGACAGG - Intronic
1061348233 9:130043308-130043330 TCCCCCGGGCTCCCCCGGCCGGG + Intergenic
1061421740 9:130476520-130476542 TTCCGAGGGCTTCCCAGGAGCGG - Intronic
1061720455 9:132547847-132547869 TCCTCAGGGCTCTCCAGGCAGGG + Intronic
1061749992 9:132770708-132770730 GCCCCAGGGCTCCCCTTGAAGGG - Intronic
1061805471 9:133135360-133135382 ACCGCAGGGCTCCCCTGCACTGG + Intronic
1061866775 9:133495349-133495371 GCCCCAGGGGCCCCCAGGGCTGG + Intergenic
1061894359 9:133639470-133639492 TCCCAAGGCCTCCTCAAGACTGG - Intronic
1061908035 9:133708744-133708766 ACCCCAGGACTCCCCAGCACTGG - Intronic
1061974154 9:134059972-134059994 TCCCCTGGGCACTGCAGGACAGG + Intronic
1062046693 9:134427664-134427686 GCCCCCGGGTTCCCCATGACAGG + Intronic
1062115532 9:134806254-134806276 GCCCCAGGGACCCCCAGGGCCGG + Exonic
1062119115 9:134824593-134824615 CCCCCAGGGCCCCCCGGGAGAGG + Exonic
1062363322 9:136197645-136197667 TGCCCAGGGCTCCCGAGGGCCGG + Exonic
1062481669 9:136755230-136755252 GCCCCTGGGCTCACCAGGCCGGG + Exonic
1062529701 9:136994433-136994455 GCCTCAGGGATCTCCAGGACCGG - Intergenic
1185764057 X:2710195-2710217 TCCCCAGGACACCCCACGGCCGG - Intronic
1185999898 X:4997497-4997519 TCCCCAGATCTCACCAGGAGGGG - Intergenic
1187630853 X:21170098-21170120 TCTCCAGGGATACACAGGACTGG + Intergenic
1189281183 X:39821146-39821168 GCCCCGGGGCTCCCGAGGACTGG - Intergenic
1190221881 X:48517101-48517123 TCCCCTGGGCTCCCCCGTGCAGG + Intronic
1195179441 X:102342664-102342686 CCCACAGGGCTCCCCAGGGTGGG - Intergenic
1197044471 X:121978665-121978687 TACAAATGGCTCCCCAGGACAGG + Intergenic
1199715234 X:150503342-150503364 TCCCCAGGGCCTGGCAGGACGGG - Intronic
1200045198 X:153397271-153397293 TGCCCAGGCCTCCCCAGCCCAGG - Intergenic
1201676288 Y:16588486-16588508 TCCCCAGATCTCACCAGGAGGGG + Intergenic