ID: 1019397533

View in Genome Browser
Species Human (GRCh38)
Location 7:830093-830115
Sequence CTGTTAAGGGGGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019397523_1019397533 11 Left 1019397523 7:830059-830081 CCATTTCCAAATTTAAAATGATC 0: 1
1: 0
2: 0
3: 56
4: 500
Right 1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG No data
1019397524_1019397533 5 Left 1019397524 7:830065-830087 CCAAATTTAAAATGATCCGTGTC 0: 1
1: 0
2: 1
3: 12
4: 161
Right 1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019397533 Original CRISPR CTGTTAAGGGGGAAGGAGGA AGG Intronic
No off target data available for this crispr